Dataset for CDS BCL-2-like of organism Macaca mulatta

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F7E8V5_BCL2A1-01        atgacagact----------------------------------------
A0A5F7ZZ15_BCL2-01      atggcgcacgctgggagaacag----------------------------
F7H6U5_BCL2L10-01       atggctgaccc---------------------------------------
F7HUE9_MCL1-01          atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A5F7ZJK5_BCL2L1-      at------------------------------------------------
A0A5F7ZJK5_BCL2L1-      at------------------------------------------------
A0A5F7ZJK5_BCL2L1-      at------------------------------------------------
A0A5F7ZJK5_BCL2L1-      at------------------------------------------------
A0A5F7ZJK5_BCL2L1-      at------------------------------------------------
F7G4L5_BCL2L2-03        atggcggcggc---------------------------------------
F7G4L5_BCL2L2-01        atggcgacccc---------------------------------------
F7G4L5_BCL2L2-02        atggcgacccc---------------------------------------

F7E8V5_BCL2A1-01        --------------------gtgaatttggatatatt---------taca
A0A5F7ZZ15_BCL2-01      -------------------------ggtacgataacc----------ggg
F7H6U5_BCL2L10-01       --------------------gttgcgggagcg-cacc---------gagc
F7HUE9_MCL1-01          gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A5F7ZJK5_BCL2L1-      -----------------------gtctcagagcaacc----------ggg
A0A5F7ZJK5_BCL2L1-      -----------------------gtctcagagcaacc----------ggg
A0A5F7ZJK5_BCL2L1-      -----------------------gtctcagagcaacc----------ggg
A0A5F7ZJK5_BCL2L1-      -----------------------gtctcagagcaacc----------ggg
A0A5F7ZJK5_BCL2L1-      -----------------------gtctcagagcaacc----------ggg
F7G4L5_BCL2L2-03        ----------------ggcggcggcggcagcagcagc----------ggg
F7G4L5_BCL2L2-01        ----------------agcctcggccccagacaca-c----------ggg
F7G4L5_BCL2L2-02        ----------------agcctcggccccagacaca-c----------ggg

F7E8V5_BCL2A1-01        ggctagctcaggactatttgcagtacgttctg------------------
A0A5F7ZZ15_BCL2-01      agatagtgatgaagtacatccactataagctgtcgcagaggggctacgag
F7H6U5_BCL2L10-01       ggctcctggccgactatctggggt--------------------------
F7HUE9_MCL1-01          ggcttttggctacggagaaggagg--------------------------
A0A5F7ZJK5_BCL2L1-      agctggtggttgactttctctcctacaagctttcccagaaaggatacagc
A0A5F7ZJK5_BCL2L1-      agctggtggttgactttctctcctacaagctttcccagaaaggatacagc
A0A5F7ZJK5_BCL2L1-      agctggtggttgactttctctcctacaagctttcccagaaaggatacagc
A0A5F7ZJK5_BCL2L1-      agctggtggttgactttctctcctacaagctttcccagaaaggatacagc
A0A5F7ZJK5_BCL2L1-      agctggtggttgactttctctcctacaagctttcccagaaaggatacagc
F7G4L5_BCL2L2-03        ggctgcgggcggtc----ggggctccggg---------------------
F7G4L5_BCL2L2-01        ctctggtggcagactttgtaggttataag---------------------
F7G4L5_BCL2L2-02        ctctggtggcagactttgtaggttataag---------------------

F7E8V5_BCL2A1-01        ----------------------------------cagataccacaacctg
A0A5F7ZZ15_BCL2-01      tgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcacc
F7H6U5_BCL2L10-01       ----------------------------------gctgcgccc-------
F7HUE9_MCL1-01          ----------------------------------cctcggcccggcgaga
A0A5F7ZJK5_BCL2L1-      tggagtcaatttagtgatgtggaagagaacaggactgaggccccagaagg
A0A5F7ZJK5_BCL2L1-      tggagtcaatttagtgatgtggaagagaacaggactgaggccccagaagg
A0A5F7ZJK5_BCL2L1-      tggagtcaatttagtgatgtggaagagaacaggactgaggccccagaagg
A0A5F7ZJK5_BCL2L1-      tggagtcaatttagtgatgtggaagagaacaggactgaggccccagaagg
A0A5F7ZJK5_BCL2L1-      tggagtcaatttagtgatgtggaagagaacaggactgaggccccagaagg
F7G4L5_BCL2L2-03        ----------------------------------ccggggc----ggcgg
F7G4L5_BCL2L2-01        ----------------------------------ctgaggc----agaag
F7G4L5_BCL2L2-02        ----------------------------------ctgaggc----agaag

