Dataset for CDS BCL-2 of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674B0E5_BCL2-01      ---atggcaaacg---------acgacaaccgctttatagtggaaaagta
A0A673Z0A3_BCL2-01      atgatggcgaacgataatccttataacagtcgctttattgttgaaaaata
A0A674B8T7_BCL2-01      atgatggcaaacgagaatccttacaacagtcgctttattgtcgaaaaata
                           ***** ****         *  ***  ******** ** ***** **

A0A674B0E5_BCL2-01      catttgtcacaaactcttgaaacgaggatatgcgtgggatttcgaggatg
A0A673Z0A3_BCL2-01      catccatcacaaactgttgaagaagggatttgtatgggaatt--------
A0A674B8T7_BCL2-01      catccatcacaaactgttgaacatgggatttgtatggaaatt--------
                        ***   ********* *****    **** **  *** * **        

A0A674B0E5_BCL2-01      ccgaggaggaggaaggtgccgctaataatgg-gtcgatgatttctcctcg
A0A673Z0A3_BCL2-01      -taatccagaaaacgattccccaaataatggctttggggagccctctccc
A0A674B8T7_BCL2-01      -tcaagcagaaaacgattctccaaataatggctttggggacccctctaca
                           *    **  * * * *  * ********  * *  **   ***  * 

A0A674B0E5_BCL2-01      gct-----------gggtttggcacggcggtgccacggggccaataacgc
A0A673Z0A3_BCL2-01      cctaactcccctgaagtttttgcacggaggtccca---gccctccgctga
A0A674B8T7_BCL2-01      cccaactcccccgaagtttttgcacggaggtccca---gcccaccgccgc
                         *             * *** ****** *** ***   * **      * 

A0A674B0E5_BCL2-01      cggcccgggcagcgtccctagtctttccaaatggctctcccaaccggacc
A0A673Z0A3_BCL2-01      aggtgtggacactgaatctcagctcccaaacaggatcccgcaaccggacc
A0A674B8T7_BCL2-01      gggcgaggacaccgaccctccttaccaaaacaggagtccgcaacctgacc
                         **   ** **  *   **         **  **    * ***** ****

A0A674B0E5_BCL2-01      cgcatgcagctattcacagagttttgcgtgaggccggggacgaactcgaa
A0A673Z0A3_BCL2-01      gacatgcccggctccatagggtgctgcgcgaggcgggggacgagattgaa
A0A674B8T7_BCL2-01      cacatgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaa
                          *****     * ** ** **  **** ***** ** * ***  * ***

A0A674B0E5_BCL2-01      agactgtaccagcccgacttcgcagagatgtcacaccagctgtatctcac
A0A673Z0A3_BCL2-01      ataatgtatcagcgggactttgcagagatgtcggggcagttgcattttac
A0A674B8T7_BCL2-01      agaatgtatcagcgggactttgcagagatgtcggggcagttgcattttac
                        * * **** ****  ***** ***********    *** ** ** * **

A0A674B0E5_BCL2-01      atcctccacggctgagaggagatttagagaggtgatagacgagctgttca
A0A673Z0A3_BCL2-01      gcccagtacagcacagagaaggtttactgctgtaatagaggagctcttcc
A0A674B8T7_BCL2-01      acccagcacggcacagagaaggtttaccgctgtaatagatgagctcttca
                          **   ** **  **** ** ****  *  ** ***** ***** *** 

A0A674B0E5_BCL2-01      gggatggggttaactggggacggattatcgccttcttcgagttcgggggc
A0A673Z0A3_BCL2-01      gcgacggtgtaaactggggtcggattgtggctttctttgagtttggaggg
A0A674B8T7_BCL2-01      gcgacggggtaaactggggtcggattgtggctttctttgagtttggaggg
                        * ** ** ** ******** ****** * ** ***** ***** ** ** 

A0A674B0E5_BCL2-01      acaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatca
A0A673Z0A3_BCL2-01      acaatgtgcgtggagagcgtcaaccgggagatgacgacccaggtagacaa
A0A674B8T7_BCL2-01      acaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtagacaa
                        ***** ********  **** ***  ********** * ***** **  *

A0A674B0E5_BCL2-01      catcgcggtgtggatgacagagtatctaaatggaccactgctcagctgga
A0A673Z0A3_BCL2-01      cattgcccattggatgacagagtacctgaacggacccctgcagaactgga
A0A674B8T7_BCL2-01      catcgctcgttggatgatggagtacttgaacggacccctacagaactgga
                        *** **    *******  *****  * ** ***** ** *  * *****

A0A674B0E5_BCL2-01      ttcaggagaacgggggatgggaggcctttgttgagctctatgacagacag
A0A673Z0A3_BCL2-01      tccaggagaatggtgactgggacgcctttgtggagatctatgggcagcag
A0A674B8T7_BCL2-01      tccaggagaatggtggctgggacgcctttgtggagatctatgagcagcag
                        * ******** ** *  ***** ******** *** ******     ***

A0A674B0E5_BCL2-01      agggactctgtgttctgttcgtggccgtccatcaagaccgtcttcggcct
A0A673Z0A3_BCL2-01      aggatctctgtcttccactcctggccctacctaaagacagtgttcggcct
A0A674B8T7_BCL2-01      aggatctct------cactcctggccgtacctaaagacagtgttcggcct
                        ***  ****         ** ***** * * * ***** ** ********

A0A674B0E5_BCL2-01      ggctgcactgggggccgcaagccttaccatcggagcataccttacacaga
A0A673Z0A3_BCL2-01      ggccgccctgggtgcagccggagtcaccattggagcgttgttcatccaga
A0A674B8T7_BCL2-01      ggccgccctgggagccgctggagtcaccatcggagccttgttcacccaga
                        *** ** ***** ** **  *  * ***** ***** *   * *  ****

A0A674B0E5_BCL2-01      agtga
A0A673Z0A3_BCL2-01      agtga
A0A674B8T7_BCL2-01      agtga
                        *****

© 1998-2020Legal notice