Dataset for CDS BCL2A1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


E2RS00_BCL2A1-02      atgtcccatc----------------------------------------
E2RS00_BCL2A1-01      atgacccagccgggaaccaggttctggagagggagcgaacattccatcag
                      *** **** *                                        

E2RS00_BCL2A1-02      --------------------------------------------------
E2RS00_BCL2A1-01      ggcagattccgcaaaggctaaagtcccatatgtcatcagtgtgcccgggt
                                                                        

E2RS00_BCL2A1-02      -------------------------------------------------t
E2RS00_BCL2A1-01      gggaggccaggctccgtgacccagagggctccaccaggcccccgcccggc
                                                                        

E2RS00_BCL2A1-02      ctttggtggttctta-------tgatgcccaacgatgttc--tggggaga
E2RS00_BCL2A1-01      cctcagggactcccaggcacgctaatgacaaatg-tgtccattgggaagg
                      * *  * *  **  *       * *** * ** * *** *  **** ** 

E2RS00_BCL2A1-02      gaagg---------------------------ctgcctg-----------
E2RS00_BCL2A1-01      agaggaagaaagactggcgtttctccctctttctgcctggtcggctggct
                        ***                           *******           

E2RS00_BCL2A1-02      ------------------------------------------------ct
E2RS00_BCL2A1-01      gaccctgaaggtacagctgggtgggggtggcaacagaacccccaggacct
                                                                      **

E2RS00_BCL2A1-02      gttggctt------------------------------------------
E2RS00_BCL2A1-01      gccagctcaaaggttcaggaaagtcaacacacagattttccagaggagga
                      *   ***                                           

E2RS00_BCL2A1-02      -----------catgttcct------------------------------
E2RS00_BCL2A1-01      gcaaagtagaacagggtcctcggctgccagacttcagacccggggtgact
                                 ** * ****                              

E2RS00_BCL2A1-02      -------------------------------------gtg----------
E2RS00_BCL2A1-01      gggcagccaacacgccggaggtctgcctggaagcccagtgctgggccatg
                                                           ***          

E2RS00_BCL2A1-02      ------------------gcccacgcccgagagtgacgaggaggaaggag
E2RS00_BCL2A1-01      ggaatctggcaggagcaagcccacgcccgagagtgacgaggaggaaggag
                                        ********************************

E2RS00_BCL2A1-02      ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
E2RS00_BCL2A1-01      ccggcccagtggtgcacacagaaattccaccagcttccacgtgccgccct
                      **************************************************

E2RS00_BCL2A1-02      gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
E2RS00_BCL2A1-01      gagtcacatcccgagccccgccagccccggcctcacagggcctcaggcag
                      **************************************************

E2RS00_BCL2A1-02      ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatga
E2RS00_BCL2A1-01      ctcacgggggaccaggctcccatcccggcgggcgggcgggccaaggatga
                      **************************************************

E2RS00_BCL2A1-02      cggactgcgagtttggctacacgctggcgctggcccaggactacgtgagg
E2RS00_BCL2A1-01      cggactgcgagtttggctacacgctggcgctggcccaggactacgtgagg
                      **************************************************

E2RS00_BCL2A1-02      cacgtcctgcagatcccgcagcccggcccggcccccagcagagcgtccag
E2RS00_BCL2A1-01      cacgtcctgcagatcccgcagcccggcccggcccccagcagagcgtccag
                      **************************************************

E2RS00_BCL2A1-02      ggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacc
E2RS00_BCL2A1-01      ggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacc
                      **************************************************

E2RS00_BCL2A1-02      tgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccaga
E2RS00_BCL2A1-01      tgaagccgtgcttggacagttttgacgtggtgtctgtcgacacggccaga
                      **************************************************

E2RS00_BCL2A1-02      accatattcaatcaggtgatggagaaggaatttgaagacggcgtcattaa
E2RS00_BCL2A1-01      accatattcaatcaggtgatggagaaggaatttgaagacggcgtcattaa
                      **************************************************

E2RS00_BCL2A1-02      ctggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaaga
E2RS00_BCL2A1-01      ctggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaaga
                      **************************************************

E2RS00_BCL2A1-02      aactcctcgagcagcgaatttcctcggatgtggatgccgagaaggtttcc
E2RS00_BCL2A1-01      aactcctcgagcagcgaatttcctcggatgtggatgccgagaaggtttcc
                      **************************************************

E2RS00_BCL2A1-02      tacttcgtggcagagttcatcacgagaaacatgagagactggataagaca
E2RS00_BCL2A1-01      tacttcgtggcagagttcatcacgagaaacatgagagactggataagaca
                      **************************************************

E2RS00_BCL2A1-02      aaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctg
E2RS00_BCL2A1-01      aaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctg
                      **************************************************

E2RS00_BCL2A1-02      gatggctgacttttctggaagttctgggaacagtgtgtgaaatgtggtca
E2RS00_BCL2A1-01      gatggctgacttttctggaagttctgggaacagtgtgtgaaatgtggtca
                      **************************************************

E2RS00_BCL2A1-02      cacctaaagcaatactactga
E2RS00_BCL2A1-01      cacctaaagcaatactactga
                      *********************

© 1998-2020Legal notice