F7E8V5_BCL2A1-01        ga----------------------------------------------tc
A0A5F7ZZ15_BCL2-01      gggcatcttctcctcccagcccgggcacacgccccatcccgccgcgtccc
F7H6U5_BCL2L10-01       --------------gggaacccggcac---------------cc----ct
F7HUE9_MCL1-01          gatag---ggggaggggaggccggcacggtgattggcggaagcg----cc
A0A5F7ZJK5_BCL2L1-      gactgaatcggagatggagacccccagtgccatcaatggcaacccatcct
A0A5F7ZJK5_BCL2L1-      gactgaatcggagatggagacccccagtgccatcaatggcaacccatcct
A0A5F7ZJK5_BCL2L1-      gactgaatcggagatggagacccccagtgccatcaatggcaacccatcct
A0A5F7ZJK5_BCL2L1-      gactgaatcggagatggagacccccagtgccatcaatggcaacccatcct
A0A5F7ZJK5_BCL2L1-      gactgaatcggagatggagacccccagtgccatcaatggcaacccatcct
F7G4L5_BCL2L2-03        cgccatcttgtgcccgggg-----------------------------cc
F7G4L5_BCL2L2-01        ggtta---tgtctgtggag-----------------------------ct
F7G4L5_BCL2L2-02        ggtta---tgtctgtggag-----------------------------ct

F7E8V5_BCL2A1-01        gggtcca-------agca--------------------------------
A0A5F7ZZ15_BCL2-01      gggaccc-------ggtcgccaggacctcgccgctgccgaccccggctgc
F7H6U5_BCL2L10-01       gagccaa-------ggccgtc--cacgcc---------------------
F7HUE9_MCL1-01          ggcgcaagccccccggccgccctcacgcc---------------------
A0A5F7ZJK5_BCL2L1-      ggcacct-------ggtggacagccccgcggtgaatggagccactggcca
A0A5F7ZJK5_BCL2L1-      ggcacct-------ggtggacagccccgcggtgaatggagccactggcca
A0A5F7ZJK5_BCL2L1-      ggcacct-------ggtggacagccccgcggtgaatggagccactggcca
A0A5F7ZJK5_BCL2L1-      ggcacct-------ggtggacagccccgcggtgaatggagccactggcca
A0A5F7ZJK5_BCL2L1-      ggcacct-------ggtggacagccccgcggtgaatggagccactggcca
F7G4L5_BCL2L2-03        ggt-----------gg----------------------------------
F7G4L5_BCL2L2-01        ggccccg-------gg----------------------------------
F7G4L5_BCL2L2-02        ggccccg-------gg----------------------------------
                        *              *                                  

F7E8V5_BCL2A1-01        ------------aaacgtccagagtgctac--------------aaaagg
A0A5F7ZZ15_BCL2-01      ccccgccgccgccgccgccgcggggcctgcgctcagcccggtgccacctg
F7H6U5_BCL2L10-01       ------------cgaggcc------gccgt----------------gctg
F7HUE9_MCL1-01          ------------agacgcccggagggtcgc----------------gcgg
A0A5F7ZJK5_BCL2L1-      cagcagcagtttggatgcccgggaggtgatccccat---------ggcag
A0A5F7ZJK5_BCL2L1-      cagcagcagtttggatgcccgggaggtgatccccat---------ggcag
A0A5F7ZJK5_BCL2L1-      cagcagcagtttggatgcccgggaggtgatccccat---------ggcag
A0A5F7ZJK5_BCL2L1-      cagcagcagtttggatgcccgggaggtgatccccat---------ggcag
A0A5F7ZJK5_BCL2L1-      cagcagcagtttggatgcccgggaggtgatccccat---------ggcag
F7G4L5_BCL2L2-03        ------------ggaggccggggagggggccccggg---------gggcg
F7G4L5_BCL2L2-01        ------------gagggcccagcagctgaccc--------------gctg
F7G4L5_BCL2L2-02        ------------gagggcccagcagctgaccc--------------gctg
                                        * *                              *

