Dataset for CDS Unclassified of organism Varroa destructor

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A7M7IY57_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Varroa destructor (length=615 residues).
atggctaagctcgcgagagaagagcgggctcaactaattgcacttgtacacgacttctttcgctatcagctaaacaagct
aagcattcaatggagcgccgtagagaatggtcactctaaagtcactgcgtttcacgatgaacttcgtttggcgctacgtg
acctcggtgatggggttttggagacgagtcgcgaacgaatcgacgttatggcgagacagctagacgtccgtgacggctgc
gtggatgatctttttcgtggcgttattcatgaaatgttcgccgaaggaattgaatggaatcgaatcgtgttcgtgttcgt
ctttgccgtggaggttgcgcaccgccgataccgaagatcgaaagccaagcccgaatgcatctctcaaacggcccagttgc
tcaccgatagcctggctctaacggttgtaccatggttgcgtacaaactcaggctggagtggactaatacggcacagggag
cagcaacacgcgctgacgctcaaccccgccgttgtgtttgagcccgtgtgtccggggctttttcatcttttcataggggc
agctgggataatcattgtaatcctctgcgcaggcgcctacgtcaggatgagatag
>gnl|bcl2dbcds|A0A7M7M2X3_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Varroa destructor (length=615 residues).
atggctcctgctatggatacccttacgacagaggaacagcgccaggtcgttgagcttgtgcaggacttctttcggtatca
actacacaaacggggcgtccggtggaatcccccaggcgtaggagcgactacggctgatcctccagacatctgtatggctc
ttcgtggactcggtgacgagtttctagcgaaatatcgggaaaatgtcgtacagatggtggaacggtttgacctgcccaat
ggctatgtggaaccggcgtacgcttcggttctggatgaaatgttcgccgagggcatttcatggtcgcgagttgtcgtttc
gttcgttttttccgtcgaatttgcctatcatcttatagagaagcagctggcaggcgagcaatgcatcgaacagacttctc
agtggcttatgaactacaccgctttgcgagttgtaccctgggtgcgaacgcatacgggatgggcgggactcatacagttc
aaggaggagcatgaaggaagcgggagcgatgattacgcttcggtgtggcctatttttcggaacgcgttttgtggagtggc
gggcgtggcgatcggtgcattggctcttggcgcctttctaacgtcgagatcgtaa
© 1998-2023Legal notice