Dataset for CDS BCL-2-like of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7E8V5_BCL2A1-01       atgacag-----actgtgaatttggatata-----tttacaggctagctc
F7H6U5_BCL2L10-01      atggctgaccc-gttgcgggagcgcaccgagcggctcc--tggccgac--
F7G4L5_BCL2L2-01       atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
F7G4L5_BCL2L2-02       atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                       *** *            *       *   *     *     ***   *  

F7E8V5_BCL2A1-01       aggac-------------------------tatttgcagtacgttctgca
F7H6U5_BCL2L10-01      ------------------------------tatctggggtgctgcgcccg
F7G4L5_BCL2L2-01       tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
F7G4L5_BCL2L2-02       tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                                                     * * **  *  *      * 

F7E8V5_BCL2A1-01       gata----ccacaacctggatcg--ggtccaag-caaaacgtccagagtg
F7H6U5_BCL2L10-01      ggaa---cccggca------cccctgagccaaggccgtccacgcccgagg
F7G4L5_BCL2L2-01       gggagggcccagcagctgacccgctgcaccaag-----ccatgcgggcag
F7G4L5_BCL2L2-02       gggagggcccagcagctgacccgctgcaccaag-----ccatgcgggcag
                       *  *    **   *       *   *  *****      *   *     *

F7E8V5_BCL2A1-01       ctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaa
F7H6U5_BCL2L10-01      ccgccgt--gctgcgctccgcggccgccaggttacg--gcagctccaccg
F7G4L5_BCL2L2-01       ctg--ga--gatgagttcgagacccgc----ttccggcgcaccttctctg
F7G4L5_BCL2L2-02       ctg--ga--gatgagttcgagacccgc----ttccggcgcaccttctctg
                       *        * **   **     **          *    *    *    

F7E8V5_BCL2A1-01       gccatgcttggacaatgttaatgttgcatccatagacactgc-------c
F7H6U5_BCL2L10-01      gtccttc--ttctccgcctaccgcggctaccccgggaaccgcgtcgagct
F7G4L5_BCL2L2-01       atctggc--ggctcagctgcatgtg---accccaggctcagca------c
F7G4L5_BCL2L2-02       atctggc--ggctcagctgcatgtg---accccaggctcagca------c
                         *   *               *      **   *   * **        

F7E8V5_BCL2A1-01       ag-aacactattcaatcaag------tgatggaaaaggagtttgaagatg
F7H6U5_BCL2L10-01      ggtggcgctgatggcggaggccgtgctctccgacagcccc---------g
F7G4L5_BCL2L2-01       agcaacgct--tcacccagg------tctccgatgaacttttccaagggg
F7G4L5_BCL2L2-02       agcaacgct--tcacccagg------tctccgatgaacttttccaagggg
                        *   * **  *     * *      *    **                *

F7E8V5_BCL2A1-01       gcatcattaactggggaagaattgtaaccatatttgcatttgaaggtatt
F7H6U5_BCL2L10-01      gcccc---acctggggcagggtggtgtcgctggtgaccttcgcggggacg
F7G4L5_BCL2L2-01       gcccc---aactggggccgccttgtagccttctttgtctttggggctgca
F7G4L5_BCL2L2-02       gcccc---aactggggccgccttgtagccttctttgtctttggggctgca
                       **  *   * ******  *  * **  *  *  *    ** *  *     

F7E8V5_BCL2A1-01       ct----------------------catcaagaaacttctacgacagcgaa
F7H6U5_BCL2L10-01      ctgct------------------ggagagagagccgctggtgacagcctg
F7G4L5_BCL2L2-01       ctgtgtgctgagagtgtcaacaaggagatggaaccactggtg--ggacaa
F7G4L5_BCL2L2-02       ctgtgtgctgagagtgtcaacaaggagatggaaccactggtg--ggacaa
                       **                       *    **  *      *   *    

F7E8V5_BCL2A1-01       ttgccccggatgtggatact-----tataaggagatttcgtattttgttg
F7H6U5_BCL2L10-01      gtggaagaagcggggcttccagccgcggctgaagg---agcaggagggcg
F7G4L5_BCL2L2-01       gtgcagga---gtggatggtggcc-tacctggaga---cgcggctggctg
F7G4L5_BCL2L2-02       gtgcagga---gtggatggtggcc-tacctggaga---cgcggctggctg
                        **        * ** *             * **     *      *  *

F7E8V5_BCL2A1-01       -ctgagttcataatgaataacacaggaga--atggataaggcaaa-----
F7H6U5_BCL2L10-01      acgtcgcccgggactgccagcgcctggtggccttgctgagctcgcggctc
F7G4L5_BCL2L2-01       actggatccacagcagtgggggctgggcg--------gagttcacagctc
F7G4L5_BCL2L2-02       actggatccacagcagtgggggctgggag--ctggaagctatcaaagctc
                        *      *             *  *                        

F7E8V5_BCL2A1-01       ------------------------------------------------ac
F7H6U5_BCL2L10-01      ------------------------------------------------gc
F7G4L5_BCL2L2-01       tatacgggg---------------------------------------ac
F7G4L5_BCL2L2-02       gagtcagggagatggaggaagaagctgagaagctaaaggagctacagaac

F7E8V5_BCL2A1-01       ggag----------------------------------------------
F7H6U5_BCL2L10-01      gggg----------------------------------cagcaccgcgcc
F7G4L5_BCL2L2-01       gggg----------------------------------------------
F7G4L5_BCL2L2-02       gaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccc
                       *  *                                              

F7E8V5_BCL2A1-01       ----------------gctgggaaaatggcttt-----------------
F7H6U5_BCL2L10-01      tggcttcaggctcagggcggctgggatggcttttgtcacttcttc-----
F7G4L5_BCL2L2-01       -----------ccctggaggaggcg-cggcgtctg---------------
F7G4L5_BCL2L2-02       agtgatcatgtccattgaggagaagatggaggctgatgcccgttccatct
                                       *  *       **                     

F7E8V5_BCL2A1-01       -----------------------------gtaaagaagtt----------
F7H6U5_BCL2L10-01      ---------------------------------aggagcc----------
F7G4L5_BCL2L2-01       ---------------------------cgggaggggaactgg--------
F7G4L5_BCL2L2-02       atgttggcaatgtggactatggtgcaacagcagaagagctggaagctcac

F7E8V5_BCL2A1-01       --------------------------------------------------
F7H6U5_BCL2L10-01      --------------------------------------------------
F7G4L5_BCL2L2-01       --------------------------------------------------
F7G4L5_BCL2L2-02       tttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatt

F7E8V5_BCL2A1-01       -------------------------------------------------t
F7H6U5_BCL2L10-01      ------cctttccgctggcttt---------------------------t
F7G4L5_BCL2L2-01       ----------------------------------------------gcat
F7G4L5_BCL2L2-02       tagtggccatcccaaaggatttgcgtatatagagttctcagacaaagagt

F7E8V5_BCL2A1-01       gaacctaaat----------------------------------------
F7H6U5_BCL2L10-01      tggagaaaac----------------------------------------
F7G4L5_BCL2L2-01       cagtgaggac----------------------------------------
F7G4L5_BCL2L2-02       cagtgaggacttccttggccttagatgagtccctatttagaggaaggcaa

F7E8V5_BCL2A1-01       ----------------------------------------------ctgg
F7H6U5_BCL2L10-01      -------tg-------------------------------------ctga
F7G4L5_BCL2L2-01       -----agtg-------------------------------------ctga
F7G4L5_BCL2L2-02       atcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacaga
                                                                     * * 

F7E8V5_BCL2A1-01       ctggatgacttttc------------------------------------
F7H6U5_BCL2L10-01      tcca--ggctttcctgg---------------------------------
F7G4L5_BCL2L2-01       cggg--gg------------------------------------------
F7G4L5_BCL2L2-02       ccgg--ggttttccacgagcccgctaccgcgcccggaccaccaactacaa

F7E8V5_BCL2A1-01       ---------------------tagaagttacaggaaagatctgtgaaatg
F7H6U5_BCL2L10-01      ---------------------catgcttgttagcaacagccttcg----g
F7G4L5_BCL2L2-01       ---------------------ccgtggc----actgggggccctg-----
F7G4L5_BCL2L2-02       cagttcccgctctcgattctacagtggttttaacagcaggccccggg--g
                                                               *   *     

F7E8V5_BCL2A1-01       ctatctctcctgaagca-------------------atactgt-------
F7H6U5_BCL2L10-01      ttatctctggacacgat--------------------tatta--------
F7G4L5_BCL2L2-01       --gtaactgtaggggcc--------------------ttttttgctagca
F7G4L5_BCL2L2-02       tcgtgtctacaggggccgggctagagcgacatcatggtattccccttac-
                          *  **      *                      *  *         

F7E8V5_BCL2A1-01       --tga
F7H6U5_BCL2L10-01      --tga
F7G4L5_BCL2L2-01       agtga
F7G4L5_BCL2L2-02       --taa
                         * *

© 1998-2020Legal notice