F7E8V5_BCL2A1-01        ttgcattctcagtccaaaaagaag-tggaaaagaatctgaagccatgctt
A0A5F7ZZ15_BCL2-01      tggtccacctgaccctccgccaggccggtgacgacttctc-ccgccgcta
F7H6U5_BCL2L10-01       ----cgctc----------cgcgg----ccgccaggtt---acggcagct
F7HUE9_MCL1-01          ccgccgccca-----ttggcgcggaggtccccgacgtc---accgcgagc
A0A5F7ZJK5_BCL2L1-      cagtaaagcaagcgctgagggaggcaggcgacgagtttga-actgcggta
A0A5F7ZJK5_BCL2L1-      cagtaaagcaagcgctgagggaggcaggcgacgagtttga-actgcggta
A0A5F7ZJK5_BCL2L1-      cagtaaagcaagcgctgagggaggcaggcgacgagtttga-actgcggta
A0A5F7ZJK5_BCL2L1-      cagtaaagcaagcgctgagggaggcaggcgacgagtttga-actgcggta
A0A5F7ZJK5_BCL2L1-      cagtaaagcaagcgctgagggaggcaggcgacgagtttga-actgcggta
F7G4L5_BCL2L2-03        caggggacta-----cgggaacggcctg----gagtctgaggaactggag
F7G4L5_BCL2L2-01        caccaagcca-----tgcgggcagctggagatgagttcga-gacccgctt
F7G4L5_BCL2L2-02        caccaagcca-----tgcgggcagctggagatgagttcga-gacccgctt
                                               *         *                

F7E8V5_BCL2A1-01        ------ggacaatgttaatgttgcat---------------ccatagaca
A0A5F7ZZ15_BCL2-01      ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttca
F7H6U5_BCL2L10-01       ccaccggtccttcttc--tccgcctaccgcggct------accccgggaa
F7HUE9_MCL1-01          cccgcgaggctgcttt--tct-----ttgcgccc------accc-----g
A0A5F7ZJK5_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatcaccccaggga
A0A5F7ZJK5_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatcaccccaggga
A0A5F7ZJK5_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatcaccccaggga
A0A5F7ZJK5_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatcaccccaggga
A0A5F7ZJK5_BCL2L1-      ccggcgggcgttcagtgacctgacatcccagctccacatcaccccaggga
F7G4L5_BCL2L2-03        cctgaggagctgct----gctggagcccgagccg-----gagcccgagcc
F7G4L5_BCL2L2-01        ccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggct
F7G4L5_BCL2L2-02        ccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggct

F7E8V5_BCL2A1-01        ctgccagaacactatt--------------caatcaagtgatggaaaagg
A0A5F7ZZ15_BCL2-01      ccgcgcggggacgctt--------------tgccacggtggtggaggagc
F7H6U5_BCL2L10-01       ccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcc
F7HUE9_MCL1-01          ccgcgcgtcgccgcttgaggagat---ggaagccccggccgccgacgcca
A0A5F7ZJK5_BCL2L1-      cagcatatcagagctt--------------tgaacaggtagtgaatgaac
A0A5F7ZJK5_BCL2L1-      cagcatatcagagctt--------------tgaacaggtagtgaatgaac
A0A5F7ZJK5_BCL2L1-      cagcatatcagagctt--------------tgaacaggtagtgaatgaac
A0A5F7ZJK5_BCL2L1-      cagcatatcagagctt--------------tgaacaggtagtgaatgaac
A0A5F7ZJK5_BCL2L1-      cagcatatcagagctt--------------tgaacaggtagtgaatgaac
F7G4L5_BCL2L2-03        c-gaagaggagc------------------cgccccggcccc------gc
F7G4L5_BCL2L2-01        cagcacagcaacgctt--------------cacccaggtctccgatgaac
F7G4L5_BCL2L2-02        cagcacagcaacgctt--------------cacccaggtctccgatgaac
                        * *                                               

