Dataset for CDS BAX-like of organism Anser brachyrhynchus

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8B9C1S2_BAK1-01      atggcctcagggaacgacggagacccaccgggggcccacggacgccgggg
A0A8B9CMI6_BOK-01       at----------------ggaagtgcttcgccgatcctcagtcttcgctg
A0A8B9C1S2_BAK1-02      atggcctcagggaacgacggagacccaccgggggcccacggacgccgggg
                        **                ***    *  **  *  ** * * *  **  *

A0A8B9C1S2_BAK1-01      cagcaatgggcgcaggctgtcacaagagctcaattcagaa-gaccaggtg
A0A8B9CMI6_BOK-01       cagaggtgatggaggtgttcgacaggtctcccactgacaaggagcttgtg
A0A8B9C1S2_BAK1-02      cagcaatgggcgcaggctgtcacaagagctcaattcagaa-gaccaggtg
                        ***   **   *  *  *   *** *    * * * * ** ** *  ***

A0A8B9C1S2_BAK1-01      gcccaggagaccgaggaggtgtttcggagctacgccttctaccgctacca
A0A8B9CMI6_BOK-01       tcccaagc---------------------taaggccctctgcagagacta
A0A8B9C1S2_BAK1-02      gcccaggagaccgaggaggtgtttcggagctacgccttctaccgctacca
                         **** *                        * *** *** * *  ** *

A0A8B9C1S2_BAK1-01      acaggagagagaagagagtggggaagaagtgc------------------
A0A8B9CMI6_BOK-01       -cataaattcgaggctggtt-cgagcaggtgtcagctggagcaaacctga
A0A8B9C1S2_BAK1-02      acaggagagagaagagagtggggaagaagtgc------------------
                         **  *    ** *   **   **  * ***                   

A0A8B9C1S2_BAK1-01      --ccttggacccggagattgcggagatccagcaagagctgggcagcaccg
A0A8B9CMI6_BOK-01       cggcaatgcgccggtgcctggcggtaagctggccgaggtgtccaccatac
A0A8B9C1S2_BAK1-02      --ccttggacccggagattgcggagatccagcaagagctgggcagcaccg
                           *   *  **** *  **  *  *  * *   *** **  ** **   

A0A8B9C1S2_BAK1-01      ggagcctggtggggaggcgcctggccatcatcggcgatgacattaacaag
A0A8B9CMI6_BOK-01       tgctgcggctgggagatgagctggaatacattcgccccaacgtctaccgg
A0A8B9C1S2_BAK1-02      ggagcctggtggggaggcgcctggccatcatcggcgatgacattaacaag
                         *   * * ****       ****    ***  **    ** *  **  *

A0A8B9C1S2_BAK1-01      cggtacgacgccgagtttc-gctacatgctgaaatccttgcagcccacca
A0A8B9CMI6_BOK-01       -------------aatatcgcccgccagctgaacatctcgctgcactcgg
A0A8B9C1S2_BAK1-02      cggtacgacgccgagtttc-gctacatgctgaaatccttgcagcccacca
                                     * * **  *  *  ******   ** ** ** * *  

A0A8B9C1S2_BAK1-01      aggagaatgcctacgagtacttcaccacgatcgcctccagcctgttcgaa
A0A8B9CMI6_BOK-01       agacggtggtgacggacgccttcctagctgtagcggcgcagattttcacc
A0A8B9C1S2_BAK1-02      aggagaatgcctacgagtacttcaccacgatcgcctccagcctgttcgaa
                        **  *   *     **   ****    *  * **  *     * ***   

A0A8B9C1S2_BAK1-01      agcggcattaactggggccgggtgatcgcgctgctgggcttcggctactg
A0A8B9CMI6_BOK-01       gcaggcataacatggggcaaggtggtgtctctctacgcggtggcagcggg
A0A8B9C1S2_BAK1-02      agcggcattaactggggccgggtgatcgcgctgctgggcttcggctactg
                           ***** *  ******  **** *  * **    *   * *      *

A0A8B9C1S2_BAK1-01      catggccatccacgtctaccagcacggcataacgggcttcctccgccgca
A0A8B9CMI6_BOK-01       gctggcggtggactgcgtgcggcacgcacagccagccatggttcacacca
A0A8B9C1S2_BAK1-02      catggccatccacgtctaccagcacggcataacgggcttcctccgccgca
                          ****  *  **  *   * *****      * * * *  * * *  **

A0A8B9C1S2_BAK1-01      tcgcccgcttcgtgacggagttcatgctgcgcaaccgcatcgcccagtgg
A0A8B9CMI6_BOK-01       tcgtcgactgccttggagagttcgtc---cgcaagaccttggtgacatgg
A0A8B9C1S2_BAK1-02      tcgcccgcttcgtgacggagttcatgctgcgcaaccgcatcgcccagtgg
                        *** *  ** * *    ****** *    *****   * * *     ***

A0A8B9C1S2_BAK1-01      atcgcccagcagggaggatgggtggctgcactcgatctggacaatgttta
A0A8B9CMI6_BOK-01       ctgaaaaggcgaggaggctgggcagaca-tcacgaagtgtgttgtgaata
A0A8B9C1S2_BAK1-02      atcgcccagcagggaggatgggtggctgcactcgatctggacaatgttta
                         *      **  ***** ****  *     * ***  **     **  **

A0A8B9C1S2_BAK1-01      ca----tga-----agtacatgctgg-cggtggtggccctggtgatggtg
A0A8B9CMI6_BOK-01       ctgaccccagccttcgctcccactggcttgtggctgctgtttgcagcttt
A0A8B9C1S2_BAK1-02      ca----tga-----agtacatgctgg-cggtggtggccctggtgatggtg
                        *       *      *  *   ****   ****  **  *    *   * 

A0A8B9C1S2_BAK1-01      gggcatttagtggtacgacgcttcttcagg------------ccctga
A0A8B9CMI6_BOK-01       gggcacttcctcaaggcgatcttcttcgtgctgctgcctgagagatga
A0A8B9C1S2_BAK1-02      gggcatttagtggtacgacgcttcttcagg------------ccctga
                        ***** **  *         *******  *               ***

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice