Dataset for CDS BCL2L10 of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9Y853_BCL2L10      atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcg
A0A8B9Y853_BCL2L10      atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcg

A0A8B9Y853_BCL2L10      gacccccggtagaggcggagccatggtggacccgtttagggagcgcaccg
A0A8B9Y853_BCL2L10      gacccccggtagaggcggagccatggtggacccgtttagggagcgcaccg

A0A8B9Y853_BCL2L10      cccggctgctgatggactacctggagttctgcgcccgggagcccggcact
A0A8B9Y853_BCL2L10      cccggctgctgatggactacctggagttctgcgcccgggagcccggcact

A0A8B9Y853_BCL2L10      ccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggc
A0A8B9Y853_BCL2L10      ccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggc

A0A8B9Y853_BCL2L10      cgcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgct
A0A8B9Y853_BCL2L10      cgcacgtatccaggaagcaaatcgaaacgtcttgcccctataccgccgct

A0A8B9Y853_BCL2L10      gccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactc
A0A8B9Y853_BCL2L10      gccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactc

A0A8B9Y853_BCL2L10      gacgaagaccctggccccagctggggccgcgtggcctcactcgtgacctt
A0A8B9Y853_BCL2L10      gacgaagaccctggccccagctggggccgcgtggcctcactcgtgacctt

A0A8B9Y853_BCL2L10      tgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga
A0A8B9Y853_BCL2L10      tgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga

A0A8B9Y853_BCL2L10      agagagacgacgacggcgttagcagggactgtcggctcctggtggccctt
A0A8B9Y853_BCL2L10      agagagacgacgacggcgttagcagggactgtcggctcctggtggccctt

A0A8B9Y853_BCL2L10      ctgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacgg
A0A8B9Y853_BCL2L10      ctgtgtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacgg

A0A8B9Y853_BCL2L10      cggctgggatggattttgtctcttcttcagccactcattccagccatctt
A0A8B9Y853_BCL2L10      cggctgggatggattttgtctcttcttcagccactcattccagccatctt

A0A8B9Y853_BCL2L10      gggaaagacagctggtctggtttttcctctcatactggacagcaataatc
A0A8B9Y853_BCL2L10      gggaaagacagctggtctggtttttcctctcatactggacagcaataatc

A0A8B9Y853_BCL2L10      ataatctacttctggataaaattatcttttcttcacataggtcctg-tgt
A0A8B9Y853_BCL2L10      ataatctacttctggataaaattatcag---ccaacatggacccagccaa
                        **************************        **** *  ** *    

A0A8B9Y853_BCL2L10      tcttgccagacgtattccagctctttgacttacgtcaccattgggaa---
A0A8B9Y853_BCL2L10      gcttgtcag--------cagccaggggaataacatctgtgtggataaaaa
                         **** ***        ****     ** * ** **    * *  **   

A0A8B9Y853_BCL2L10      -------tag
A0A8B9Y853_BCL2L10      gccagcctag

© 1998-2023Legal notice