Dataset for CDS MCL-1 of organism Neogobius melanostomus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6SVR4_MCL1-02      --atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg
A0A8C6SVR4_MCL1-01      gtatgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg
A0A8C6SVR4_MCL1-03      --atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg
                          ************************************************

A0A8C6SVR4_MCL1-02      ggtatgcttatgcctcaaaatggagtcgtggaggcggagggagctatgac
A0A8C6SVR4_MCL1-01      ggtatgcttatgcctcaaaatggagtc-----------------------
A0A8C6SVR4_MCL1-03      ggtatgcttatgcctcaaaatggagtcgtggaggcggagggagctatgac
                        ***************************                       

A0A8C6SVR4_MCL1-02      tatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaac
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      tatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaac
                                                                          

A0A8C6SVR4_MCL1-02      agcagagacccacagccctgcaagtcaagaacgaccattcaagaaagcac
A0A8C6SVR4_MCL1-01      -------acccacagccctgcaagtcaagaacgaccattcaagaaagcac
A0A8C6SVR4_MCL1-03      agcagagacccacagccctgcaagtcaagaacgaccattcaagaaagcac
                               *******************************************

A0A8C6SVR4_MCL1-02      aaaaacctacgggagggcgattacgaccacaactcggacggcggctcgct
A0A8C6SVR4_MCL1-01      aaaaacctacgggagggcgattacgaccacaactcggacggcggctcgct
A0A8C6SVR4_MCL1-03      aaaaacctacgggagggcgattacgaccacaactcggacggcggctcgct
                        **************************************************

A0A8C6SVR4_MCL1-02      cccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggct
A0A8C6SVR4_MCL1-01      cccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggct
A0A8C6SVR4_MCL1-03      cccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggct
                        **************************************************

A0A8C6SVR4_MCL1-02      actccgtggagaacgacacgaggcagcttctcggcgactttttcgagcta
A0A8C6SVR4_MCL1-01      actccgtggagaacgacacgaggcagcttctcggcgactttttcgagcta
A0A8C6SVR4_MCL1-03      actccgtggagaacgacacgaggcagcttctcggcgactttttcgagcta
                        **************************************************

A0A8C6SVR4_MCL1-02      atcacggggatttcgcagccgggttggctccagcgacccgctttaacgac
A0A8C6SVR4_MCL1-01      atcacggggatttcgcagccgggttggctccagcgacccgctttaacgac
A0A8C6SVR4_MCL1-03      atcacggggatttcgcagccgggttggctccagcgacccgctttaacgac
                        **************************************************

A0A8C6SVR4_MCL1-02      aatgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtaca
A0A8C6SVR4_MCL1-01      aatgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtaca
A0A8C6SVR4_MCL1-03      aatgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtaca
                        **************************************************

A0A8C6SVR4_MCL1-02      atggtaggtatgat--------aaa--caaactgtcagtggacgacaggg
A0A8C6SVR4_MCL1-01      atggtaggctgaatttgccttcaaatccaaactg-------------ggg
A0A8C6SVR4_MCL1-03      atggtaggctgaatttgccttcaaatccaaactg-------------ggg
                        ********    **        ***  *******             ***

A0A8C6SVR4_MCL1-02      ggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacg
A0A8C6SVR4_MCL1-01      ggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacg
A0A8C6SVR4_MCL1-03      ggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacg
                        **************************************************

A0A8C6SVR4_MCL1-02      gcaccaccaactggggtcggatcgccagcctgatatccttcggggcggtg
A0A8C6SVR4_MCL1-01      gcaccaccaactggggtcggatcgccagcctgatatccttcggggcggtg
A0A8C6SVR4_MCL1-03      gcaccaccaactggggtcggatcgccagcctgatatccttcggggcggtg
                        **************************************************

A0A8C6SVR4_MCL1-02      gtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagt
A0A8C6SVR4_MCL1-01      gtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagt
A0A8C6SVR4_MCL1-03      gtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagt
                        **************************************************

A0A8C6SVR4_MCL1-02      ggctgaagaaatttcctcataccttctttcagaccaacgagactggctga
A0A8C6SVR4_MCL1-01      ggctgaagaaatttcctcataccttctttcagaccaacgagactggctga
A0A8C6SVR4_MCL1-03      ggctgaagaaatttcctcataccttctttcagaccaacgagactggctga
                        **************************************************

A0A8C6SVR4_MCL1-02      tcaggaacaactcctgggatggttttgttgagttctttagagtagacgac
A0A8C6SVR4_MCL1-01      tcaggaacaactcctgggatggttttgttgagttctttagagtagacgac
A0A8C6SVR4_MCL1-03      tcaggaacaactcctgggatggttttgttgagttctttagagtagacgac
                        **************************************************

A0A8C6SVR4_MCL1-02      ccagaatcaaaagtgaggaacacacttatggctgtggccggactagcagg
A0A8C6SVR4_MCL1-01      ccagaatcaaaagtgaggaacacacttatggctgtggccggactagcagg
A0A8C6SVR4_MCL1-03      ccagaatcaaaagtgaggaacacacttatggctgtggccggactagcagg
                        **************************************************

A0A8C6SVR4_MCL1-02      aatcggtgcaaccctggccatgttaatcaggtga
A0A8C6SVR4_MCL1-01      aatcggtgcaaccctggccatgttaatcaggtga
A0A8C6SVR4_MCL1-03      aatcggtgcaaccctggccatgttaatcaggtga
                        **********************************

© 1998-2022Legal notice