F7E8V5_BCL2A1-01        ag-----tttgaagatggcatcattaactggggaagaattgtaaccatat
A0A5F7ZZ15_BCL2-01      tc-----ttcagggacggggtg---aactgggggaggatcgtggccttct
F7H6U5_BCL2L10-01       ccg----gccccacctggggca---gggtggtgtcgctggtgaccttcgc
F7HUE9_MCL1-01          tcatgtcgcccgaagaggagct---ggacgggtacgagccggagcctctc
A0A5F7ZJK5_BCL2L1-      tc-----ttccgggatggggta---aactggggtcgcattgtggcctttt
A0A5F7ZJK5_BCL2L1-      tc-----ttccgggatggggta---aactggggtcgcattgtggcctttt
A0A5F7ZJK5_BCL2L1-      tc-----ttccgggatggggta---aactggggtcgcattgtggcctttt
A0A5F7ZJK5_BCL2L1-      tc-----ttccgggatggggta---aactggggtcgcattgtggcctttt
A0A5F7ZJK5_BCL2L1-      tc-----ttccgggatggggta---aactggggtcgcattgtggcctttt
F7G4L5_BCL2L2-03        gc-----ccccccgggagctcc---gg--------gccctg-ggcctggt
F7G4L5_BCL2L2-01        tt-----ttccaagggggcccc---aactggggccgccttgtagccttct
F7G4L5_BCL2L2-02        tt-----ttccaagggggcccc---aactggggccgccttgtagccttct
                                         *                 *        *     

F7E8V5_BCL2A1-01        t---------------------tgcatttgaaggtattctcatcaagaaa
A0A5F7ZZ15_BCL2-01      t---------------------tgagttcggtggggtcat----gtgtgt
F7H6U5_BCL2L10-01       gggga-----------------cgctgctggag------a----gagagc
F7HUE9_MCL1-01          gggaagcggccggctgtcctgcccctgctggagttggtcg----gggaat
A0A5F7ZJK5_BCL2L1-      t---------------------ctccttcggcggggcact----gtgcgt
A0A5F7ZJK5_BCL2L1-      t---------------------ctccttcggcggggcact----gtgcgt
A0A5F7ZJK5_BCL2L1-      t---------------------ctccttcggcggggcact----gtgcgt
A0A5F7ZJK5_BCL2L1-      t---------------------ctccttcggcggggcact----gtgcgt
A0A5F7ZJK5_BCL2L1-      t---------------------ctccttcggcggggcact----gtgcgt
F7G4L5_BCL2L2-03        t---------------------cg-----ggagc--cccc----ggcagc
F7G4L5_BCL2L2-01        t---------------------tgtctttggggctgcact----gtgtgc
F7G4L5_BCL2L2-02        t---------------------tgtctttggggctgcact----gtgtgc
                                                     *  *                 

F7E8V5_BCL2A1-01        cttctacgacagcgaattgccccggatgtggatacttataaggagatttc
A0A5F7ZZ15_BCL2-01      ------ggagagcgtcaaccgggagatgtcgcccctggtggacaacatcg
F7H6U5_BCL2L10-01       cgctggtgacagcct-----------------------------------
F7HUE9_MCL1-01          --ctggtaatagccccagtacggatgggtcactaccctcgacgccgccgc
A0A5F7ZJK5_BCL2L1-      ------ggaaagcgtagacaaggagatgcaggtattggtgagtcggatcg
A0A5F7ZJK5_BCL2L1-      ------ggaaagcgtagacaaggagatgcaggtattggtgagtcggatcg
A0A5F7ZJK5_BCL2L1-      ------ggaaagcgtagacaaggagatgcaggtattggtgagtcggatcg
A0A5F7ZJK5_BCL2L1-      ------ggaaagcgtagacaaggagatgcaggtattggtgagtcggatcg
A0A5F7ZJK5_BCL2L1-      ------ggaaagcgtagacaaggagatgcaggtattggtgagtcggatcg
F7G4L5_BCL2L2-03        ------caagag-------gaggaggaggagcc------gggac------
F7G4L5_BCL2L2-01        ------tgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
F7G4L5_BCL2L2-02        ------tgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
                                * **                                      

