Dataset for CDS BCL-2-like of organism Sander lucioperca

[Download (right click)] [Alignment] [Repertoires]

14 sequence(s)

>gnl|bcl2dbcds|A0A8C9WU15_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggctttctacataaactataaactctcccagagaaactatcctctcaaccacatggg
actcatagagccttcgaacaggactgatggggggcacgcagggttggttgaggaggagagggtagcgacgcacgccaacg
ggactttgaacggcacgagtcccgggaccccaccagcgtccccgctgcggcagcaacagttggcgtctacgacgagcctg
gacgcagtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccagccacggcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggggtcaact
ggggccgcatcgtagggctttttgctttcggcggggctctgtgcgtggagtgcgtggagaaggagatgagtccgctggtg
ggcaggatcattgagtggatgacggtttacctggacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgccgaaatcttcgggcaggacgcggcggcagagagcaggcggtctcaggagagtttcaagaagtggctgctggcgg
gtatgaccctggtgaccggagtcgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C9XS62_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=813 residues).
atgtctttgaaactgcacgacaacatggacaaggctcccctgtttaccttgaaccgttggggactcctcgaaaccgacag
tgccggagcgtgctccagtgacttccgcatactgggaccgcaagcaaacatgcactacattcatggtacggttgacgctc
actattgtttcagttgtaagtgcacaattagcaactttgtggagaacgacaccttactgggtgaacacctctatcacagc
aacggcaattccttggcaggtgaacccggcatcaccttgatatcccgagactcgccggacaatgagactaggcaactcat
acaaaggtgcctagacgacttcacgggacttgtgaaacctacgtgggatgaaagcaaagctctgtctacaatgaaaagag
ttgtggctggcctattgcagaaatacagatgtgaatataatggtctggtcaaacgtgtattggagcattggaccagaaat
gatgacatggggtttgtcagccagatagctatgaacatgttcaatgatgggaccatgaactggggccgcattgccagctt
gatagcatttggtgctgctttgtgtcagcgcttcaatgagattggcaaagaggactgtgtggcgcgagtgggagaggaaa
tctccctgtacctgctgactgtccacacggactggctggttagaaacgactcctggaacggctttgtggagttctttcgg
gtcccagaccaggagtctactttgacaaacatactcctcacggctgctggatttgctggcattggggctgctctgacctt
gttgatcaattga
>gnl|bcl2dbcds|A0A8C9XY04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=852 residues).
atgaatattattccggcgaaacggaccgcgttcaacgtaacgaccggagtcatgagctgttttattcatcctcaaaatgg
agtcgtggagggaccaattctctacggctcagggaattcctccccgcagattgcaatgggctcatctaaagaatctcaca
acggaaatgcggggtcaaacgataccctgaaacgaccgaagaacctgggagtgaacgggtatgtaacaaaaagcctccgg
gaggacaacgacgaaatcgaggacggctcattgccgtgtactccggagccagacggtgaaatcgacgtctccagttgccc
ggcaggtgatgcagtcctggagaacgacacgaggcaactcattggccgtttcctgagagactttactggactttcgaaag
caaagtggaatgaaagccgagcactagcaacaatgaaaagagttgtggagggcgttttggagaaacacagatacgcatac
aatggtatgatcaacaaattgtcattggatgaaagaacggatgacgccagttttgtcagtgcagtagccaagagcctctt
tgcagacggaaccaccaactggggtcgtatcgccagcctgctggccttcggggcagtggtgtcacaatacctgaaggagc
gaggcagggagaactgtgtggagctggtgggacaggagatctccacgtatttgctaagcgaccagcgggactggctggtc
aaaaacaatgcctgggatggctttgtcgagttcttcagagtagcagacccagagtccacagtgaggaacacactcatggc
ctttgctggatttgctggtattggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1017 residues).
atgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctaca
agcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaaca
ggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtgg
aagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactc
cccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtgg
cctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaa
acttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctgt
gggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcagg
ctgcctttgtggagctgtatgacagacagagggactccctcttcagctgctcctggccctccattaagacggtctttggc
ctagctgcactcggggcagctagcctcaccttcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1104 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaac
aggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtg
gaagtggaccgttttaagtcagaaaggaggttaaattcccagaaactgatggaagtaaactacctgggcagcgtttaccc
gacacgggccgtcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcg
gcctgtttggatacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaag
ccatacaatatctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcc
tctagagactaaattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcag
tgcaggggaactttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacg
tccatcacagaaggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttga
cagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1080 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaac
aggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtg
gaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccat
gaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctact
ccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtg
gcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctga
aacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctg
tgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcag
attgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgat
tcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1014 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaa
agtttgaggacgtggaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggcc
gtcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttgg
atacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaata
tctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagact
aaattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaa
ctttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacag
aaggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtg
cgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=894 residues).
atgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctaca
agcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaaca
ggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtgg
aagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactc
cccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtgg
cctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaa
acttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcaattgttaccatgggattatttcggac
catcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctg
acaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=561 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggtggtgctctgcatatcagtggatgtttccagtgattatag
ccaggtggaaagtgtgataaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagcca
tttctggaaagtttgaggacgtggaagtggaccgttttaagattgttaccatgggattatttcggaccatcgccctcttc
tacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagta
a
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=933 residues).
gtaacggtagctaacgtccagtcattatactgtagcttcatagtgacaggaggctcaagtgggattgggaaatccattgc
agttgagtgctacaagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagagg
tggagaaatttgccatcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaa
agtgtgataaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaa
gtttgaggacgtggaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccg
tcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttgga
tacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatat
ctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagacta
aattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaac
tttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacaga
aggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgc
gccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=909 residues).
tacatttccagtttacctgtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaaggagc
attcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgccatcaatgaca
aacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaacaggctcaagag
aagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtggaagtggaccg
ttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcgaa
gaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactccccatccaag
tttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtggcctacccccc
tgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaaacttctggag
tttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctgtgggacccgat
ggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcagattgttaccat
gggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagc
agtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtacatctgccataaactctccaaacggggctacgtgtttggatt
tgatgatgtccgggatgaagatgctgctaataatgggtcaatagttgtccctccaccgagtttggttcgccggtgccgtg
aaggcagcactgggcctgacagcgagagcatccctcacctctgcaaacggctcccccagtccgacccgaccgccgccatc
cacagagttctccgcgaggctggagacgaacttgagagactataccagccggacttcacggagatgtcgcggcaactgta
tctcacctccaccacggcgcaaaggagattcgccgaggtgatcgacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgccgccaaagaggagatgacatcacaggtggacaac
atcgccgagtggatgactgagtatctaaatggacctctaaacagctggatacaagataacggaggatgggctgcctttgt
ggagctgtatgacagacagagggactccctcttcagctgctcctggccctccattaagacggtctttggcctagctgcac
tcggggcagctagcctcaccttcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A8D0AAQ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=675 residues).
atggaaataatgttgtacagtaacagagagctggtggagttctttataagctacaagctgtctcagagaaactattcaac
ctctctgctgaggccagaggatgctggcagaaggactgaaggagacaaggccaactcagctgccagtaacggcctgctgg
tcaacagccgaaatgggggcggccagccagggatgtcgttgcccccacgtggtgacatagaggctgtaaaggcagctctt
caggactcagcaaatgagtttgaactgctcttcacacaagcgtttagtgacctctcctcgcagctagacatcactcctga
cacagcctaccacagctttaagagcgtgatggacgaggtgttcaaggatggaatcaactggggtcgtgtagtgggtctgt
ttgcctttggcggcgtgctgtgtgtggaatgtgtagagaaggatatgagcgagctggtttcccgcatcgcagactggatg
accatgtacctggatgagcacatcagtccatggatccagagccaaggaggatgggactgctttgctgaggttttcgggcg
agacggcgctgcagaagcgaggagatctcaggagactatgagaagatggctgctagttggagtggcgctgctaatgggag
tgctggttggtgtggccatcgctaagaaacgatga
>gnl|bcl2dbcds|A0A8D0AGY2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L10 (length=582 residues).
atgtacgggctgtggaaagagaccctggctcttgcagaggactacctgtccctgtgctgcacaagcccacggccagcccc
tccacctcccagcgagtcagccgctgccatgagattcctggcccacgacatggagacgcagcaccaggctcgcttccaca
ccctcgctcagaccttcctgaagcactgtgggccggacctctgctccagcctcaggaaggtgatggaggagttggtggga
gacggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgatggagcagaa
gggcatgaagccggggctggactccggacaggggcaggaactgggacaggatcctggaaactgcagggcgctggctgaga
ccatagctgattacctgggagaggagaagaaagactggttcctggagaatgacggatgggaggggttctgtaaattctcc
gtcagtgccagagaggggagtcaggactcgtccatgaagacagcactgtttgctgctgctggtgtgggcctcgctggact
caccttcctcctggtgcgctag
© 1998-2023Legal notice