Dataset for CDS BCL-2 of organism Salmo trutta

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A673Z0A3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=693 residues).
atgatggcgaacgataatccttataacagtcgctttattgttgaaaaatacatccatcacaaactgttgaagaagggatt
tgtatgggaatttaatccagaaaacgattccccaaataatggctttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccagccctccgctgaaggtgtggacactgaatctcagctcccaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacagcacagagaaggtttactgctgtaatagaggagctcttccgcgacggtgtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgacccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgtcttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagcgttgttcatccagaagtga
>gnl|bcl2dbcds|A0A674B0E5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgccgctaataatgggtcgatgatttctcctcggctgggtttggcacggcggtgcc
acggggccaataacgccggcccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcagctggattcaggagaacgggggatgggaggcctttgttga
gctctatgacagacagagggactctgtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A674B8T7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttacaacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaacatgggatt
tgtatggaaatttcaagcagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgaccctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgctcgttggatgatggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgctggagtcaccatcggagccttgttcacccagaagtga
© 1998-2020Legal notice