Dataset for CDS Unclassified of organism Ictalurus punctatus

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A2D0PSX4_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictalurus punctatus (length=615 residues).
atggcaaaccaaagtccctatgataatcgggatatcgttgagaagtatctgtatcacaaacttttgaagcgaggctacgt
gtgggagttccgcgctggagcagaggaaggcgacggattgagggagccgccggcggaagttgtggatcgcaggccgcgcg
ccgtcttaccgctgcaccgcgttctccgggaggccggcgatgagatcgagcggacgtaccagcgcgacttcgcggccatg
tcggaccagctgcactttaccccgagcaccgcgcagcgccgcttcaccgccgtcatcgaggagctgttccgggacggcgt
gaactggggccgcatcgtggtcttcttcgagttcgggagcaccctgtgcgtggagagcgtgaaccaggagatggcgtccc
aggtggacaacatagcaagttggatgacggattacctgaacgggccattgcagaactggattcgggacaatggaggctgg
gatgcctttgtggagctctacagtcatcagagagcgtccatgttccacccctggccatatttaaagacagtctttggcct
ggcagcattgggagcagcgggagtcaccatcggcgccctcttttctcaaaagtga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0QV33_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atgtcctgttggttaaggaaagagactctgatgttggcagaagactacatcgacttctgcatcgggaaccagcagatgcc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcacgttcctggcggcgtgcggcttgaaatcggaccggagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgctttcacgggcgttgtcgccaccgagatgtcctcccgagg
agacggagtggagaactgcaggaagctcgccgagaccatcgctgattacctggtcaaagagaggagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcatgtcagttacgattcgtccatgaagacggcg
ctgttcgcggcagcgggagtcggcttggctggactgaccttcctcctagtgcgctga
>gnl|bcl2dbcds|A0A2D0REW4_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=537 residues).
atggcctgttggttaaggaaagagactctgatgctggccgaagactacatcgacttctgcatcgggaaccagcagatacc
tcccagcaagtcggccgaggccatgcgccgtgtggcgaaggatctggagctccagtacaagaccaagttcctgtctatgt
cgcgcatgttcctgtcgacgtgcggcttgaaatcggacctgagcacctgtctgcgcagcgtcatgaccttgctggtggag
gacggaaagctgaactggggaagaatcgtctcgctgttcgcgttcacgggcgtcgtcgccgtcgagatgtcctccagagg
agacggagtggagagctgcaggaaactcgccgagaccatcgctgactacctggttaaagagaagagcgactggctgctgg
agaatggaggctgggacggtttctgcaggttcttcagcagcaccgatcacgtcagtcacgatttgtccatgaagacggtg
ctgttcgcagccgcgggagtctgcttggctggactgaccttcctgctaatgcgctga
>gnl|bcl2dbcds|A0A2D0SDG7_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictalurus punctatus (length=777 residues).
atgagtatgagcatgatgaagaggaccgctccgctgagtttactgtattgtggagtagaaaatggcggcggtgttagtgg
tgttttccgttctagagctccagtacagactttcccacagaaacgcgaggaggagctggacggctacacggaggaggtcg
acggaaggactgttaaaaccgtgattaatgagatcgaagtgccgctggagagccggttactgcttcaggacagcggctgc
gatgagcggatcataccggacctggagacggaaacccgggcgctgctcatgcagttgtaccgctgtcacatagggcttca
ccccgggaacaacacacacccagcgctgccgagcctgcagagagtggtggggaaactgctctgcaaacacaggatcacct
acagcggcatggtgcagcggctgttcgaccaggccaatggactggacagtgtgagttccgtgttgagcggtgtgttcagt
ggcggcgtggtgagttggggccgcatcgcgagtgttctggctctgggagccgtggtgtgtgagcggctgaagcaggagtg
tgtgaaggaacaagcagaggagtgtgtggacgtcgttacctcacacatctcctcataccttagcaaagacctacagcact
ggttcatcaacaacaacagctggaatggttttgtggagttcttccgtgtcgaggatcccgaggccacagttcggaacaca
ctcatggcagtggccggattgggaataggggcatgtctgttcacgctgatgcggtga
>gnl|bcl2dbcds|W5UHJ6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictalurus punctatus (length=615 residues).
atggcgaacggaaatctatacgataaccggcgcatcgtggaaaagtatctgaaccacaaactgtcgaaaaacggccacgc
gcgggagttccatcggtgccgcgcgagcagcctggacggccaggaggagcgcgagaaggagagctcgcgccgcgtaactc
tgcacatggctttgcgcgaggccggtgacgaactggaaagcttgtaccgaccggagttggcggagatggtgaagggcctg
cgcgcgacatccgtgggcacggagcagccgcggttcgtggccgtggcggacgagctgttccgcgatggagtcaactgggg
tcgcgtggtggcatttttcgagtacggcgcgatggtgtgcgtgcagtgcgctccggagaccgagaggaacgcgtgtgccg
agaacgtcgcgcgctggatggccgagtacctgaacggcccgctgaacgactggatccaggagaacggaggatgggatgcc
tttgtggagctgtacacgaggaaaaaggattcggtgttcagcagctcctggccgtccttaacaacgtccgtcttcagttt
ggcggcactgggggcagtcggtctcaccattggggcttatctgactcagaaatga
© 1998-2020Legal notice