Dataset for CDS Unclassified of organism Myripristis murdjan

[Download (right click)]

9 sequence(s)

>gnl|bcl2dbcds|A0A667WIR5_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Myripristis murdjan (length=624 residues).
atgcgcagagagcagtctgatatcgctgggaggaaaatgtcgtgttggctgtggaaagagaccctggctctggcagagga
ctacctgttcttctgcagcataagcacacagccagcccctccacctcccagcgagtcagccgctgccatgaggcgcctgg
cccaggacatggagacccagcaccacgctcgcttccactccctcgctcagaccttcctgcagcagtgcgggcaggacccc
tgctccagcctcaggaaggtgatggaggagctggtgggagatggacagttgaactgggggagggtggtgtccctcttcac
cttcactggggtgctggccagacagctgcgggagcaggatggcacaaagccggggctggaccccgggcaggggcaggacc
tgggacagggacccagtagctgcagaggactggcagagaccatagctgattacctaggagaggagaagaaagactggatg
ctggagaatgacagctgggaagggttttgtaagttctcccgcagtgccagagaggtgaaccaagactcctccatgaagac
agctctatttgctgctgctggggtgggcatcgcaggattgaccttcctcctgggttgtgattaa
>gnl|bcl2dbcds|A0A667WZK8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=669 residues).
atggccgaccgcgccgccgcctacgacagtcgccacatcgtggaaaactacctccgccacaagctgctgaagaagggcgt
ggcctggccgctgcacctgccgccgcgaagcccacctgcagcatcatcatcatcatcatcatcatcatcatcatctcctc
tgagcggcgaaggcgtgaggacgtcacgaagaggagccactccgtcacctgagggagaggaagaggagcccccccgagct
gctccccacgtggcacgtctgcaggacgtcctgcagcaggcgggtgacgagctggagcaacgttaccatggcgacttcaa
cgcccagatgtgtgcactcctggacgcggtgcgggacgagctgctgggggacggggtgaactgggggcgggtggtggtgc
tgctggagctgggcggggctctgtgtgtggaggcggcgaggcggcggtgggcggggcatgttgatgacatcgccagctgg
atggtggaaagtctggaggctccgcccctcagaggatggatagaaaacaacggaggatgggatgcctttgtggacctgta
cgggcaggcggggccggcagggcgctcctggtccctcaggactctggtgggactggcagcactgggagccgctgggatca
cactgggagcgctcttcacccagaagtaa
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtacatttctcataaactctcgaaacggggaatcgtgtgggaatt
cgatgatgtcagggaggaggatgctgctaataatgggtcagtagttgcccctccaccgactttggtccggcgatgccgtg
gagccagcgccgggcctgagacggagagcatcccccagctctccaaaaggctatcccagtcggacccgcacgccgccatc
cacagagtactgcgtgaggctggagacgaacttgaaagactataccagccggacttcacggagatgtcgcatcaattgta
tctgacgaccaccacggcgcagaggaggttcaccgaggtgatagacgaactgttccgggatggagtgaactggggccgga
ttatcgccttcttcgagttcgggggcacggtgtgcgtggagtgcgcgggcaaggaggagatgacatcgcaagtggaccac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagacaacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtgttcagttgctcctggccctccatcaagacggtcttcggcctggcggcgc
tcggggcagccagcctcaccatcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=1017 residues).
atgcttcttgtagtcgccgcattcatcgttgccttcgtgttgctgttgtacatgatatcgcctcttattagccccaaacc
tttgaaactgaacggggcccacgtcgtggtgacaggagggtcaagcggcattgggaagtgcattgcaatggagtgctaca
agcaaggagctttcatcaccctggtggcacgggatgaggctaaattgctccaagcaaagaaggaggtggagaaatgtgcc
atcaatgataagcaggtggtgctctgcatatcagtggacgtttcaaaggattacggccaggtggagagtgtgataaaaca
ggctcaggagaagctggggcctgttgatatgctggtgaactgtgccggaatgtccatttctggaaagtttgaagaggtgg
aggtggatcgcttcaaaaggctgatggaggtgaactacctgggcagtgtttacccaacgcgtgcggtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcatcccaggcaggccagattggcttgtttggctacacagcctactc
cccgtccaagtttgcccttcgtggcttagcagagtcactgcagatggagatgaagccatacaatatctatgtgacggtgg
cctaccccccagacaccgacacaccaggactggctgaggaaaataagacaaagcctttagagaccaagttaatctccgag
acctctggggtttgtcagccagagcaagtggccaaaatcgttgttcgggatgcggtgcaggggaactttaacagctctgt
gggtcctgacggctacatgctctcggcactcacctgtggaatgtcacctgtcacctccatcacagagggcctgcagcagg
atgcctttgtggagctgtatgacagacagagggactccgtgttcagttgctcctggccctccatcaagacggtcttcggc
ctggcggcgctcggggcagccagcctcaccatcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=1080 residues).