F7E8V5_BCL2A1-01        gtattttgttgctga----------gttcata------------------
A0A5F7ZZ15_BCL2-01      ccctgtggatgactg---------agtacctg------------------
F7H6U5_BCL2L10-01       -------ggtggaagaagcggggctt--ccag------------------
F7HUE9_MCL1-01          cagcagaggaggaggaggacgagttgtaccgg------------------
A0A5F7ZJK5_BCL2L1-      cagcttggatggcca---------cttacctg------------------
A0A5F7ZJK5_BCL2L1-      cagcttggatggcca---------cttacctg------------------
A0A5F7ZJK5_BCL2L1-      cagcttggatggcca---------cttacctg------------------
A0A5F7ZJK5_BCL2L1-      cagcttggatggcca---------cttacctg------------------
A0A5F7ZJK5_BCL2L1-      cagcttggatggcca---------cttacctg------------------
F7G4L5_BCL2L2-03        --tggtcgagggtga---------c---ccgggggacggcgc--------
F7G4L5_BCL2L2-01        aggagtggatggtgg---------cctacctggagacgcggctggctgac
F7G4L5_BCL2L2-02        aggagtggatggtgg---------cctacctggagacgcggctggctgac
                               *  *                 *                     

F7E8V5_BCL2A1-01        ---------------------------atgaataacacaggagaatggat
A0A5F7ZZ15_BCL2-01      ------------------aaccggcacctgcaca---------cctggat
F7H6U5_BCL2L10-01       ---------------------ccgcggctgaa------------------
F7HUE9_MCL1-01          ---------------------cagtcgctggagattatctctcggtacct
A0A5F7ZJK5_BCL2L1-      ------------aatgaccacctagagc---------------cttggat
A0A5F7ZJK5_BCL2L1-      ------------aatgaccacctagagc---------------cttggat
A0A5F7ZJK5_BCL2L1-      ------------aatgaccacctagagc---------------cttggat
A0A5F7ZJK5_BCL2L1-      ------------aatgaccacctagagc---------------cttggat
A0A5F7ZJK5_BCL2L1-      ------------aatgaccacctagagc---------------cttggat
F7G4L5_BCL2L2-03        -----------cattgaggacccggagctggaagctatcaaagctcgagt
F7G4L5_BCL2L2-01        tggatccacagcagtgggggctgggcg------gagttcacagctctata
F7G4L5_BCL2L2-02        tggatccacagcagtgggggctgggagctggaagctatcaaagctcgagt

F7E8V5_BCL2A1-01        aaggcaaa------------------------------------------
A0A5F7ZZ15_BCL2-01      ccaggata------------------------------------------
F7H6U5_BCL2L10-01       ---ggagcaggagggcgacgt------------------------c----
F7HUE9_MCL1-01          tcgggagcaggccaccggcgc------------------------caagg
A0A5F7ZJK5_BCL2L1-      ccaggaga------------------------------------------
A0A5F7ZJK5_BCL2L1-      ccaggaga------------------------------------------
A0A5F7ZJK5_BCL2L1-      ccaggaga------------------------------------------
A0A5F7ZJK5_BCL2L1-      ccaggaga------------------------------------------
A0A5F7ZJK5_BCL2L1-      ccaggaga------------------------------------------
F7G4L5_BCL2L2-03        cagggagatggaggaagaagctgagaagctaaaggagctacagaacgagg
F7G4L5_BCL2L2-01        cgggg---------------------------------------acgggg
F7G4L5_BCL2L2-02        cagggagatggaggaagaagctgagaagctaaaggagctacagaacgagg

F7E8V5_BCL2A1-01        --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       -------------------gcccgggactgccagcg-------cctggtg
F7HUE9_MCL1-01          acacaaagccaatgggcaggtctggggccaccagcaggaaggctctggag
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
F7G4L5_BCL2L2-03        tagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtg
F7G4L5_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-02        tagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtg

F7E8V5_BCL2A1-01        ---------------------acggaggctg-------------------
A0A5F7ZZ15_BCL2-01      ---------------------acggaggctg-------------------
F7H6U5_BCL2L10-01       gccttg--c--tgagctcg---cggctcgcggggcagcaccgcgcctggc
F7HUE9_MCL1-01          acctta--cgacgggttggggatggcgtgcagcgcaaccacgagacggcc
A0A5F7ZJK5_BCL2L1-      ---------------------acggcggctg-------------------
A0A5F7ZJK5_BCL2L1-      ---------------------acggcggctg-------------------
A0A5F7ZJK5_BCL2L1-      ---------------------acggcggctg-------------------
A0A5F7ZJK5_BCL2L1-      ---------------------acggcggctg-------------------
A0A5F7ZJK5_BCL2L1-      ---------------------acggcggctg-------------------
F7G4L5_BCL2L2-03        atcatgtccattgaggagaagatggaggctgatgcccgttccatctatgt
F7G4L5_BCL2L2-01        -------ccctggaggaggcg-cggcgtctg-------------------
F7G4L5_BCL2L2-02        atcatgtccattgaggagaagatggaggctgatgcccgttccatctatgt

F7E8V5_BCL2A1-01        -----------------ggaaaatggc-----------------------
A0A5F7ZZ15_BCL2-01      -------ggacgcctttgtggaactgt-----------------------
F7H6U5_BCL2L10-01       ttc--aggc-----------------------------------------
F7HUE9_MCL1-01          ttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaa
A0A5F7ZJK5_BCL2L1-      -------ggacacttttgtggaac--------------------------
A0A5F7ZJK5_BCL2L1-      -------ggacacttttgtggaac--------------------------
A0A5F7ZJK5_BCL2L1-      -------ggacacttttgtggaac--------------------------
A0A5F7ZJK5_BCL2L1-      -------ggacacttttgtggaac--------------------------
A0A5F7ZJK5_BCL2L1-      -------gagtcttgctgtgtcgc--------------------------
F7G4L5_BCL2L2-03        tggcaatgtggactatggtgcaacagcagaagagctggaagctcactttc
F7G4L5_BCL2L2-01        -----------------------cgggaggggaactgg------------
F7G4L5_BCL2L2-02        tggcaatgtggactatggtgcaacagcagaagagctggaagctcactttc

F7E8V5_BCL2A1-01        --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       --------------------------------------------------
F7HUE9_MCL1-01          atctttg-------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
F7G4L5_BCL2L2-03        atggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagt
F7G4L5_BCL2L2-01        --------------------------------------------------
F7G4L5_BCL2L2-02        atggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagt

F7E8V5_BCL2A1-01        ---------------------------------------------tttgt
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       ---------------------------------------------tcag-
F7HUE9_MCL1-01          -----------------------tctcgagtgatggtccatgttttcagc
A0A5F7ZJK5_BCL2L1-      ---------------------------------------------tctat
A0A5F7ZJK5_BCL2L1-      ---------------------------------------------tctat
A0A5F7ZJK5_BCL2L1-      ---------------------------------------------tctat
A0A5F7ZJK5_BCL2L1-      ---------------------------------------------tctat
A0A5F7ZJK5_BCL2L1-      ---------------------------------------------cc---
F7G4L5_BCL2L2-03        ggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagt
F7G4L5_BCL2L2-01        ------------------------------------------gcatcagt
F7G4L5_BCL2L2-02        ggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagt

F7E8V5_BCL2A1-01        aaaga---------------------------------------------
A0A5F7ZZ15_BCL2-01      -acggc--------------------------------------------
F7H6U5_BCL2L10-01       ggcggc--------------tgggatggcttttgtcacttcttcaggagc
F7HUE9_MCL1-01          gacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgc
A0A5F7ZJK5_BCL2L1-      gggaac--------------------------------------------
A0A5F7ZJK5_BCL2L1-      gggaac--------------------------------------------
A0A5F7ZJK5_BCL2L1-      gggaac--------------------------------------------
A0A5F7ZJK5_BCL2L1-      gggaac--------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
F7G4L5_BCL2L2-03        gaggac--------------------------ttccttggccttagatga
F7G4L5_BCL2L2-01        gaggac--------------------------------------------
F7G4L5_BCL2L2-02        gaggac--------------------------ttccttggccttagatga

F7E8V5_BCL2A1-01        --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
F7H6U5_BCL2L10-01       c-------------------------------------------------
F7HUE9_MCL1-01          ctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaac
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
F7G4L5_BCL2L2-03        gtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaaca
F7G4L5_BCL2L2-01        ---------------------------agtg-------------------
F7G4L5_BCL2L2-02        gtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaaca

F7E8V5_BCL2A1-01        -------------------------------agtttgaacctaaatctgg
A0A5F7ZZ15_BCL2-01      -------------cccagcatgcggcctctgtttgatttctcctggctgt
F7H6U5_BCL2L10-01       ----------------------cctttccg----------------ctgg
F7HUE9_MCL1-01          cattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactgg
A0A5F7ZJK5_BCL2L1-      -----------aatgcagcagccg-------agag--------------c
A0A5F7ZJK5_BCL2L1-      -----------aatgcagcagccg-------agag--------------c
A0A5F7ZJK5_BCL2L1-      -----------aatgcagcagccg-------agag--------------c
A0A5F7ZJK5_BCL2L1-      -----------aatgcagcagccg-------agag--------------c
A0A5F7ZJK5_BCL2L1-      ------------aggctgaagttc-------agtg--------------g
F7G4L5_BCL2L2-03        gaccaggcatcagcacaacagacc-------ggggttttccacgagcccg
F7G4L5_BCL2L2-01        ------------------ctgacg-------gggg---------------
F7G4L5_BCL2L2-02        gaccaggcatcagcacaacagacc-------ggggttttccacgagcccg

F7E8V5_BCL2A1-01        ct---------ggatgacttttctagaagttacagg--------------
A0A5F7ZZ15_BCL2-01      ct------ctgaagactctgctcagtttggccctgg--------------
F7H6U5_BCL2L10-01       ctttttggagaaaactgctgatccaggctttcctggcatgctt-------
F7HUE9_MCL1-01          ctagttaaacaaagaggctgggatgggtttg--tggagttcttccatgta
A0A5F7ZJK5_BCL2L1-      cgaaagggccaggagcgcttcaaccgctggttcctg--------------
A0A5F7ZJK5_BCL2L1-      cgaaagggccaggagcgcttcaaccgctggttcctg--------------
A0A5F7ZJK5_BCL2L1-      cgaaagggccaggagcgcttcaaccgctggttcctg--------------
A0A5F7ZJK5_BCL2L1-      cgaaagggccaggagcgcttcaaccgctggttcctg--------------
A0A5F7ZJK5_BCL2L1-      cgcaa--tctcagctcactacaagctccgcctcccg--------------
F7G4L5_BCL2L2-03        ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctaca
F7G4L5_BCL2L2-01        ------------------------------------------------cc
F7G4L5_BCL2L2-02        ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctaca

F7E8V5_BCL2A1-01        aaagatctgtgaaatgctatc------------------tctcctgaagc
A0A5F7ZZ15_BCL2-01      -------tgggagcttgcatca------------------ccctgggtgc
F7H6U5_BCL2L10-01       ------------gttagcaacag----------------ccttcggttat
F7HUE9_MCL1-01          gaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgt
A0A5F7ZJK5_BCL2L1-      acgggcatgactgtggccggcgt---------ggt----tctgctgggct
A0A5F7ZJK5_BCL2L1-      acgggcatgactgtggccggcgt---------ggt----tctgctgggct
A0A5F7ZJK5_BCL2L1-      acgggcatgactgtggccggcgt---------ggt----tctgctgggct
A0A5F7ZJK5_BCL2L1-      acgggcatgactgtggccggcgt---------ggt----tctgctgggct
A0A5F7ZJK5_BCL2L1-      -----------tgttcacgccat---------tct----cctgc----ct
F7G4L5_BCL2L2-03        gtggttttaacagcaggccccgg---------ggtcgtgtctacaggggc
F7G4L5_BCL2L2-01        gtggc----actgggggccctg--------------gtaactgtaggggc
F7G4L5_BCL2L2-02        gtggttttaacagcaggccccgg---------ggtcgtgtctacaggggc

F7E8V5_BCL2A1-01        aatactgt----------------------------tga---
A0A5F7ZZ15_BCL2-01      ctatctggg--------------------ccacaagtga---
F7H6U5_BCL2L10-01       c--tctgga----------------cacgattattatga---
F7HUE9_MCL1-01          t--gctggagtaggagctggtttggcatatctaataagatag
A0A5F7ZJK5_BCL2L1-      c-------------------actcttcagtcggaaatga---
A0A5F7ZJK5_BCL2L1-      c-------------------actcttcagtcggaaatga---
A0A5F7ZJK5_BCL2L1-      c-------------------actcttcagtcggaaatga---
A0A5F7ZJK5_BCL2L1-      c-------------------actcttcagtcggaaatga---
A0A5F7ZJK5_BCL2L1-      c-------------------agcctcc---------tga---
F7G4L5_BCL2L2-03        cgggctagagcgacatcatggtattccccttac---taa---
F7G4L5_BCL2L2-01        c--------------------ttttttgctagcaagtga---
F7G4L5_BCL2L2-02        cgggctagagcgacatcatggtattccccttac---taa---

© 1998-2023Legal notice