Dataset for CDS BCL2A1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0Q365_BCL2A1-      atgt---gtccattggg-----------------aagga------gagga
A0A8C0Q365_BCL2A1-      atgtcccatctctttggtggttcttatgatgcccaacgatgttctgggga
                        ****    **  ** **                 ** **      * ***

A0A8C0Q365_BCL2A1-      agaaagactggcgtttctccctctttctgcctggtcggctggctgaccct
A0A8C0Q365_BCL2A1-      gagaaggctg---------------cctgct--gttggcttcatgttcct
                           *** ***                ****   ** ****   **  ***

A0A8C0Q365_BCL2A1-      gaagcccacgcccgagagtgacgaggaggaaggagccggcccagtggtgc
A0A8C0Q365_BCL2A1-      gtggcccacgcccgagagtgacgaggaggaaggagccggcccagtggtgc
                        *  ***********************************************

A0A8C0Q365_BCL2A1-      acacagaaattccaccagcttccacgtgccgccctgagtcacatcccgag
A0A8C0Q365_BCL2A1-      acacagaaattccaccagcttccacgtgccgccctgagtcacatcccgag
                        **************************************************

A0A8C0Q365_BCL2A1-      ccccgccagccccggcctcacagggcctcaggcagctcacgggggaccag
A0A8C0Q365_BCL2A1-      ccccgccagccccggcctcacagggcctcaggcagctcacgggggaccag
                        **************************************************

A0A8C0Q365_BCL2A1-      gctcccatcccggcgggcgggcgggccaaggatgacggactgcgagtttg
A0A8C0Q365_BCL2A1-      gctcccatcccggcgggcgggcgggccaaggatgacggactgcgagtttg
                        **************************************************

A0A8C0Q365_BCL2A1-      gctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatc
A0A8C0Q365_BCL2A1-      gctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatc
                        **************************************************

A0A8C0Q365_BCL2A1-      ccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgt
A0A8C0Q365_BCL2A1-      ccgcagcccggcccggcccccagcagagcgtccagggtgctccaggacgt
                        **************************************************

A0A8C0Q365_BCL2A1-      ggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgcttgg
A0A8C0Q365_BCL2A1-      ggccttctccgtccaggggcaggtggaaaagaacctgaagccgtgcttgg
                        **************************************************

A0A8C0Q365_BCL2A1-      acagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcag
A0A8C0Q365_BCL2A1-      acagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcag
                        **************************************************

A0A8C0Q365_BCL2A1-      gtgatggagaaggaatttgaagacggcgtcattaactggggaaggatcgt
A0A8C0Q365_BCL2A1-      gtgatggagaaggaatttgaagacggcgtcattaactggggaaggatcgt
                        **************************************************

A0A8C0Q365_BCL2A1-      gaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagc
A0A8C0Q365_BCL2A1-      gaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagc
                        **************************************************

A0A8C0Q365_BCL2A1-      gaatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagag
A0A8C0Q365_BCL2A1-      gaatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagag
                        **************************************************

A0A8C0Q365_BCL2A1-      ttcatcacgagaaacatgagagactggataagacaaaacggaggctggga
A0A8C0Q365_BCL2A1-      ttcatcacgagaaacatgagagactggataagacaaaacggaggctggga
                        **************************************************

A0A8C0Q365_BCL2A1-      aaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttc
A0A8C0Q365_BCL2A1-      aaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttc
                        **************************************************

A0A8C0Q365_BCL2A1-      tggaagttctgggaacagtgtgtgaaatgtggtcacacctaaagcaatac
A0A8C0Q365_BCL2A1-      tggaagttctgggaacagtgtgtgaaatgtggtcacacctaaagcaatac
                        **************************************************

A0A8C0Q365_BCL2A1-      tactga
A0A8C0Q365_BCL2A1-      tactga
                        ******

© 1998-2022Legal notice