Dataset for CDS BCL2L1 of organism Gouania willdenowi

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5G971_BCL2L1-      atgactca---gaacagagaactggttgtgttctacatcacatacaaact
A0A8C5D4L1_BCL2L1-      atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgact
A0A8C5D4L1_BCL2L1-      atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgact
A0A8C5D4L1_BCL2L1-      atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgact
                        *** * *     *********** **   *** *   *     **  ***

A0A8C5G971_BCL2L1-      gtctcagaggaactaccctctggaccacatagtgctcaatgagcctccac
A0A8C5D4L1_BCL2L1-      ggctcagagggactttc-------ccacatc---cccgctgaggct----
A0A8C5D4L1_BCL2L1-      ggctcagagggactttc-------ccacatc---cccgctgaggct----
A0A8C5D4L1_BCL2L1-      ggctcagagggactttc-------ccacatc---cccgctgaggct----
                        * ******** ***  *       ******    * *  **** **    

A0A8C5G971_BCL2L1-      acaggaccgctgggtc-ggacgcagagcccgcagaggatgagcggacgga
A0A8C5D4L1_BCL2L1-      gcaggataccagggacaggacggtg-----gtggagaaggaaaaggc---
A0A8C5D4L1_BCL2L1-      gcaggataccagggacaggacggtg-----gtggagaaggaaaaggc---
A0A8C5D4L1_BCL2L1-      gcaggataccagggacaggacggtg-----gtggagaaggaaaaggc---
                         *****   * *** * *****  *     *  *** * **   * *   

A0A8C5G971_BCL2L1-      cacgcagtccaatggaactttgaacgcgtctccggtgcagcagcagagg-
A0A8C5D4L1_BCL2L1-      ----cagcccgactg--ccggtaacg-gcctccaggacagagacggggtg
A0A8C5D4L1_BCL2L1-      ----cagcccgactg--ccggtaacg-gcctccaggacagagacggggtg
A0A8C5D4L1_BCL2L1-      ----cagcccgactg--ccggtaacg-gcctccaggacagagacggggtg
                            *** ** *  *  *    **** * **** *  ***   * * *  

A0A8C5G971_BCL2L1-      --------ttgccgtcagcgacaa--gcctggatgcggtgaaggaagccc
A0A8C5D4L1_BCL2L1-      atcccacctcgcca-cggcgatgacgacgtggaggcggtgaagttggcgc
A0A8C5D4L1_BCL2L1-      atcccacctcgcca-cggcgatgacgacgtggaggcggtgaagttggcgc
A0A8C5D4L1_BCL2L1-      atcccacctcgcca-cggcgatgacgacgtggaggcggtgaagttggcgc
                                * ***  * ****  *   * **** *********   ** *

A0A8C5G971_BCL2L1-      tccgagacacagccaacgagtttgagctgcgctactcgctggctttcagt
A0A8C5D4L1_BCL2L1-      tcgtggagtcagccgacgagtttgaactcctcttcacgcaagcgtttaac
A0A8C5D4L1_BCL2L1-      tcgtggagtcagccgacgagtttgaactcctcttcacgcaagcgtttaac
A0A8C5D4L1_BCL2L1-      tcgtggagtcagccgacgagtttgaactcctcttcacgcaagcgtttaac
                        **   **  ***** ********** ** * ** * ***  ** ** *  

A0A8C5G971_BCL2L1-      gacctgcacagccagctgcacatcacgccggccacggcctaccagagctt
A0A8C5D4L1_BCL2L1-      gacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
A0A8C5D4L1_BCL2L1-      gacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
A0A8C5D4L1_BCL2L1-      gacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
                        ******  **  ******** ***** ** * **********   *****

A0A8C5G971_BCL2L1-      tgagaacgtgatggacgaggtgttccgggacggcgtcaactggggtcgca
A0A8C5D4L1_BCL2L1-      caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgca
A0A8C5D4L1_BCL2L1-      caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgca
A0A8C5D4L1_BCL2L1-      caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgca
                          * * *** ***************  ****************** ****

A0A8C5G971_BCL2L1-      ttgtggggctctttgcatttggtggagcactgtgtgtagagtgtgtggag
A0A8C5D4L1_BCL2L1-      tcgtgggcctttttgtcttcggaggtgtgttgtgcttggagtgttcagag
A0A8C5D4L1_BCL2L1-      tcgtgggcctttttgtcttcggaggtgtgttgtgcttggagtgttcagag
A0A8C5D4L1_BCL2L1-      tcgtgggcctttttgtcttcggaggtgtgttgtgcttggagtgttcagag
                        * ***** ** ****  ** ** ** *   ****  * ******   ***

A0A8C5G971_BCL2L1-      aaggagatgagtcctttggtgggcaggattgtggagtggatgacggtcta
A0A8C5D4L1_BCL2L1-      aaggacatgagcgagctggtgccccgcattgcagactggatgaccatgta
A0A8C5D4L1_BCL2L1-      aaggacatgagcgagctggtgccccgcattgcagactggatgaccatgta
A0A8C5D4L1_BCL2L1-      aaggacatgagcgagctggtgccccgcattgcagactggatgaccatgta
                        ***** *****     *****  * * ****  ** ********  * **

A0A8C5G971_BCL2L1-      cctggacaaccacattcagccctggatccagagcca---agggggatggg
A0A8C5D4L1_BCL2L1-      cctggatgagaacatcaacgagtggatagagagcgaaggaggaggatg--
A0A8C5D4L1_BCL2L1-      cctggatgagaacatcaacgagtggatagagagcgaaggaggaggatggg
A0A8C5D4L1_BCL2L1-      cctggatgagaacatcaacgagtggatagagagcgaaggaggaggatggg
                        ******  *  ****  *    *****  ***** *   *** *****  

A0A8C5G971_BCL2L1-      aacgctttgctgaggtcttcgggcaggatgcggtggctgagatccggcgg
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      cttcctttgcccagatcttcggacaggacgcggctgccaaggcgaggaaa
A0A8C5D4L1_BCL2L1-      cttcctttgcccagatcttcggacaggacgcggctgccaaggcgaggaaa

A0A8C5G971_BCL2L1-      tccgaggaatcttttaaaaagtggctgctggtggggatgacggtggtgac
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      gctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcac
A0A8C5D4L1_BCL2L1-      gctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcac

A0A8C5G971_BCL2L1-      cggggtggtggtgggttcgctcttcgcacaaaaacg--------------
A0A8C5D4L1_BCL2L1-      -----------------------------------gagaaccacacttat
A0A8C5D4L1_BCL2L1-      aggagttctgtttctcgtctgctacgtcaagagacgagaaccacacttat
A0A8C5D4L1_BCL2L1-      aggagttctgtttctcgtctgctacgtcaagagacggtga----------

A0A8C5G971_BCL2L1-      ----------------------------------tctgtga---------
A0A8C5D4L1_BCL2L1-      gggtcacatacctcacattgctgaacacagcgcctctgtcataccaggaa
A0A8C5D4L1_BCL2L1-      gggtcacatacctcacattgctgaacacagcgcctctgtcataccaggaa
A0A8C5D4L1_BCL2L1-      --------------------------------------------------

A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      atatttctgttggatggatgtaa---------------------------
A0A8C5D4L1_BCL2L1-      atatttctgttggatggatgtaatataacctcctccagcatcccacattc
A0A8C5D4L1_BCL2L1-      --------------------------------------------------

A0A8C5G971_BCL2L1-      ----
A0A8C5D4L1_BCL2L1-      ----
A0A8C5D4L1_BCL2L1-      ctag
A0A8C5D4L1_BCL2L1-      ----

© 1998-2023Legal notice