Dataset for CDS BCL-2 of organism all

[Download (right click)] [Alignment] [Repertoires]

268 sequence(s)

>gnl|bcl2dbcds|A0A3Q1FLK7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtacatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagttgaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggggatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctcta
tctcaccaccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgccttcgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggttttcggtctggcagcac
tcggggcggcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A8B9RWH9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Accipiter nisus GN=BCL-2 (length=744 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgctgcggttg
ctgctgctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagcccccc
ggctcggccgctgctagccacgcgcccccggccgaggggctgccccccgcgccccaggtcgtccacctcgccctgcgcca
ggcgggcgacgagttctcccgccgctaccagagggacttcgcccaaatgtccggccagctgcacctgacgcccttcacgg
ccaggggccgcttcgtggcggtggtggaggagctcttccgagacggcgtcaactggggcaggatcgtggccttcttcgag
ttcggcggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccga
gtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagta
tgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactctt
ggcgcttatcttggacataagtag
>gnl|bcl2dbcds|G1LIC9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgctcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgccaccgcccccggccgcccccgccgccgccgccgccgcgggccctgcg
ctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q0S5Z7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaaacggggatacgcgtggggatt
tgacggtgtccaggatgaagatgctgctaataacgggtcaataaatgaccctccaccgactttggtccgccggtgccgag
aacccagcaacgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcagacatc
cacagagtcctgcgagaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggagtgcgcttccaacgaggggatgacatcgcaggtggacaac
atcgcagagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtatggcagacagagggagtccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcac
tcggagcggccagcctcaccatcggagcatatcttacacaaaagtga
>gnl|bcl2dbcds|A0A3Q1B8C3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagtggaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctgta
tctcacctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggtcttcggtctggcagcac
tcggggcagcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A3P8S9L3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Amphiprion percula GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgtgtgggggtt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagtggaccctccgccgactttggtccgtcggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctgta
tctcacctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggggggacggtgtgcgtcgagtgcgcggccaaagaggagatgacatcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactcagtcttcagttgctcctggccctccatcaagacggtcttcggtctggcagcac
tcggggcagcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgcgtgggggtt
tcatgatgcccaagacgaagatgctgctaataatgggtctgcagttccccctccaccgactttggtccggcggtgccgtg
aagccagcaccgggcctgacagcgacagcatcccgcaacactgcagacggctccctccgtccgacccgcacgctgcgctc
cacagggtcctgcgtgaggctggagatgaacttgaaagactatatcagccggacttcacggagatgtcccgacagctgta
tctcacctccaccacggcgcagcggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcgtccaaggaggagatgacaccgcaggtgaacaac
atcgcagagtggatgacggagtatttaaatggacctcttcacagctggatacaagataacgggggatgggatgccttcgt
ggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggcctcgctgctc
tcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1017 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagg
atgccttcgtggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggc
ctcgctgctctcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=1302 residues).
atgcagactgctttgtcacggggagaaagggttcaacacggtactttaatccgactgttgcacatctttgactctctgcc
aaaccagcgaacaactcctcctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcgtatctcggtt
atcgaacccctgaagctggcctgctagttagcagacgagctaacgattgtcagatttcacccatgtcctctgaagaaggg
ttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcattatgcttcttgtaattgc
tgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacctctgaaactgaacgggg
cccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctacagacaaggagcattcatc
actttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgccatcaatgacaaacaggt
ggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaacaggctcaagagaagctgg
gacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtggaggtggattgttttaaa
aaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatggg
ccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactccccatccaagtttgccc
tgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtggcctacccccccgacact
gacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtca
accagaccaagtggccaaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttaca
tgctctctgccctcacctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggatta
tttcgaaccattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaa
agcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=954 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
gcactttactccagattccactattgcaaaatgttggccttattttcaccagaaactgatggaagtgaactacctgggca
gcgtttacccaacacgggccgtcataaccaccatgaaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagca
ggacaggttggcctgtttggatacactgcctactccccatccaagtttgccctgcgtggtttagcagagtcactgcagat
ggagataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttggctgaggaaaata
agacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggccaaaatcattgtg
cgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctcacctgtggaatgtc
acccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgccctgttctacttgg
ggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=894 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaaaactgatggaagtgaactacctgggcagcgtttacccaacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgtttgtgtcctcccaagcaggacaggttggcctgtttggatacactgcctactc
cccatccaagtttgccctgcgtggtttagcagagtcactgcagatggagataaagccctacaatatatatgtgacagtgg
cctacccccccgacactgacactccaggtttggctgaggaaaataagacaaagcctctggagaccaaattaatctctgaa
acatctggagtctgtcaaccagaccaagtggccaaaatcattgtgcgagatgcaataattaccatgggattatttcgaac
cattgccctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctg
acaagagagagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=807 residues).
atgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctaca
gacaaggagcattcatcactttagtggcacgaaatgaggctaaattgcttcaggcaaagaaggaaatagagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgattatagtcaggtggaaagtgtgataaaaca
ggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaatgtctggaaagtttgaggaggtgg
aggtggattgttttaaaataaagccctacaatatatatgtgacagtggcctacccccccgacactgacactccaggtttg
gctgaggaaaataagacaaagcctctggagaccaaattaatctctgaaacatctggagtctgtcaaccagaccaagtggc
caaaatcattgtgcgagatgcagtgcaggggaacttcaatagctcagtgggacctgatggttacatgctctctgccctca
cctgtggaatgtcacccgttacctccattacagagggtctccagcagataattaccatgggattatttcgaaccattgcc
ctgttctacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagag
agagtaa
>gnl|bcl2dbcds|A0A7N6A4C8_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttgagctcaacgatcacagattggcttttcatcaactcctggtggctccttctgccattcat
tatgcttcttgtaattgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacgggaggctctagtgggattgggaagtgcattgcaattgaatgctac
agacaaggagcattcatcactttagtggcacgaaatgaggtggtgctttgcatatcagtggatgtttccagtgattatag
tcaggtggaaagtgtgataaaacaggctcaagagaagctgggacctgttgatatgcttgtgaactgtgctggaacatcaa
tgtctggaaagtttgaggaggtggaggtggattgttttaaaataattaccatgggattatttcgaaccattgccctgttc
tacttggggagttttgacagcatcgtacgccgctgcatgattcaaagagagcagtcaaaagcagctgacaagagagagta
a
>gnl|bcl2dbcds|A0A493T1X3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggacgagttctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9SFH3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggatgaattctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agtgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9UYC3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL-2 (length=1044 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccccgccgggctgctgtccccgcaccctgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgccctgcgccaggccggggacgagttctcccgtcg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcccttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccgcatcgtggccttcttcgagttcggcggcgtcatgtgcgtggag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggtacgtgccccgtgctttgctttcctgctccgatggcccgtggctggggtggctc
tggggctcacgggtgtccacgtgtgctcacctcggtgcgagcctcgggatgtgaggtttgcctgctgcatctttgcaccg
gtgtgggccttctgctggctcctctgctgtcgggtgtcacctcatggtggggctgcagtgaaacaatgttggtttttaag
tgggggggagcagctgcagctccctcctcaggtgctgaaaggccaagcaaggtgccctctccatcggagggctccgcttt
cccatccccttcacccaccggtggcatcagccctggccaaggcttgttccagcacagcatgggaaggggttacagagtct
ggggatgggtacagggggtggcaggtcctggatgtggacatccctgcatgttggggtgacgcgtgtgtggggacacggtg
ctag
>gnl|bcl2dbcds|H9GPE7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anolis carolinensis GN=BCL-2 (length=738 residues).
atggctcatcctgggataagaggttacgacaacagggaaatcgtgctgaggtacatccattacaagctgtcgcagaaagg
atatgactgggttgccagtggagacagaggaaaccttgctgctgctgctgctgctgctgctgctactcctagtgctccaa
ctgtgtcagcatctctttccccagagcttctcaattctgatcctgtgagtaccaatgcccccagggaagaacctgacccg
gtgccacaggttgtccatacaacattacgccaagccggagatgagttctcccgacgctatcggagggactttgctcaaat
gtctggccagctgcatttgacccccagcactgccagaagtcgttttgtggccgtggtggaagagctcttccaggacggtg
tgaactgggggaggattgtggcgttctttgaatttggtggcatgctgtgcgtggagagtgtcagccgggagatgtccccc
cttgtggacaatattgctacgtggatgactgagtatctgaaccagtacctgcgcaactggatccaggagaacggaggctg
ggtatgtggctcattgtctttgtctttttctgtttcaaggtcatacatcactgaaacatccattccggtgtcacaaatgg
cttgtgtgaccagtggttcccagtgcggtgtcacttgtaaagttgttccaagggcattttgcttattccgaacaaaaggt
gacaaccagttattatag
>gnl|bcl2dbcds|A0A8B9C4H4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL-2 (length=720 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccctgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccaccttgccctgcgccaggccggggacgagttctcccgccg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcctttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtgatgtgcgtcgag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtttggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9E2U6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anser cygnoid GN=BCL-2 (length=1080 residues).
atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcgcccgcgcctacggctctcgctcctgctgctgctgcggttgctgctgctg
ggactccctcccgccaccgccctgccgggctgctgtccccgcaccccgagccccccggctcggctgctgctagcgaggcg
cccccgggcgaggggctgcgccccgcgccccccgtggtccaccttgccctgcgccaggccggggacgagttctcccgccg
ctaccagcgggacttcgcccagatgtccggccagctgcacctgacgcctttcacggccagaggccgcttcgtggccgtgg
tggaggagctcttccgagacggggtgaactggggccggatcgtggccttcttcgagttcggcggcgtgatgtgcgtcgag
agcgtcaaccgggagatgtctcccctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggtacgtgccctgcgctttgctttcctcctccgatggcccacggctttgggggctc
tggggtgtctctggggctcacgggtgcccacgtgtgctcacctcagtgtgagcgtcgggacgcgaggtttgcctgctgcg
tcttttgtaccggtgtgggccttctgccggctcctctgctgtcgggtgtcacctgatggtggggctgcagtgaaatggtg
ttgtttttttttgtggaggggggcagctgcagctccctcgtcaggtgccgaaaggccaagcaaggtgtcctttccatcgg
agagctctgctttcccatcaccttcgcccactggtggcatcagccctggccaaggcttgttccagcgcagcatgggaagg
ggttgcagaggctggggatgggcacagggggtggcaggtcctggatgtggggaccatgtggacatccctgcatgttgggg
tggtgcaccgggcacggcgagtgtggggacatggtgctag
>gnl|bcl2dbcds|A0A2K5EB04_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcacccccaggggccgcccccgcgccgggcatcttctcctcccagcctg
gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcgccgccgccgcccccggccgcccccgccgcc
gccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggggacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=717 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctgggatgccttcgtggagttgtacggcaacagtatgcggcctttgttcgatttctcctgga
tctctctgaagactatcctaagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B9PRT7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Apteryx owenii GN=BCL-2 (length=684 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccattataaactctcgcagagggg
atacgactgggctgccagcggcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgctcttgctgctg
ctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagtaacgcggcc
ccgggtgacgggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggggatgagttctcccgccgcta
ccagagggacttcgcccaaatgtctggccagctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttcgagttcggcagcgtcatgtgcgtggagagc
gtcaaccgggagatgtcccccctggtggacagcattgccacctggatgaccgagtacctgaaccggcacctgcatacttg
gatccaggacaacggcggctggcaggtaactccaagcaggcatcaccggagggacgtgctggatctcagacagactttgc
gcagcccagcgtggcggagcttgcctcaccgagacgttggagta
>gnl|bcl2dbcds|A0A663FHR0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccgggtctctctcctcctcctgctgctgctgctgcggttg
ctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcg
gctgctgctagccacgcgcccccggccgaggggctgccccccgcgccccaggtcgtccacctcgccctgcgccaggcggg
cgacgagttctcccgccgctaccagagggacttcgcccaaatgtccggccagctgcacctgacgcccttcacggccaggg
gccgcttcgtggcggtggtggaggagctcttccgagacggcgttaactggggcaggatcgtggccttcttcgagttcggc
ggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccgagtacct
gaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggc
ctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgct
tatcttggacataagtag
>gnl|bcl2dbcds|A0A3P8QVM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL-2 (length=687 residues).
atggagaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctcctccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A663MPN9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Athene cunicularia GN=BCL-2 (length=639 residues).
atgcaagaatataacggcagtgattttacttggttgacaaatccccttgcctaccttcctgccatcagaagcagccccac
agctcaccgcacttttccaagtctctcccacagacacgatgcgctccagcatttatcctcgctgcgagctgcccgcaggc
cctgccgggctgcagccccgcggccgcgcagaatcgtccaccttgccctgcgccaggcgggcgacgagttctcccgccgc
taccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggt
ggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgtgtggaga
gcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaac
tggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtgtgaggcctttgtttgatttctcctg
gatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcgtcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctggcacattccactcatcattgttattaactatttcttctgcgcttcacatttgtctgaacttggaacatatgctt
acgaagctgttggaaacttcccaagcctatttgattctgctgatatttccatagtgtga
>gnl|bcl2dbcds|A0A8B8V3A7_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL-2 (length=615 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcaggcaccgcgtccccgggggccgcccccgcgccaggcatcttctcctcccagcctg
ggcgcaccccagcgccatccaggacctccccgccgccgccccagaccgcccccgccgcccccgccggggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttctctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctggacaaaagataaacccagctgtccttcagtgagaatgatgacggaatga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=612 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggtaggtgctcgtctggatgtgagtctgagcgggacacctcggtcccagtgcggtc
cgagtggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4W2DSR6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=612 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggtaggtgctcgtctggatgtgagtctgagcgggacacctcggtcccagtgcggtc
cgagtggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
>gnl|bcl2dbcds|F6R2C4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|O02718_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=687 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgccccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataag
>gnl|bcl2dbcds|A0A8C0IE77_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bubo bubo GN=BCL-2 (length=696 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgct
gctagccacgtcgtccacctcgccctgcgccaggcgggcgacgagttctcccgccgctaccagagggactttgcccaaat
gtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagacgggg
ttaactggggcaggattgtggccttcttcgagtttggcggtgtgatgtgcgtggagagcgtcaaccgggagatgtctccc
cttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctg
ggatgccttcgtcgagttgtatggcaacagtatgaggcctttgtttgatttctcctggatctctctgaagactatcctga
gtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C0BN28_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Buteo japonicus GN=BCL-2 (length=600 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgctgcggttg
ccgctgctgctgctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggnggccaggggccgcttcgtggcggtggtggaggagctcttccgagacggcgtcaactggggcaggat
cgtggccttcttcgagttcggcggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcg
ccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgcctttgtggag
ttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtggg
agcttgcatcactcttggcgcgtatcttggacataagtag
>gnl|bcl2dbcds|A0A8C3CIW8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cairina moschata domestica GN=BCL-2 (length=834 residues).
cccctcggggacttgaagcatcaaagcagccggagcttaacgtttctgaagacttggcgatgtttgggtcgtgtcgttgc
tggtgttttttgtagaggaaacttgacagaggaacatatttatagtcccaaaagaggctacgataaccgggagatagtgc
tgaagtacatccactataaactctcgcagaggggatacgactgggctgccggcgaggacagggcgcccgcgcctacggct
ctcgctcctgctgctgctgcggttgctgctgctgggactccctcccgccaccgccccgccgggctgctgtccccgcaccc
cgagccccccggctcggctgctgctagcgaggcgcccccgggcgaggggctgcgccccgcaccccccgtggtccacctcg
ccctgcgccaggccggggacgagttctcccgtcgctaccagcgggacttcgcccagatgtccggccagctgcacctgaca
cccttcacggccagaggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaactggggccggatcgtggc
cttcttcgagttcggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggtggacagcatcgccgcct
ggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtat
ggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtttggttctggtgggagcttg
catcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C3JHE5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Calidris pygmaea GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagagg
atacgactgggctgccggtgaggacccggcacctctgccaccaggtctctctcctcctgctgctgctgctgctgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgtg
cccccggccgaggggctgcgccccgcgccccaggtggtccacctcaccttgcgccaggcaggggacgagttctcccgccg
ctaccagagggactttgcccaaatgtccggccagctgcacctgacccccttcacggccaggggccgcttcgtggcggtgg
tggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagttcggcggcgtgatgtgcgtggag
agcgtcaaccgggagatgtctcccctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A2R8MY14_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggggccgcccccgcggagggcatcttctcttcccagcccg
ggcacacgcccggtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgcccccagccgcccccgccgcc
gccgccacggggcctacgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggtcctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A8C0KWE3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus dingo GN=BCL-2 (length=714 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgccgccgccgccgccgccgccgccgcg
ggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccg
ccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggagg
agctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggat
ccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgt
ctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=693 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctggatgacttgggttttcctgttggttttactttcctttccctgtgtccactcctggc
cccttgtgcagtgccaggccccctggccatggccaccacacagtccagcctga
>gnl|bcl2dbcds|A0A8C0NC28_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgcc
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctggagtccacatcctttgatggtctcctctgctgaaaaaacttgcgtctacagtgtct
atataaagcatagaagcattgattctcatctgtggattctctcatgctctgactttagttgtagtgatcgatgcctgtag
>gnl|bcl2dbcds|A0A8I3MLT5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgcgggc
cccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8I3MLT5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgcgggc
cccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctggagtccacatcctttgatggtctcctctgctgaaaaaacttgcgtctacagtgtctatataaagc
atagaagcattgattctcatctgtggattctctcatgctctgactttagttgtagtgatcgatgcctgtag
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A452EV13_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcgcgcccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A250YD83_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Castor canadensis GN=BCL-2 (length=720 residues).
atggcgcaagctgggagaacagggtatgataaccgggagatagtgatgaaatacatccactataagctgtcacagagggg
ctacgagtgggatgccggagacgtgggcgccgcgcccccggaggccaccccagcgccgggcatcttctccttccagcccg
ggagcaaccccctgcccgctgcgccccgggaccgggccgccaggaccacgtcgctgccgcccccggtcgcccccgccgcc
cgcgccgggcctgcgctcagcccagtaccacctgtggtccacctgaccctccgccaggctggcgatgacttctcccggcg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcctctggtggacaacatcgccttgtggatgattgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagtgtgcgacctctgtttgacttctcct
ggctgtctctgaagactctgctcagcctggccctggtgggagtctgtatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C3WCN0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Catagonus wagneri GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgcgcccgccaggacctcgccgccaccgcccccgaccgcccccgccgccgccgcggggcctgcgctcagc
cccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctctcgtcgctaccgccgagactttgccga
gatgtccagccagctgcacctgacacccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatagccctgtggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggagg
ctgggacgcctttgtggagctgtatggccccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C3TNF2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Catharus ustulatus GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcccagagggg
atacgactgggctgccggtgaggacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccctggccgaggggctgcgccccgcaccccaggtcgtccaccttgtcctgcgccaggcgggggatgagttctcccgacg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagttcggtggtgtgatgtgtgtggaa
agcgtcaaccgggagatgtctccgctcgtggacagcatcgctgcctggatgactgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|H0W1T3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cavia porcellus GN=BCL-2 (length=549 residues).
atggctcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcccagagagg
ctacgagtgggatgccggagacgggagcgcactgggtcgcaactccccgcttggtgtgccccgggacccggccgccagga
cctcgccaccgccacccctggccggcctcgccgtcgcccaggggcctgcgctcagcccggtgccacctgtggtccacctg
accctccgccaggccggcgatgacttctcccgccgctatcgccaagacttcgctgagatgtccagccagctgcacctgac
gcctttcaccgcgaggggacgctttgccacgctcttcagggatggggtgaactgggggaggattgtggccttctttgagt
tcggtggggtcatgtgtgtggagagtgtcaaccgggagatgtcacctctggtggacaacatcgccctctggatgactgag
tacctgaaccggcacctgcacacctggatccaggataacggaggatgggtaggtgcatgtttgagtgag
>gnl|bcl2dbcds|A0A2K5NZS5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C0G2Q6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgagagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttctccaaatctctctccccctcctgctactgggacctcatctg
accatgctgggctggtctctttgcctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctg
cacccagcaccgcaggctgttctcttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcagtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaatttggtggtgtgatgtgcgtggagagcgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgaatacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattatacggcaggaacatgaggcctgtgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcatgcatcaccctgggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C3SV21_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chelydra serpentina GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaattacatccattacaaactgtcacagagggg
atatgattgggctgccagtgaaaacagaggaccagtttctccaaatctctctcctcctactgctgctgggacctcatctg
accctgctgggctggtgtctctgcctcctgagccccctggctcagctgctgctagtaatgtgccccttggtgatgggctg
cacccagcaccgcaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctaccacagagattttgc
ccagatgtccggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggagttaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgcgtggagagcgtcaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgagtacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattgtacggcaacaacatgaggcctttgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C2VKS3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagaggagagcgccgcgccccccggggccgcgcccacgccgggcatcttctccttccagcccg
ggcgcaactccccggccgctgcgccccgggacccggccgccaggacctcgccgccgccgccgctggccggcctcgccgcc
gccgcgggacctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgtcg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctctggatgacagagtacctgaaccggcacctgcacac
ctggatccaagataacggaggctgggacgcctttgtggagctgtatggacccagtgtacggcctctgtttgacttctcct
ggctgtctctgaagactctgctcagcctggccctggtgggagcctgcatcacgctgggtgcctacctgggacacaagtga
>gnl|bcl2dbcds|A0A0D9S017_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
>gnl|bcl2dbcds|A0A8C3ITE1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL-2 (length=759 residues).
atgtatttaattgcatgtgtctgtacgttgcactggagggaaaagcacagcacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatacgattgggctgccaatgaaa
acagaggaccagtttctccaaatctctctccccctactgttgctgggacctcatctgaccatgctgggctggtgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtacctcttggtgatgggctgcgcccagcaccgcaggctgttct
cttgactctgtgccaagctggagatgaattttcccgccgctaccacagagattttgcccagatgtctggccagttgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaattcggtggcgtgatgtgcgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgaccgagtacctgaacagacacctacataactggatccaagacaacggaggctgggatgcctttgtggaat
tgtacggcaacaacatgaggcctttgtttgatttctcctggatctctttgaagactatcctaagtctggctctggtggga
gcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C3LBC4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctatgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtacccccggccctggctcccactgctgctcccactgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
agccccgcacctcccggcgtccacctcgccctgcgccaggctggggacgaattctcacgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagcttttccgtg
atggggtcaactggggtcggatcgtcgccttctttgagttcggtggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaacaggcacctgcataactggatccaggacaacgg
aggatgggatgccttcgtggaattgtacggcaacagcatgaggcctttgtttgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A2K5HK49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggagccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgcttagcccagtgccacctgtggtccaccttaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgtggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A0U3DHY6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coregonus lavaretus GN=BCL-2 (length=684 residues).
atggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccataacaaactgttgaagaagggatttgt
atgggaatttcaagcagaaaacgattctccaaataatttatttggggacccctctacacccaacacccccgaagtttttg
cacggaggtcccagcccaccgccgcggtcgaggacaccgactctcctttccaaaacaggagtccgcaaccggacccacat
gtcaggctccacagggtcctgcgcgaggcgggggacgagattgaaagaatgtatctgcgggactttgcagagatgtcggg
gcaattgcattttacgcccagcacggcacaganaaggtttaccgctgtaatagatgagctcttcagcgacggggtaaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtg
gacaacatcgctctttggatgacggagtacctgaacggacccctacagaactggatccaggagaatggtggctgggacgc
ctttgtggagatctatgaacagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccctgg
gagccgtcggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C2U1A2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Coturnix japonica GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctctcagcgggg
ctatgactgggctgccggtgaggacaggccgcctgtgcccccggccctggctcctgctgctgctcctgccgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
cgccccgcacctccaggcgtccacctcgccctgcgccaggccggggacgagttctctcgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggtcgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggattgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
gggatgggatgccttcgtggaattgtacggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacacaagtag
>gnl|bcl2dbcds|Q923R6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cricetulus longicaudatus GN=BCL-2 (length=711 residues).
atggctcaagctgggagaacagggtatgataaccgagagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgctacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcatttgtggaactgtacggccccagtgtgaggcctctgtttgatttctcttggctgtctc
tgaanaccctgctcaacctggccctggtcggggcctgcatcactctgggtacctacctgggccacaagtga
>gnl|bcl2dbcds|A0A7M4EPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atgtcttccacagtgaaaacaggctatcataaccgggagatagtgctaaagtacatccattacaaactatcacagagggg
atacgactgggctgcccaccaagacagagcatggtgtcctctgagtctctctcctgctgctgctgttgctgctgctggga
cttcctctgacaatactgggctggtgtctctgcatcgtgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgacctgggcccagtcctacaggctgtccacctgaccctgcgccaagcgggagatgatttctcctgccgctaccagag
tgacgttgcccaaatgtctggccagctgcacttgacccccttcacagccaggaggcgttttatggcagtagtagaggaac
tgttccgagatggagtgaactggggaagaattgtagccttctttgggttcggtggcgtgatgtgcgtggagaatgtcaac
caggagatgtcgcccctcgtggacaacattgcaacatggatgatggagtatctgaacaggcacctccagaactggatcca
ggacaacggaggctgggatgccttcatagaattgtatggtaacaacatgagactgttgattgacttcttctggatctctt
ggaaaactatcataagtctggttctggtgggagcttgcatcactcttggtgcttatctaggacataagtaa
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=1035 residues).
atggaggctgggagattatttcagccaaaaagaatacatgtaagaaccaggatgtctcaaacagacagacctcaccgaga
taagccataccgatactacgagagccatggttatgacaggcacaacacagacagaaggactaaagaaccatacccatccc
acggaaggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaaaaac
gcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtgcaaa
catatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagctgccc
agacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagcccattt
gaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggggcat
tgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctccatgc
cactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgtatttt
gtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatgaactg
cgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtcatct
gcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagctacaga
gagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=879 residues).
atggaggctgggtcagcaaaagagactcacagcacccagaactccagaccttccagactttgttcagatccttataaaaa
aaacgcagtatcaactcatggctacgtcagctcttctcctcacttttatcctcccaaacagaccttttcagagaaatgtg
caaacatatgctcaacaagaggtattttgaaatttgttgaaattacagtcagcattctgatgctgatttgtgttgcagct
gcccagacagccatttcaggctacacctccatcggcggcttgggaatgggctccttcagcctggataccgcttacagccc
atttgaaggatatgaactgaaggaggtgagagacctggacatgcagttcagccagatgagagccccttgtgtgtacgggg
gcattgccttcagcctgacaatggctgcacttacactcctgttcctcgtcgttggggcaaagcaaattcatcgtctctcc
atgccactgctcgtggcagaatgtgcctttgatattctggctggtatggcatacatctcagccgttggcctctacctgta
ttttgtcatccaggtgaacacaacagatgtatgcaagaggagggagaggttgtatgcacgccggggatacacatcaatga
actgcgaggtgcaggggggcgatgcagctgttgctgtctttggtattgtggctgcctgtttgtacttcccaagctctgtc
atctgcgctcgcaccattcggaccgtgaggaacttccggaggcaccagacacagcctcagtacagcccagagagcagcta
cagagagagaggccaccacaaagccaacagaagccctgaaagcacccgcagcatgcaggcagtggcaacgttggtgtag
>gnl|bcl2dbcds|A0A7M4G2E0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Crocodylus porosus GN=BCL-2 (length=711 residues).
atggctaatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
gtacgactgggctgcccaccaagacagagcacggggtcctccgagtcattctcctgctgctgctgttgctgctgctggga
cttcctctgaccatgctgggccggtgtctctgcatcctgagcctgctggctcagctgctgctagtaatgtgcctcctggt
aatgagccgggcccagccccacaggctgtccacctgaccctgcgccaagcgggagatgatttctcccgccgctaccagag
tgactttgcccaaatgtctggccagctgcacttgacccccttcacagccagggggcgctttgtggcggtagtggaggagc
tgttccgagacggagtgaactgggggagaattgtggccttctttgagttcggtggcgtgatgtgcgtggagagtgtcaac
cgggagatgtcgcccctcgtggacaacattgcaacatggatgacggagtacctgaacaggcacctccagaactggatcca
ggacaatggaggctgggatgccttcgtggaattgtatggtaacaacatgagaccattgattgacttctcctggatctctt
ggaaaactatcttaagtctggttctggtgggagcttgcatcactcttggcgcttatctaggacataagtga
>gnl|bcl2dbcds|A0A8C0UAC7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL-2 (length=672 residues).
cagaggaacatatttatagcccaagctcatccggggagaagaggctatgataaccgggagatagtgctgaagtacatcca
ctataaactctcccagaggggatacgactgggctgccggcgaggacagggcacccctgtctccaggtctctctgctcctg
ctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagc
cacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggggatgagttctc
ccgacgctaccagagggactttgcccaaatgtctggccagctgcacctgacacccttcacggccaggagccgcttcgtgg
ccgtggtggaggagctcttccgagacggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatgtgt
gtggagagcgtcaaccgggagatgtctcccctcgtggacaacattgctgcctggatgactgagtacctgaaccggcacct
gcaccactggatccaggacaacggaggctgggtaagtcaccccgatcgctcgcttcctctccctgctccggcccgtggct
ggtgggaccccaggctgggcagcgccccagag
>gnl|bcl2dbcds|A0A8C3QX54_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL-2 (length=708 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcacagagggg
atacgactgggctgccggtgaggacagggcacccctgcctccaggtctctctgttcctgctgctgctgctgctgggactt
cctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcgcccccggccgag
gggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggggatgagttctcccgacgctaccagaggga
ctttgcccagatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtagccgtggtggaagagctct
tccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtcatgtgcgtggagagcgtcaaccgg
gagatgtctcccctcgtggacagcatcgctgcctggatgactgagtacctgaaccggcacctgcacaactggatccagga
caacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctga
agactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8C2X310_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1017 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgt
gggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcctttgtggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggt
ctggctgcactcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A8C2X310_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagc
aggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatg
gaagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccat
gaaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctact
ccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtg
gcctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctga
aacctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccg
tgggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgttaccatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgat
tcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=555 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggtcaattgcttaaataattcagtgttgacctactggagtgg
ctttttttctgttgcgcaggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctg
gaaagtttgatgaaatggaagtggaccgttttaaaattgttaccatgggactgtttcggaccatcgccctcttctacctg
ggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1074 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtatattgcttaaataattcagtgttgacctactggagtggctttttttctgttgcgcaggctc
aggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatggaagtg
gaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatgaagga
gcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactccccgt
ccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtggcctac
ccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaaacctc
aggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgtgggac
ccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagattgtt
accatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagag
ggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=894 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcaattgttaccatgggactgtttcggac
catcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctg
ataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=687 residues).
atggcgaacgagtgcaatcgcaacattgtggaaaagtacatctgccataaactctccaaacggggctacgtgtttggatt
tgacgacgtccgagatgaagatgccgccgatgacggcttaatagttgtcccgccgccgactctggtccgccggtgccgtg
aatccggcaccgggcccgacatcgagagcgtcccccacctctgcaaacggctcccgcagtccgacccgaccgccgccatc
caccgggtcctgcgcgaggctggggacgaactcgagagactgtaccagccggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgcagcggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgcggagtgcgccgccaagcaggagatgacctcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctctgaacaactggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A3P8WUE9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL-2 (length=714 residues).
atgtacttggtgccaaattctgctggaatggcgagcgagtgtaaccgctatatagtggaaaagtacatctgccataaact
cgccaagcgtgggtacgtgtgggagcacgacgaggaccgagatggagacgctgctaataatggctcaatagtttcccgtc
caccgactctggttcaccggtgccgtggtgccagcaccgggcctgggaacgacggcatccctaacctctgcaaacggcca
cctgcgcccgaggcgcacgccgccattcacagagtcctgcgcgaagccggagacgaactggagcgactgtaccagccgga
cttctcagagatgtcacggcagctctatctcacctccagcacggcgcagaggagattcaccgaggtgattgacgaactgt
tccgggacggcgtgaactggggccggattatcgccttcttcgagtttggaggcgtcgtgtgtgtggagtgtgcggctaag
gaggacttgacgccgcaagtggagcaggtcgtggactggatgacagagtatttaaatggacctcttaacatctggattaa
agagaacgggggatgggatgcctttgtggagctgtacgacagacagggggagtctgccttcagctgctcctggccctcca
tcaagaccgtctttggtctggctgcactgggggccgccagcctcaccatcggagcgtatctgacccagaagtga
>gnl|bcl2dbcds|A0A8C1IQE4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=573 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagc
tggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttt
accgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgt
ttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggc
cgctgcacgcctggatccaggagaacggcggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcggggctgttggcttgaccataggagcctacct
tgctcagaaatga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A3KNH9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|Q564A4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|A0A1X9JZA1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacagggctacgagtgggggtt
tgacgctgtccggaatgcagatgccggtaataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgtg
gagccagcaccgggcccgacagcgagagcatcccccacctctgcacacggctcccccagtccgacccgcatgccgccatc
cacagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgta
tctcacctccaccacggcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaac
atcgcggagtggatgactgagtatttaaatggacctctgaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtcttcagttgctcctggccctccattaagacggtcttcggtgtggctgcgc
ttggagcagctagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|A0A665U7Y7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Echeneis naucrates GN=BCL-2 (length=687 residues).
atggagagcgagtggaaccgcaatattgtggaaaattatttacgctataaactcgccaaacggggctatgcgtggggatt
tgatgacgtccggaatgaagatgctgctactaatggctcaatagttgccccatccccgactttggtccgccggttccgcg
aagccagcagcgggcccgacaaccagagcgcgcccgagcggtacggacggcccccgcagtccgacccgaacgccgacatc
cacagagtcctccgggaggccggagacgaacttgagaggttgtaccagccggacttcacggagatgtcccggcagctgta
catctcctcctccgtggcgcagaggaggttcgccgaggtgatagacgaactcttccgggacggagtgaactggggccgga
ttatcgccttcttcgagttcgggggggccgtgtgcgtcgagtgcgcggccaaggaggagttgagcccgcaggtggacaac
gtcgcggagtggatgacggagtatttaaacggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagggcgactccatcttcagctgctcctggccctccatcaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A4W4F7Z4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Electrophorus electricus GN=BCL-2 (length=672 residues).
atggcaaacgaaaatctcgatcataatcgtaacatagtagaaaagtatctcaaccacaaactgtcgaaaaatgggtacat
gtgggaattccattcgcgtgagacggaccctgaccctgcctctaatggctttgacgctccggagcggcgatgtcaagcaa
gcacagacgaggaagagaccgttcaccgagccccacgcgcgccccttcccgacccgtatgctgctctccacagggttttg
cgcgaggccggcgacgagctggaaagattatatcagccggactttgccgagatgtcaaagcagttacacctaacatctat
cacggcgcagagaaggttcacagctgtcatagacgaactgtttagggacggggtcaattggggtcggattattgcgtttt
tcgagttcggagcgtcggtgtgtgtagaatgtgtaaataaagagatgagtgcgcaggtggataacattgcgggctggatg
acggagtatttgaatggaccactgcacagctggatccaggagaacggtggatgggatgccttcatggagctgtatggcag
gcaaaaggactccgttttcagtagttcttggccttccatagtgacagtcttcagcttggcagcactgggagcagtcggct
tcaccataggagcctacttagctcagaaatga
>gnl|bcl2dbcds|A0A8C4L1K6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus asinus asinus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcgaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgtatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q2HRY3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus caballus GN=BCL-2 (length=858 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcaaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctggcaactttgccaagcaccaacaggctctcaggaaatgttcagcggtgggtggaccattcattctggctctccattgc
agaatctttgtgtgtcaagggcaggaaattggttttcagagaagaaaaatatgacttggtgtttaacttcagacaaggat
gtaatcgacaggacacccatccgcatgtatcagggaaggaagagtagagaggcagaaatacaaagccagtgcagacctcc
gtgcatgctgctgcacctgctggaaatccaggttccagttctgtttctcagtgagtaa
>gnl|bcl2dbcds|A0A6Q2YIU6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Esox lucius GN=BCL-2 (length=678 residues).
atggcagacgacgataaccgttttatagtggaaaagtacatttgtcacaaactcttaaaacggggatatgcatgggattt
cgaagatgcagaggaggaagatggtgctaataatgggtcgatgatttctcctccgccgggtttggtacggcggattcatg
gggccagtaaagccggacagggcagcgttccccatatttccaaatggctctcccaaccagacccgcatgcagctattcac
agagtgttgcgtgaggccggggacgaactcgaaagactgtaccaacccgactttttggagatgtcacaccagctgtatct
gacgtcctctgtggccgagaggagattcagagaggttatagacgagctgttcagagacggagttaactggggacgtatta
tcgctttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggaaatgacttcgcaggtggaccacattgcc
gggtggatgacagaatatctaaatggacccctgcacagctggattcaagaaaacgggggatgggaggcctttgtggagct
ctatgacagacagagggactctgtgttctgttcatggccctccatcaagactgtctttggcctggctgcactgggggctg
caagcctcaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A8C4U538_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=687 residues).
cagaggaacatatttatagtccaagctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatcca
ctataaactctcgcagcggggatacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctg
ctgctgctgctgcggttgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggctgctgctagccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccct
gcgccaggcgggggacgagttctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgccct
tcacggccaggggccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttc
ttcgagttcggcggcgtgatgtgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggat
gaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggtacgtcccccgattgctcgttccc
tctcctggctctggtgcacagccagtggggctccggggtgggcagta
>gnl|bcl2dbcds|A0A8C4U538_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Falco tinnunculus GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagcgggg
atacgactgggctgccggcgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgcggttgctg
ctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccacgtgcccccggctgaggggctgcgccccgcaccccaggttgtccacctcaccctgcgccaggcgggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtctggccagttgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtggccttcttcgagttcggcggcgtgatg
tgcgtggagagtgtcaacagggagatgtctcccctcgtagacagcatcgctgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A5F5Y6Y3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=714 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgt
ccctgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A5F5Y6Y3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=675 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgccgcg
ggccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccg
ccgcgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggagg
agctcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtc
aaccgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggat
ccaagacaacggaggctggctaatcttgctgcctcgtacctcgtatgaattaaaaagctcccgggctctccgtgaagacg
taagaatttcaccctcttttctttttaaagactag
>gnl|bcl2dbcds|Q8I008_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Felis catus GN=BCL-2 (length=708 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactatgagctgccgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgctgccgcgggccct
gcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcga
cttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctct
tcagggatggcgtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagggcgtcaaccga
gagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccagga
taacggaggctgggatgcctttgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgtccctga
aggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A803VR88_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A803VR88_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ficedula albicollis GN=BCL-2 (length=690 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgagcacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccccgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtccacctggtcctgcgccaggcgggcgacgagttctcccggcg
ctaccagagggactttgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgcttcgtggccgtgg
tggaggagctcttccgagacggggttaactggggcagaatcgtggccttcttcgagtttggcggcgtgatgtgcgtggag
agcgtcaacagggagatgtctccgctggtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaacggaggctgggacagaagctgcttcgccaaatacttttttgtagctgcacagctatggataccag
ctttggataccaacacaagggctattcatgcttctccactggaaaaatga
>gnl|bcl2dbcds|A0A8C5C4C3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gadus morhua GN=BCL-2 (length=717 residues).
atggcgaacgtgtgcaaccgcgatatcgtgcaaaagtacattttccataaactgtccaagcaggggtatatgtgggaatt
cgaggacgctgtggaggaagaagaagtggggaataataggtcgatcatcgctcctccaccgactttggtgaaacgatgtc
gaggagaagtgggggacgacaacgacgccaacaccgggccggagagcatcccccgtctttccaagcggatcacggcccgc
cacggggacccgcgcgcggcgacccaccgggtgctgcgcgaggcgggggacgaactcgagagactctaccaggcggactt
caccgagatgtcgcaccagctgtacctcacgtcgactacggcgcagaggcggttcagggaggtgatcgacgagctgttca
gggacggcgtgaactggggccggatcatcgcatttttcgagttcgggggtacagtgtgcgtggagtgcgccggcggccag
gaggaggagatggtggcgcaagtggagcacatcgccgagtggatgactgagtacatgaacgggcatctgaacaactggat
ccaggacaacgggggatgggagtccttcgtggagctgtacgacagacagcgggggtcggcgttcagctgtgcctggccct
ccatcaggaccgtgtttggtctggccgcgctgggcgccgccagcctcaccattggcgcgtacctcactcagaagtga
>gnl|bcl2dbcds|A0A452I9V7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gopherus agassizii GN=BCL-2 (length=663 residues).
atgtatttaactgcatgtgtctgtacgttgcactggagggaaaagcacagtacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatatgattgggctgccaatgaaa
acagaggaccagtttcaccaaatctctctccccctactgttactgggacctcatctgaccatgctgggctgatgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctgcgcccagcaccgcaggctgttct
cttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgcccagatgtctggccagctgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaatttggtggtgtgatgtgtgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgactgaatacctgaacagacacctacacaactggatccaggacaacggaggctgggtatgtgtccagtatt
tctttctctttaaattacagtaa
>gnl|bcl2dbcds|A0A8C4VT25_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttcaccaaatctctctccccctactgctactgggacctcatctg
accatgctgggctgatgtctctgcctcctgagccccctggctcggctgctgctagtaacgtgccccttggtgatgggctg
cgcccagcaccgcaggctgttctcttggctctgtgccaagctggagatgaattttcccgtcgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaatttggtggtgtgatgtgtgtggagagcgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgactgaatacctgaacagacacctacacaactggatccaggacaacgg
aggctgggatgcctttgtggaattgtacggcaggaacatgaggcctgtgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcaccctgggcgcttatctgggacataagtga
>gnl|bcl2dbcds|G3QES9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgtgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggaccgggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtctcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q2UYW8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=159 residues).
atgaatcccagggttccaggccaggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctg
gctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=618 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=597 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctggctttacatgtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=807 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctggacagaaactcaggatctgttcaacagtaatgcctgttcccccacgcctgcagcct
tggcaaccaccatactactgcctgcctctatgaacttgactactctaggtacctcgcataagtggactcacacttgtgac
tggcttgttacactaagcatgatgtcttcaaggttcatccatgttttggcctgtgtcacagcttccttcattttgaaggc
tgaatga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=141 residues).
atggaggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggctgtctctgaagactct
gctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7I2V3S7_BCL2-10 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=618 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggtaggtgcacttggtgatgtgagtctgggctga
>gnl|bcl2dbcds|A9QXG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Homo sapiens GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacggggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatccagccgcatcccgggacccggtcgccaggacctcgccgctgcagaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgagccacaagtga
>gnl|bcl2dbcds|A0A4W5KV00_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgctgaggaggaggaaggtgctgctaataatgagttgatgatttctcctcgcccgggtttggcacggcggtgcc
acggggccaataacgccggaccgggcagcgttcctcgtctttccaaatggctctcccaaccggacccacatgcagcaatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagccagacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacctcgcaagtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaagcctttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccattggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A4W5NW18_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttatgacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaagcagaaaacgattatccaaataatggctttggggacccctctgcaccgaacacccgcgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctcaacagggtcctgcgcgaggcgggtgacgagattggaagaatttatcacccggactttgcagagatgtc
ggggcagttgcattttacgcccaacacggcacagagaaggtttacggctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgcccgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccattggagccttgttcacccagaagtga
>gnl|bcl2dbcds|I3MVK9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL-2 (length=588 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccataccccggccgccaggacctcgccaccgccacccccggctgcccccgctgccgccgcggggcccgtgctcagc
ccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccga
gatgtccagtcagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggtaggtgcacgtcgggttgaatga
>gnl|bcl2dbcds|A0A8C5JYS0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Jaculus jaculus GN=BCL-2 (length=711 residues).
atggcgcacgcggggaccaccgggtacgataaccgggaaatcgtgaggaactacatccactataagctgtcgcagagggg
ctacgcgtgggatgctggcgacgtgggctcggcgaccccgggagccacccccgcgccgggcatcttctcctcccagcctg
ggaacgacaccacatcggccgtgccccgggatccagcagccaggacctcgccgccgccggccgcggccgcccccgccggg
cctctgcctggcccggtcccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcgggggcgcttcgccacggtggtggaggagc
tgttccgggacggggtgaactgggggcggatcgtggccttctttgagttcggcggggtcatgtgtgtggagagcgtcaac
cgggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgcctttgtggagctgtacggccctggtgtacgacccctgtttgacttctcctggctgtctc
tgaagaccctgctgagcctggccctggtgggggcgtgtgtgactctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=1014 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
atgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagt
ctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=999 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
gctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgcattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaacaagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtgtctaaagactatgaacaagtggaaaatgttctaaaaca
ggctcaggagaagttggggccagttgatatgctcgtgaactgtgcaggaacatcagttacaggcaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtgaattacctgggcagtgtttacccaagccgagcagtaatcgctaccatg
aaggagcgcagaatgggaaggattgtcttcgtgtcgtctcaggctggccagctgggcctgtttggatatacagcttattc
tcccaccaagtttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacggtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctgatttctgaa
acctcatctgtttgccaagcagagcaagttgccagagttatagtgaaagatgccatacaagggaacttcaacagctcagt
tggatcagatggttacatgctgtcaatattgacaagtgggatgtcaccagtcacttctattactgaaggtcttcagcagg
ttgtttgcatgggcatttttcgcatcattggcctattttacctaggaagttttgacagcatagttcgtcgctgcatgatg
caaagggaaaaatctgaaagtgcagataaaactgagtaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaatggaatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacataaatag
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggagctacagaaggactggcttggcagtggcctgtcgcacttggcaactttttttga
cgttgacgtggggaacactgaagggatgcagttggtgtgggagaaacaactgtgtttgtcttgcagtgatgggttccctc
tttgggcacacaacctaa
>gnl|bcl2dbcds|A0A8C5IH35_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Junco hyemalis GN=BCL-2 (length=726 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggacttcctctgatcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccacgcg
cccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcgggggacgagttctcccgacg
ctaccagagggacttcgcccagatgtccggccagctgcacctgacgcccctcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgcgatggggttaactggggcaggattgtggccttcttcgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaa
ctggatccaggacaacggaggctggatttcaggatctgtcagtgtgaaaggatgctttaattcctgtgcccggtcttcaa
cttgcttcttgcaccataccccatatatgaaccttattaataaatggctcttccagagtggctttgtatgtggtcatgct
tggtag
>gnl|bcl2dbcds|A0A3Q3B0R2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL-2 (length=894 residues).
atggaggtgaatcgcttcattgtggaaaactatatttgccacaaactctccaagcgcggctacgcgtggggctccgaccg
cccccgccgcgtccgagacgatgctgccaacaacggctcggtggcgagccagtccccgaccctggtccggaggtgccgcg
gcgcacgaggagccccaggaggagcaggaacggcgccccctgacgcggagagcgaccccgaccccgtcctctgcgggcgg
atctccccgcacgagccgctcgcgcacatccacagggtgctgcgcgaggccggcgacgagctggagcgcctctaccagcc
ggacttcgtggagatgtcgcggcagctggggctcgccagcgccgcggccaaggcgcgcttcgccgaggtgatggacgagc
tgttccgggacggcgtcaactggggccgcatcattgccttcttcgagttcggcggcacggtgtgcgtggagtgcgcgtcc
agggaggagatgacgccgcaggtggaccacatcgcggagtggatgacggagtatttaaatggacctctgaacagctggat
agaggataacgggggatgggatgcgttcgtggaactgtacgacagacacaaggagtccgtcttcagctgctactggccgt
ccatcaagacagtcttcggcctggcggcgctcggggcggccagcatcaccatcggcgcgtacctcacgcaaaagatgccc
ctgacccctcagagacaaccttcagaccagatctggctctcttcaaagcctcgctcagagaactgctttcctcctcctgc
gcctccatgtcaaaacagacacaaatcaaaacagcagagggaaccagaggcacggcccagagagcaaaggatgtctgagg
tggaatcacactag
>gnl|bcl2dbcds|A0A3Q3G1D7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Labrus bergylta GN=BCL-2 (length=690 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgtcataaactctccaaacggggctacgagtggggatt
cgaggatgagcaggatgaagatgctgctaataacgggtcattagttgcccctccgccgactttggttcgccggtgccgtg
aagcgagctccgggcctgaccgtgagagcatcccccacctctgcaaacggcccccccagtccgacccagcctacgcggat
atccacagagtcctgcgcgaggctggagatgaacttgaaagactttaccagccggacttcacggagatgtcgcggcagct
gtatctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgtttcgggacggggtgaactggggcc
ggattatcgcctttttcgagttcgggggcacggtgtgcgtggagtgcatgtccaaacaggagatgacatcgcaggtggac
aacatcgcagagtggatgacggagtatttgaatggacctctgaacagctggatacaagataacggtggatgggatgcctt
tgtggagctgtacgacagacagagagactcggccttctgctcctcctggccctccattaagacagtcttcggtctggcag
cactcggggcggctagcctcaccattggagcataccttacacagaaatga
>gnl|bcl2dbcds|A0A4W6DDI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lates calcarifer GN=BCL-2 (length=690 residues).
atggcgagcgagtgtaatcgcaatatcgtggaaaagtatatctgccataaactctccaaacggggctacgtgtggcggtg
tgacaacgtccgggatgaagatgctgctaataacgggtcgatagtttcccctccgccgactttggtacaccggtgccgcg
aagccagcgggcccgacgacaacgagagcgtccccaacctgcgcaggcggctcaaccctcagcccgacccgtacgccgcc
atccacagagtcctgcgcgaggctggagacgaacttgagagactgtaccagccggacttcacggagatgtcgcggcagct
gtacctcacctccaccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggcc
ggattatcgcattcttcgagttcgggggcaccgtgtgcgtggagtgcgcggccaaggaggacatgacgtcgcaggtggac
aacatcgcggagtggatgacggagtatttaaatggacctcttaacagctggataaaagataacgggggatgggatgcctt
tgtggagctgtacgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacggtcttcggcctggccg
cgctcggggcggctagcctcaccatcggagcgtaccttacgcagaagtga
>gnl|bcl2dbcds|A0A8C5S4J3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL-2 (length=618 residues).
atggctcatcctgggataagagattacagtaaccgggagatagtgctgaggtacatccattacaagctgtcacagaaagg
atatgactgggttgccagtggagacagagaaaatgtttctcctgctgttgggacctttcctgcccttggaggactggtgc
ctctgccttctgctgctgttagtaacttggctgccactgaagaacatcctgtaccccaagttgtttattccacactatgc
caagctggtgatgagttttcccggagatatcaaagggactttacccaaatgtctggacaactgcacttgactccagtgac
tgccagaagtcatttcatggctgttgtagaagagctgttccgagatggagtaaattggggaaggattgtggcattctttg
aatttggtggcatgctgtgtgtggaaagtgtcagtcgggagatgtcacctctcgtggacagtattgctgaatggatgact
gaatacatgaacaggcacctgcataattggatccaggacaatggaggctgggtacgtggctggttgtgttctttcactgt
ctggggtgggcgtggcctgtatgtgggccaccagtttgacatccctgacttagactga
>gnl|bcl2dbcds|W5N4F7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL-2 (length=696 residues).
atggcaaataacgaagccccgtacgatactcggaatatcgtgacaaaatacatccatcacaaactcctgaagaagggcta
cgtgtgggaatcccgcgtgtccggcgagaccgatccccccaataacggattggtgggcccctccgcctcgggtccggggc
tgcaggcgcggcggctccaggctgccggggccgagcgcggagctgtcccggtcccccgccggacccccccgcccgacccc
cacgccgctctccacaaggtgctgcgggaggctggggacgagatcgagaggatgtaccaccgggacttcgcggagatgtc
ggatcagttgcacttcacccccaacaccgcccggaggaagttcaccgcggtggtggaggagctgtttcgggacggagtca
actgggggcggattgtcgctttcttcgagttcggcgggacgatgtgcgtggagagcgtgaaccgggagatgacgtcccag
gtggacaacattgccaactggatgacggagtatctcaacgggccccttcagaactggatccaggagaacggaggctggga
cgcctttgtggagctctatgggagacagagaggctccatgttcagctgttcatggccatctttgaagactttctttggtc
tagctgctctgggcgcagcaggcctgaccgttggagcctactttacacaaaaatga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=891 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatgggagtcgtttgtggaattgtatgacagcagcgtcagacccccatt
tgaccccagttggatctccatcaagacaatactgagtcttgctgtggttggagcctgcatcaccataggagcataccttg
gtcacaagtga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=822 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatgggtgtcatttttcaaccttttctacatacacttcctggtcgaggc
ctcatttatagatgctcaatga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=888 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatggttaaacacattgcctgagattgagacgctgcagagtcttattcg
agaaacacagagatcattgcgtcagtcccacagaaagaatgaatgcacctggataaagagagcgcagaggattttgacac
attcttga
>gnl|bcl2dbcds|A0A8C5MT36_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL-2 (length=876 residues).
