Dataset for CDS BAX-like of Organism Gouania willdenowi

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C5ELB2_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=630 residues).
atggacgtcctgcgtaagtcttccgtgtttgctgcagaggtcctggatgtgtttgaccgatcagtgaccgagaaggatct
ggtgtcccagtccaggacgctgtgcagagactacatcctgtctaggatcaaccagaatggactgggatggtccaaaaacg
agcttaattttcctccctccactgcagcacttgctgaggtgtctgtggtgcttctgtgtcttggcgacgagctggaaagc
cttcagccggctttgtacaggaacgtggcgcggcagctcaacatctctgtttccatggagaacatggtgtctgatgcttt
tatcggcgtggcaacagagatatttgcaacaggtgtaacgtggggtaaagtggtcgctatgtatgcagtagctggagctc
tggcagtggactgtgtccggcatggccaaccagccacagttcacatcctggtggataacttgacacagtttgttaggaaa
tacctggtttcgtggctgaagaggcgtggaggatgggcccaaaggcttgggttgcagaaacaccctgacacgcagggaca
tgactgggaaccttcactgagattacatgatgtaatctttaaaaaagagatatcacaaagtgtgtggtga
>gnl|bcl2dbcds|A0A8C5ELB2_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=642 residues).
atggacgtcctgcgtaagtcttccgtgtttgctgcagaggtcctggatgtgtttgaccgatcagtgaccgagaaggatct
ggtgtcccagtccaggacgctgtgcagagactacatcctgtctaggatcaaccagaatggactgggatggtccaaaaacg
agcttaattttcctccctccactgcagcacttgctgaggtgtctgtggtgcttctgtgtcttggcgacgagctggaaagc
cttcagccggctttgtacaggaacgtggcgcggcagctcaacatctctgtttccatggagaacatggtgtctgatgcttt
tatcggcgtggcaacagagatatttgcaacaggtgtaacgtggggtaaagtggtcgctatgtatgcagtagctggagctc
tggcagtggactgtgtccggcatggccaaccagccacagttcacatcctggtggataacttgacacagtttgttaggaaa
tacctggtttcgtggctgaagaggcgtggaggatggagagatatcacaaagtgtgtggtgaagaaagatctcacccctga
acaaaactggatgtcctcagccatcgagtccctgaaatacttcctcaccacaatatacgtctacgtcatgaaggagttgt
ga
>gnl|bcl2dbcds|A0A8C5ENY4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gouania willdenowi GN=BAX (length=582 residues).
atggcatcacacccgggaggaggcgacgaccaaggcaatacaagagaccagatgctagaagtgggagctgttttattgaa
agatttcatttatcagcgactgcagcggcatggtgagaggaaccaggtagtgacaagagagcagctgggtggctccgagc
tgtcagaccccaaccacaaaaagctcggtcagtgcctgcagaagattggagatgagctcgatggaaatgtagagctgcaa
aggatgataaacgacccaaccgtcagtcctactaaagacatttttctgagagtagctgttgagatcttctctgatgggag
gttcaactggggcagagtggttgcacttttctacttcgcctgtcgactcgtcatcaaagctcttgtaaccaaagttcctg
atatcatccgaactattataagttggaccatagactacctcagagaacatgtgatcaactggattagagaacagggaggc
tgggagggtattcgttcttacttcggcacccccacgtggcagacagtgggcgtcttcctggcaggcgttctaacaactgt
tcttgttatccgtaagatgtga
>gnl|bcl2dbcds|A0A8C5ENY4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Gouania willdenowi GN=BAX (length=579 residues).
gggcgctggtaccccagtggtcggttggcatgcaatacaagagaccagatgctagaagtgggagctgttttattgaaaga
tttcatttatcagcgactgcagcggcatggtgagaggaaccaggtagtgacaagagagcagctgggtggctccgagctgt
cagaccccaaccacaaaaagctcggtcagtgcctgcagaagattggagatgagctcgatggaaatgtagagctgcaaagg
atgataaacgacccaaccgtcagtcctactaaagacatttttctgagagtagctgttgagatcttctctgatgggaggtt
caactggggcagagtggttgcacttttctacttcgcctgtcgactcgtcatcaaagctcttgtaaccaaagttcctgata
tcatccgaactattataagttggaccatagactacctcagagaacatgtgatcaactggattagagaacagggaggctgg
gagggtattcgttcttacttcggcacccccacgtggcagacagtgggcgtcttcctggcaggcgttctaacaactgttct
tgttatccgtaagatgtga
>gnl|bcl2dbcds|A0A8C5GDW0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=630 residues).
atggagatgttacgccgttcctccgtgttcgccgccgaggtgttcgaccgttcccccaccgataaggagctggtgtccca
ggggaaggctctgtgcagggactacatccactccaggctccacagggccgggataggatggaccaaagcagagcagcccg
ggaccctggcggaggtctcctctgtgctgctgtggctgggtgatgagttggagtaccttcgtcctaacgtgtaccgtaac
gtggctcggcagctcaacatcacagtggcctcagagagtgtggtgtcagacgccttcctggctgtggctgctgacatttt
ctccacaggtaggacacacacgtgtgtgacgtgggggaaggtggtttccttgtacgccgtggctggagccctagcggtgg
actgtgtgcgtcatggtcacccagccatggtccacaccatcgtagactgtatgggagagtttgtcaggaagagcctcacc
tcgtggttaaagaaaagaggaggatggacggacctcacaaagtgtgtggtgaacactgactccagcttccgctctcactg
gctggtgtcggccgcctgtacctgtggacactacatgaaggctgtggtgttgtacatcctcagggagtga
>gnl|bcl2dbcds|A0A8C5GDW0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=588 residues).
atgttacgccgttcctccgtgttcgccgccgaggtgttcgaccgttcccccaccgataaggagctggtgtcccaggggaa
ggctctgtgcagggactacatccactccaggctccacagggccgggataggatggaccaaaaaaaattacacaaaagaga
atgtttggttaggtgatgagttggagtaccttcgtcctaacgtgtaccgtaacgtggctcggcagctcaacatcacagtg
gcctcagagagtgtggtgtcagacgccttcctggctgtggctgctgacattttctccacaggtgtgacgtgggggaaggt
ggtttccttgtacgccgtggctggagccctagcggtggactgtgtgcgtcatggtcacccagccatggtccacaccatcg
tagactgtatgggagagtttgtcaggaagagcctcacctcgtggttaaagaaaagaggaggatggacggacctcacaaag
tgtgtggtgaacactgactccagcttccgctctcactggctggtgtcggccgcctgtacctgtggacactacatgaaggc
tgtggtgttgtacatcctcagggagtga
>gnl|bcl2dbcds|A0A8C5GYX8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Gouania willdenowi GN=BAX (length=621 residues).
atggcagacggtcaccaggaccgggaagagccccgggaccgggaagagcccagaggagccgttggtggacaagatgttgt
tgatgatcccatcatggaacaaggagccgtcgttctcagagggtatgtgattgagcgtattaacactcaggaccccgccc
gccacgtctcctctgaggacctggggggggatccaggagaacaacaggacccaaaaatcaaggaagtggttgagcagctt
ctgaagattgcagctgacatcaacaggaacgctgagctccagagactcattaaccaggttcagggtccgtgtgctgagga
gatttttatgggcgtggccagaagtatctttgctgacggcatcaactggggtcgagtggtggctctgttccatctggcct
acaaactcatctacaaggctctgaccaccaactgtctggataatataaaaatggtgataaattgggttctccgtgtggtt
cgggagcgtctctacatgtggctggtgcagcagggaggctgggagggcgtcatcagcacattctcgagatggaggaccgt
ggccgtagccgcctcgctagtgctgatagcatcctttgtttactacagaaagacacgctga
© 1998-2023Legal notice