Dataset for CDS MCL-1 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7GTF7_MCL1-01      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
F7GTF7_MCL1-02      atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggc
                    ************************************************************

F7GTF7_MCL1-01      ttgggggccggcagcggcggcgccacccctccgggagggcggcttttggccacagagaag
F7GTF7_MCL1-02      ttgggggccggcagcggcggcgccacccctccgggagggcggctttt-------------
                    ***********************************************             

F7GTF7_MCL1-01      gaggcctcggcccagcgagaggtagggggaggggaggccggcgcggtgactggcggaagc
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      gccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      cccacccgccgcgcggcgccgctggaggagatggaagccccggccgccgacgccatcatg
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      tcgccggaagaagagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      ctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggag
F7GTF7_MCL1-02      ------------------------------------------------------------
                                                                                

F7GTF7_MCL1-01      attatctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagccaatgggc
F7GTF7_MCL1-02      --------------------------ggcgaccggcgccaaggacacaaagccaatgggc
                                              **********************************

F7GTF7_MCL1-01      aggtccggggccgccagcaggaaggcgctggagaccttacgacgggttggggacggcgtg
F7GTF7_MCL1-02      aggtccggggccgccagcaggaaggcgctggagaccttacgacgggttggggacggcgtg
                    ************************************************************

F7GTF7_MCL1-01      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
F7GTF7_MCL1-02      cagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
                    ************************************************************

F7GTF7_MCL1-01      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
F7GTF7_MCL1-02      gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaac
                    ************************************************************

F7GTF7_MCL1-01      tggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagacc
F7GTF7_MCL1-02      tggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagacc
                    ************************************************************

F7GTF7_MCL1-01      ataaaccaagaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
F7GTF7_MCL1-02      ataaaccaagaaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
                    ************************************************************

F7GTF7_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
F7GTF7_MCL1-02      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
                    ************************************************************

F7GTF7_MCL1-01      gtagaggacctagaaggcagagattgtagtgagctgagatcgagccattgta-----ctc
F7GTF7_MCL1-02      gtagaggacctagaaggtggcatcagaaatgtgctg----ctggcttttgcgggtgttgc
                    *****************  *     * * ** ****    *  **  ***         *

F7GTF7_MCL1-01      cagcccaggggatggtacgagactttgtctcaaaaaaaaaaaaaagttaa
F7GTF7_MCL1-02      tggagtaggagctgggttggca---tatct----------aataagatag
                      *   *** * ***   *  *   * ***          ** *** ** 

© 1998-2022Legal notice