Dataset for CDS MCL-1 of organism Strigops habroptila

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A672UZL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Strigops habroptila GN=MCL-1 (length=894 residues).
atgttcgcgctcaagcggaacgcggtcatcggcctcaacctctactgcggcggcagccccgcgctggcccccgctcccgc
cgcaccgggagggggcccggccccgccgccgccctccgcggcccccgcgggggcttgggccgccgggcgcgctgaggcgc
tgctgggctgcggcgcggccccgctgcccgccccggccccgctgcccgccccggcgcggccggtgccgctctggagcccc
gaggaggagctggatggctgcgagcccgagcccgagcgcggccccgcgggggactcgctgcccgcgccgccgcccgacgc
gctgcgccaggcctcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggccgagcccggagccaagaagc
tgttcccggggctgctgggcgggcccggccggcccggaggggcggcggatgcggtgatggggaaggcgctggagacgctg
cggagggtcggcgacggcgtcatggcgaagcacgaactcgccttccagggaatgcttcggaagctggaaatccagaagga
ggaggacctgcagtcggtgcgagaggtggctgcgcacttgttcagtgacggagtgaccaactggggccgggtggtgacgc
tcatctccttcggggccttcgtcgcgaagcacctgaagagcatccagcaggagaagtgcatcagctccctggcagggatc
atcacggacgcgctcgtctcctcccggcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcg
agtcgaggacctggaaggcagcatcagaaacgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcct
acatgatccggtga
© 1998-2020Legal notice