Dataset for CDS BCL2A1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0MTY3_BCL2A1-      ---------------------------------------------atgtc
A0A8I3MYG9_BCL2A1-      atgagcatgatacaggaatgtgcatcactgctggggagaaataaaatgtc
                                                                     *****

A0A8C0MTY3_BCL2A1-      ccatctctttggtggttcttatgatgcccaacgatgttctggggagagaa
A0A8I3MYG9_BCL2A1-      ccatctctttggtggttcttatgatgcccaacgatgttctggggagagaa
                        **************************************************

A0A8C0MTY3_BCL2A1-      ggctgcctgctgttggcttcatgttcctgtggcccacgcccgagagtgac
A0A8I3MYG9_BCL2A1-      ggctgcctgctgttggcttcatgttcctgtggcccacgcccgagagtgac
                        **************************************************

A0A8C0MTY3_BCL2A1-      gaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttc
A0A8I3MYG9_BCL2A1-      gaggaggaaggagccggcccagtggtgcacacagaaattccaccagcttc
                        **************************************************

A0A8C0MTY3_BCL2A1-      cacgtgccgccctgagtcacatcccgagccccgccagccccggcctcaca
A0A8I3MYG9_BCL2A1-      cacgtgccgccctgagtcacatcccgagccccgccagccccggcctcaca
                        **************************************************

A0A8C0MTY3_BCL2A1-      gggcctcaggcagctcacgggggaccaggctcccatcccggcgggcgggc
A0A8I3MYG9_BCL2A1-      gggcctcaggcagctcacgggggaccaggctcccatcccggcgggcgggc
                        **************************************************

A0A8C0MTY3_BCL2A1-      gggccaaggatgacggactgcgagtttggctacacgctggcgctggccca
A0A8I3MYG9_BCL2A1-      gggccaaggatgacggactgcgagtttggctacacgctggcgctggccca
                        **************************************************

A0A8C0MTY3_BCL2A1-      ggactacgtgaggcacgtcctgcagatcccgcagcccggcccggccccca
A0A8I3MYG9_BCL2A1-      ggactacgtgaggcacgtcctgcagatcccgcagcccggcccggccccca
                        **************************************************

A0A8C0MTY3_BCL2A1-      gcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcag
A0A8I3MYG9_BCL2A1-      gcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcag
                        **************************************************

A0A8C0MTY3_BCL2A1-      gtggaaaagaacctgaagccgtgcttggacagttttgacgtggtgtctgt
A0A8I3MYG9_BCL2A1-      gtggaaaagaacctgaagccgtgcttggacagttttgacgtggtgtctgt
                        **************************************************

A0A8C0MTY3_BCL2A1-      cgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaag
A0A8I3MYG9_BCL2A1-      cgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaag
                        **************************************************

A0A8C0MTY3_BCL2A1-      acggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaagga
A0A8I3MYG9_BCL2A1-      acggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaagga
                        **************************************************

A0A8C0MTY3_BCL2A1-      attctcaccaagaaactcctcgagcagcgaatttcctcggatgtggatgc
A0A8I3MYG9_BCL2A1-      attctcaccaagaaactcctcgagcagcgaatttcctcggatgtggatgc
                        **************************************************

A0A8C0MTY3_BCL2A1-      cgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagag
A0A8I3MYG9_BCL2A1-      cgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagag
                        **************************************************

A0A8C0MTY3_BCL2A1-      actggataagacaaaacggaggctgggaaaacggctttgtgaagaagttc
A0A8I3MYG9_BCL2A1-      actggataagacaaaacggaggctgggaaaacggctttgtgaagaagttc
                        **************************************************

A0A8C0MTY3_BCL2A1-      gaacccaagtctggatggctgacttttctggaagttctgggaacagtgtg
A0A8I3MYG9_BCL2A1-      gaacccaagtctggatggctgacttttctggaagttctgggaacagtgtg
                        **************************************************

A0A8C0MTY3_BCL2A1-      tgaaatgtggtcacacctaaagcaatactactga
A0A8I3MYG9_BCL2A1-      tgaaatgtggtcacacctaaagcaatactactga
                        **********************************

© 1998-2023Legal notice