atgtcctctgaagaaggcttgagttcaacgatcaccgattggcttttcatcaattcctggtggctgctcctgccgttcat
catgcttcttgtagtcgccgcattcatcgttgccttcgtgttgctgttgtacatgatatcgcctcttattagccccaaac
ctttgaaactgaacggggcccacgtcgtggtgacaggagggtcaagcggcattgggaagtgcattgcaatggagtgctac
aagcaaggagctttcatcaccctggtggcacgggatgaggctaaattgctccaagcaaagaaggaggtggagaaatgtgc
catcaatgataagcaggtggtgctctgcatatcagtggacgtttcaaaggattacggccaggtggagagtgtgataaaac
aggctcaggagaagctggggcctgttgatatgctggtgaactgtgccggaatgtccatttctggaaagtttgaagaggtg
gaggtggatcgcttcaaaaggctgatggaggtgaactacctgggcagtgtttacccaacgcgtgcggtcataaccaccat
gaaggagcgaagaatgggccgcatcatgtttgtgtcatcccaggcaggccagattggcttgtttggctacacagcctact
ccccgtccaagtttgcccttcgtggcttagcagagtcactgcagatggagatgaagccatacaatatctatgtgacggtg
gcctaccccccagacaccgacacaccaggactggctgaggaaaataagacaaagcctttagagaccaagttaatctccga
gacctctggggtttgtcagccagagcaagtggccaaaatcgttgttcgggatgcggtgcaggggaactttaacagctctg
tgggtcctgacggctacatgctctcggcactcacctgtggaatgtcacctgtcacctccatcacagagggcctgcagcag
attgtgactatgggactgtttcggaccattgccctgttctacctggggagttttgacagcattgtgcgtcgctgcatgat
tcagagagagcagtcgaaagcggccgacaagagggagtaa
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-04 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=1056 residues).
atgtcctctgaagaaggcttgagttcaacgatcaccgattggcttttcatcaattcctggtggctgctcctgccgttcat
catgcttcttgtagtcgccgcattcatcgttgccttcgtgttgctgttgtacatgatatcgcctcttattagccccaaac
ctttgaaactgaacggggcccacgtcgtggtgacaggagggtcaagcggcattgggaagtgcattgcaatggagtgctac
aagcaaggagctttcatcaccctggtggcacgggatgaggtcagcagaaacgcccacagtgactctcagccagtggtgct
ctgcatatcagtggacgtttcaaaggattacggccaggtggagagtgtgataaaacaggctcaggagaagctggggcctg
ttgatatgctggtgaactgtgccggaatgtccatttctggaaagtttgaagaggtggaggtggatcgcttcaaaaggctg
atggaggtgaactacctgggcagtgtttacccaacgcgtgcggtcataaccaccatgaaggagcgaagaatgggccgcat
catgtttgtgtcatcccaggcaggccagattggcttgtttggctacacagcctactccccgtccaagtttgcccttcgtg
gcttagcagagtcactgcagatggagatgaagccatacaatatctatgtgacggtggcctaccccccagacaccgacaca
ccaggactggctgaggaaaataagacaaagcctttagagaccaagttaatctccgagacctctggggtttgtcagccaga
gcaagtggccaaaatcgttgttcgggatgcggtgcaggggaactttaacagctctgtgggtcctgacggctacatgctct
cggcactcacctgtggaatgtcacctgtcacctccatcacagagggcctgcagcagattgtgactatgggactgtttcgg
accattgccctgttctacctggggagttttgacagcattgtgcgtcgctgcatgattcagagagagcagtcgaaagcggc
cgacaagagggagtaa
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-05 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=885 residues).
gcacacctgttcggcattgggaagtgcattgcaatggagtgctacaagcaaggagctttcatcaccctggtggcacggga
tgaggctaaattgctccaagcaaagaaggaggtggagaaatgtgccatcaatgataagcaggtggtgctctgcatatcag
tggacgtttcaaaggattacggccaggtggagagtgtgataaaacaggctcaggagaagctggggcctgttgatatgctg
gtgaactgtgccggaatgtccatttctggaaagtttgaagaggtggaggtggatcgcttcaaaaggctgatggaggtgaa
ctacctgggcagtgtttacccaacgcgtgcggtcataaccaccatgaaggagcgaagaatgggccgcatcatgtttgtgt
catcccaggcaggccagattggcttgtttggctacacagcctactccccgtccaagtttgcccttcgtggcttagcagag
tcactgcagatggagatgaagccatacaatatctatgtgacggtggcctaccccccagacaccgacacaccaggactggc
tgaggaaaataagacaaagcctttagagaccaagttaatctccgagacctctggggtttgtcagccagagcaagtggcca
aaatcgttgttcgggatgcggtgcaggggaactttaacagctctgtgggtcctgacggctacatgctctcggcactcacc
tgtggaatgtcacctgtcacctccatcacagagggcctgcagcagattgtgactatgggactgtttcggaccattgccct
gttctacctggggagttttgacagcattgtgcgtcgctgcatgattcagagagagcagtcgaaagcggccgacaagaggg
agtaa
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-06 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=894 residues).
atgcttcttgtagtcgccgcattcatcgttgccttcgtgttgctgttgtacatgatatcgcctcttattagccccaaacc
tttgaaactgaacggggcccacgtcgtggtgacaggagggtcaagcggcattgggaagtgcattgcaatggagtgctaca
agcaaggagctttcatcaccctggtggcacgggatgaggctaaattgctccaagcaaagaaggaggtggagaaatgtgcc
atcaatgataagcaggtggtgctctgcatatcagtggacgtttcaaaggattacggccaggtggagagtgtgataaaaca
ggctcaggagaagctggggcctgttgatatgctggtgaactgtgccggaatgtccatttctggaaagtttgaagaggtgg
aggtggatcgcttcaaaaggctgatggaggtgaactacctgggcagtgtttacccaacgcgtgcggtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcatcccaggcaggccagattggcttgtttggctacacagcctactc
cccgtccaagtttgcccttcgtggcttagcagagtcactgcagatggagatgaagccatacaatatctatgtgacggtgg
cctaccccccagacaccgacacaccaggactggctgaggaaaataagacaaagcctttagagaccaagttaatctccgag
acctctggggtttgtcagccagagcaagtggccaaaatcgttgttcgggatgcgattgtgactatgggactgtttcggac
cattgccctgttctacctggggagttttgacagcattgtgcgtcgctgcatgattcagagagagcagtcgaaagcggccg
acaagagggagtaa
>gnl|bcl2dbcds|A0A667Z8D3_uncBCL2-07 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Myripristis murdjan (length=561 residues).
atgtcctctgaagaaggcttgagttcaacgatcaccgattggcttttcatcaattcctggtggctgctcctgccgttcat
catgcttcttgtagtcgccgcattcatcgttgccttcgtgttgctgttgtacatgatatcgcctcttattagccccaaac
ctttgaaactgaacggggcccacgtcgtggtgacaggagggtcaagcggcattgggaagtgcattgcaatggagtgctac
aagcaaggagctttcatcaccctggtggcacgggatgaggtggtgctctgcatatcagtggacgtttcaaaggattacgg
ccaggtggagagtgtgataaaacaggctcaggagaagctggggcctgttgatatgctggtgaactgtgccggaatgtcca
tttctggaaagtttgaagaggtggaggtggatcgcttcaaaattgtgactatgggactgtttcggaccattgccctgttc
tacctggggagttttgacagcattgtgcgtcgctgcatgattcagagagagcagtcgaaagcggccgacaagagggagta
a
© 1998-2020Legal notice