atggctcatcccaggcgagcggggtacgaccaccgggacatagtggtaaaatatattcattataagctatcacagagggg
ctatgaatgggaagatgggaggcagcaggtttctgttgatcttcaggatgcttctgctgctaataataatcattctgatg
gtgacgaagtgtccgcttcacctggagatccacttggaccacgtcacgacacacctctgaatgctgctgcttctacgtca
aataatgcatcccaaaataatgcccccaccgctcttttagacaatgcacctgctgctcagaggagctctgcttctgctgc
ttctaccgtcccttcaccacagggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaaatcaattag
tggatggcgatggagaggatgctcttgtacgaccagttccccaagcggttctccagactcttagccgagcaggcgatgag
ttttcccggctgtaccagcaagactttaggcagatatccgggctcctccacttaaccccatcaacagttcgtccacggtt
tgctgctgtggtggaggaactcttccatgatggggtgaactggggaaggattgtggctttctttgagtttggaggtgtca
tgtgcgtggagagtgtgaatcgggagatgtcaccactggtggactccatcgttggttggatgacagagtacctgaatagg
catctgcaaaactggatccaggaacaaggcggatggtgctgggcttccttagagctggttcagacaggacatgcttcgac
tccctgtaagctgcagcatttgacatggccgtggcgaggcagccaatcaaattactctcaaggccgaacacattga
>gnl|bcl2dbcds|G3SLZ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=690 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctagcgccgcgccccccggggccgctcccgcgccgggcgtcctctcttctccgcccg
cggcgccccggggcccggacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcccggtgcca
cctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgagatgtcgag
ccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacggggtgaact
gggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggatgggatgc
ctttgtggaactgtatggccccaacatgcgacctctgtttgatttctcctggctgtctctgaagacactgctcagtctgg
ccctggtgggagcttgcatcaccctgggtgcttacctggggcacaagtga
>gnl|bcl2dbcds|G3SLZ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Loxodonta africana GN=BCL-2 (length=504 residues).
atggcgcacgcagggagaacaggttatgacaaccgggagatagtgatgaagtatatccactataagctgtcgcagcgggg
ctacgaatgggaggctggcgaagctgacaccaggacctcgccgctccaggctgacccggccgcgcagccggcgctcagcc
cggtgccacctgtagttcacctgaccttgcgccaggccggcgacgacttctccaggcgctaccgccgcgacttcgccgag
atgtcgagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggacgg
ggtgaactgggggcggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacatcgccctctggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggagga
tgggtaggtgcatgtgtggttgaa
>gnl|bcl2dbcds|A0A667GHH0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Lynx canadensis GN=BCL-2 (length=696 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccggggccgcccccgcgccgggcatcttctcctcccagcccgggc
gcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgcgggccctgcgctcagcccc
gtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagat
gtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggag
tgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgagagatgtcgccc
ctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacgtggatccaagacaacggaggctg
ggatgcctttgtggaactgtacggccccagcatgcagcctctatttgatttctcctggctgtccctgaaggccctgctca
gtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A7N9CNB8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gccgtcgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A5F7ZZ15_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca mulatta GN=BCL-2 (length=726 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctc
ccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgcca
cggtggtggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgt
gtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacct
gcacacctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatt
tctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccac
aagtga
>gnl|bcl2dbcds|A0A2K6CIX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Macaca nemestrina GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C5TLV4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL-2 (length=720 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccagcgaggacagggcacccctgcctccaggtctctctgctcctgctgctgctgcggttgctgctg
ctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagccacacg
cccccggccgaggggctgcgccccgcaccccaggttgtccacctcgtcctgcgccaggcgggagacgagttctcccgacg
ctaccagagggactttgcccaaatgtctggccagctgcacctcacgcccttcacggccaggagccgcttcgtggcggtgg
tggaggagctcttccgagatggggttaactggggcagaattgtggccttctttgagttcggcggtgtgatgtgcgtggag
agcgtcaaccgggagatgtctcccctcgtagacaacatcgccgcctggatgaccgagtacctgaaccggcacctgcacaa
ctggatccaggacaatggaggctgggatgcctttgtggagttgtatggcaacagtatgaggcctttgttcgatttctcct
ggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcatatcttggacataagtag
>gnl|bcl2dbcds|A0A2K5XRD4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccactgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C5YTS1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL-2 (length=687 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
gnnnnnnnccggccgccaggacctcgcccccccggccccccgctgccgccgcggggcccgtgctcagcccggtgccacct
gtggtccacctgaccctccgccaggccggcgatgacttctctcgtcgctatcgtcgcgacttcgccgagatgtccagtca
gctgcacctgacccccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactggg
ggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggac
aacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctt
tgtggagctgtatggccccagcgtgcggcccctgtacgacttctcctggctgtctctgaagactctgctcagcctggccc
tggtgggagcctgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacgcggctacgtgtggggatt
tcataacgtccaggatgaagatgctgctaataatggctctgtagttgcccctccgccgactgtggtccgccggtgccgtg
acgcgagcaccgggcccgacagcgagagcatcccccagctctgcagagggctccctcagtccgacccacaagccgccatt
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtatcagccggactttacggagatgtcgcgacagctgta
tctcacctccaccacggcgcagaggcgattcgccgaggtgatagatgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcggccaaggaggagatgacatcgcaagtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcctttgt
ggagatgtatgacaggcagagggagtctgtcttcagttgttcctggccctccatcaaaacagtcttcggcctggctgcac
ttggggcagctagcattactatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1017 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagg
atgcctttgtggagatgtatgacaggcagagggagtctgtcttcagttgttcctggccctccatcaaaacagtcttcggc
ctggctgcacttggggcagctagcattactatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgc
cattaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaac
aggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtg
gaggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccat
gaaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatact
ccccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtg
gcctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctga
aacatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccg
tgggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcag
attattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgat
tcagagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1077 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagccgatgccatttaacttaaggtttcataagactgtgtacaa
tttcttaattcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaacagg
ctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggag
gtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatgaa
ggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactccc
catccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcc
tacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaac
atctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgg
gacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagatt
attaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattca
gagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=1059 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgc
cattaatgacaagcaggtatgggtttatttgagtagaagtgacttttttgctgttgtgcaggctcaagaaaagctgggac
ctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggaggtggaccgttttaaaaaa
ctgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatgaaggaacgcagaatgggccg
catcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactccccatccaagtttgccctgc
gaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtggcctacccgccagacacagac
actccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaacatctggcgtttgtcaacc
agagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgggacctgatggttacatgc
tctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagattattaccatggggttattt
cggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatc
agctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=807 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaataaagccgtacaacatctatgtgaccgtggcctacccgccagacacagacactccaggattg
gctgaggaaaataagacaaagcctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccagagcaagtggc
caaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgtgggacctgatggttacatgctctctgccctca
cctgtggaatgtcacctgtcacgtccatcacagaagctctccagcagattattaccatggggttatttcggaccatcgcc
ctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatcagctgacaagag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=990 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcagtacaggggaacttcaacagttccgt
gggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcacgtccatcacagaagctctccagcaga
ttattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgatt
cagagggagcatgacacagctcttccgtag
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=936 residues).
actcatctattggacctttgggtttatgatctcctgactcttttgaactttcaggtgacaggaggctcaagtggaattgg
gaagtgcatcgcgatcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaag
caaaaaaagaggtggagaaatttgccattaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattat
aatcaggtggaaagtgtgataaaacaggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatc
tgtttctggaaagtttgaggaagtggaggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatc
caactcgggccgtcataaccaccatgaaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagatt
ggcctgtttggatacactgcatactccccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaa
gccgtacaacatctatgtgaccgtggcctacccgccagacacagacactccaggattggctgaggaaaataagacaaagc
ctctagagaccaaattaatctctgaaacatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgca
gtacaggggaacttcaacagttccgtgggacctgatggttacatgctctctgccctcacctgtggaatgtcacctgtcac
gtccatcacagaagctctccagcagattattaccatggggttatttcggaccatcgccctcttctacctggggagttttg
acagcattgtacgccgctgcatgattcagagggagcatgacacagctcttccgtag
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=894 residues).
atgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctaca
ggcaaggagcgttcatcactctggtggcacgagatgagactaagttgcttcaagcaaaaaaagaggtggagaaatttgcc
attaatgacaagcaggtggtgctctgcatatcggtggatgtttccagtgattataatcaggtggaaagtgtgataaaaca
ggctcaagaaaagctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtgg
aggtggaccgttttaaaaaactgatggaagtgaactacctgggcagtgtttatccaactcgggccgtcataaccaccatg
aaggaacgcagaatgggccgcatcatgtttgtgtcctcccaagctggccagattggcctgtttggatacactgcatactc
cccatccaagtttgccctgcgaggcttggcagagtcactgcagatggagataaagccgtacaacatctatgtgaccgtgg
cctacccgccagacacagacactccaggattggctgaggaaaataagacaaagcctctagagaccaaattaatctctgaa
acatctggcgtttgtcaaccagagcaagtggccaaaattgttgtgcgagatgcaattattaccatggggttatttcggac
catcgccctcttctacctggggagttttgacagcattgtacgccgctgcatgattcagagggagcagtcaaaatcagctg
acaagagggagtaa
>gnl|bcl2dbcds|A0A3Q3MEY1_BCL2-10 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL-2 (length=525 residues).
atgtcctctgaagaaagcttgagctccacgatcacagattggcttttcatcaactcctggtggctccttcttcccttcat
catgcttcttgtagttgccgccttcattgttgcctttgtgttgctgttatatatgatatcgccccttattagccccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtggaattgggaagtgcatcgcgatcgagtgctac
aggcaaggagcgttcatcactctggtggcacgagatgagcctggttgtctttatagccaggtgaaaaacgctcaagaaaa
gctgggacctgttgatatgcttgtgaactgtgctggaacatctgtttctggaaagtttgaggaagtggaggtggaccgtt
ttaaaattattaccatggggttatttcggaccatcgccctcttctacctggggagttttgacagcattgtacgccgctgc
atgattcagagggagcagtcaaaatcagctgacaagagggagtaa
>gnl|bcl2dbcds|A0A3P9DIG5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Maylandia zebra GN=BCL-2 (length=687 residues).
atggagaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctcctccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|G1MZW1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL-2 (length=660 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtgcccccggccctggctcccactgctgctcccgctccccccggct
cggctgctgctagtgaggtgcccccagctgaggggctgcgccccgcacctcccggcgtccacctcgccctgcgccaggcc
ggggatgagttctcgcgccgctaccagagggactttgcccagatgtcgggccagctgcacctgacgcccttcacagccca
cggccgcttcgtggccgtggtggaggagcttttccgtgatggggtcaattggggccggatcgtcgccttctttgagttcg
gcggcgtgatgtgcgtcgagagcgtcaaccgggagatgtcgccgctggtggacaacattgccacctggatgaccgaatac
ctgaacaggcacctgcacaactggatccaggacaacggaggatgggatgccttcgtggaattgtacggcaccagtatgag
gcctttgtttgatttctcctggatctctctgaagaccatcctgagcctggttctggtgggagcttgcatcactcttggcg
cttatcttggacataagtag
>gnl|bcl2dbcds|A0A8B7H1C6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Microcebus murinus GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagaagcgagcgctgcgcccccgggggccgtccccgcacctggcatcttctcttcccagcccg
ggggcaccccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccggccgcccacgccgctgccgcgggg
cctgcgctcagcccagtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgccttcgtggaattgtatggccccaacatgcggcctctgtttgatttctcctggctgtctc
tgaagactctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaaatga
>gnl|bcl2dbcds|F6YNL8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodelphis domestica GN=BCL-2 (length=567 residues).
atgatggctcaccctggaagaagaggatatgataaccgggagatagtgatgaaatacattcattataaactgtcacagag
ggggtacgagtgggatgctggagatctgagggcaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctg
ttggaatcttctctacccagccacgaaacacaccattgcctgctgctgctgctgctggacctaccgtcagtccagtgcca
cctgtggtccacctgactcttcgtcaagctggagatgatttctctagaaggtaccggagagactttgatgaaatgtcagg
tcaactgcacctgacccctgttactgctaggggacgctttgccacagtggtagaggagctgttcagggatggggtgaact
gggggaggatcgtggccttctttgagtttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcattgccctatggatgactgagtacctgaaccggcacctgcacacttggatccaggataacggaggatgggtagg
tgcctag
>gnl|bcl2dbcds|A0A8C6AXM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Monodon monoceros GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgcgggcgccacgtccccgggggccgcccccgcgccgggcatcttctcctcccagcctg
ggagcaccccagcgccatccaggacctccccgccgccgccccagaccgctcccgccgcccccgccagggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggagtaaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtacggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C6CUJ2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Moschus moschiferus GN=BCL-2 (length=687 residues).
atggcgcacgcggcgggcacaggctacgataaccgcgagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggacgccggggacgcgggcgccgcgccccccggggccgcccccgcgccgggcaccctgtccgccgcgccgg
gccgcgcgcccgcgcccgccaggacctccccgccgccgccggccgccgccgccgggcccgcgcccagcccggtgccacct
gtggtccacctgaccctgcgccaggccggcgacgacttctcccggcgctaccgccgcgacttcgccgagatgtccagcca
gctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggcgtgaactggg
ggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggac
agcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgcctt
tgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctggccc
tggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q6NTH7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|A0A8C6H5J8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus spicilegus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctactctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|M3YYK3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL-2 (length=621 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
aagaccagtgatgaaactcgtgtacttacccaccgccccccccccaccccccctctcccgccaccgccgcccgcagctca
cctccccggccaccgccctcgccgccgctgccgccgcgggccctgcgctcagccccgtgccacctgtggtccacctgacc
ctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctgcacctgacgcc
cttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggattgtggcct
tctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctatgg
atgactgagtacctgaaccggcacttgcacacctggatccaggacaacggaggctggcctgcccccgccccccatgaagg
tccagctgccagacctattgttgatgattcctactggcccaaagtgttttccttgcttgcc
>gnl|bcl2dbcds|A0A8C6RID6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=711 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactgtatggacccagtgtgcggcccctgtttgacttctcttggctgtctc
tgaagaccctgctcagtctggccctggtaggggcctgcatcaccctgggtgcctatttgggccacaagtga
>gnl|bcl2dbcds|A0A8C6RID6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=642 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggtaggtgcacatctgactgaaggagtctgggtttcggtgatcattttctggtaccctgggaggt
ag
>gnl|bcl2dbcds|A0A8C7B9K2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Neovison vison GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggcgacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgcccccgccccccgccgccctcgccgccgctgccgccgcgggccctgcg
ctcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctatggatgactgagtacctgaaccggcacttgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagctgtacggccccagcgtgcagcctctgtttgacttctcctggctgtccctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A2I3GZF9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagccgg
ggcacacgccccatccagctgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C6ZF48_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nothoprocta perdicaria GN=BCL-2 (length=723 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctcaagtacatccattacaaactctcgcagagggg
atacgactgggcggccagcggcgaccgcgcgccggcctccccggcgctctcccctcctgctgctgctgctgctgctgctg
ctcctgctgctgctgggactccctctgatcacactgggccggtgtctcggcaccccgagccccccggctcggctgctgct
agtaacgagggcgaggggctgcgcccggcgccgcccggcgtccacctggccctgcgccaggccggcgatgagttctcgcg
ccgctaccagagggacttcgcgcacatgtccggccagctgcacctgacgcccgtcacggcgcgcggccgcttcgtggccg
tggtggaggagctcttccgagatggcgtcaactgggggaggatcgtggccttcttcgagttcggcggcgtcatgtgcgtg
gagagcgtcaaccgggagatgtcgccgctcgtggacagcatcgccgcctggatgaccgagtacctgaaccggcacctgca
gaactggatccaggacaacggcggatgggatgccttcgtggagttgtacggcaacagtatgcggcctttgttcgatttct
cctggatctctctgaagactatcctaagcctggttctggtgggagcttgcatcactcttggcgcttatttcggacataag
tag
>gnl|bcl2dbcds|A0A8C7CHJ0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=693 residues).
atgatggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatt
tgtatgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccaaccctccgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtgtaa
actggggtcggattgtggctttctttgaatttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C7G8X1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgctgctaataatgggtcgatgatttctcctcggccgggtttggcacggcggtgcc
acggggccaataacggcggaccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgactttgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcaactggattcaggagaacgggggatgggaggcttttgttga
gctctatgacagacagagggactcggtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A8C7N3I9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttggcacggcggtgccacggag
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtcg
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatgacggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C7Q7B4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL-2 (length=690 residues).
atggcaaacgataatccttataacagtcgctttattgttgaaaaatacatacatcacaaactgttgaagaagggatttgt
atgggaattttatccagaaaacgattccccaaataatggttttggggagccctctccccctaactcccccgaagtttttg
cacggaggtcccaaccctccgccgaaggcgtggacactgactctccgctccaaaacaggatcccgcaacctgaccgacat
gcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtcggg
gcagttgcattttacgcccagtacggcacagagaaggtttactgctgttatagaggagctcttcagcgacggtataaact
ggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggta
gacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactgggacgc
ctttgtggagatctatgggcagcagaggatctctgccttccactcctggccctacctaaagacagtgttcggcctggccg
ccctgggtgcagccggagtcaccattggagccttgttcatccagaagtga
>gnl|bcl2dbcds|A0A8C7RG50_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaaatgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgatgcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C8GL24_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacagcagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggctggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggtcgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=810 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatggatctgcaggcacttccaaag
gagactccccagaggagaccccccagaggagaccccccaaagggaccccccagaggagaccccccagggagactcccaaa
gtagaccccccaaagggactccccagaggagacccccacaggagaccccccagagggaccccccaaggagaccccccaaa
ggagaccccccgaggaggaccccccagaggagaccccccagaggagacaccccagcaagctttgaacatgggaatacaca
cactgcttga
>gnl|bcl2dbcds|A0A668TEB6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1017 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctgt
cggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcatttgtggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggc
ttggctgcgctcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A668TEB6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgc
catcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaac
aggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtg
gaggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccat
gaaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctact
ccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtg
gcatacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctga
aacctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcagtgcaggggaacttcaacagctctg
tcggtccagatggttacatgctatcagcgctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgtcaccatgggattgtttcggaccatcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgat
tcaaagggagcagtcaaaagcggccaataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=894 residues).
atgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagcc
tctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctaca
agcaaggagcgttcatcactttggtggcacgagacgaggagaagttgcttcaggcaaagaaggaagtggagaaatttgcc
atcaatgacaagcaggtggtgctctgcatctcagttgatgtttccagtgattacagtcaagtggaaaacgtgataaaaca
ggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcagtttctgggaagtttgaggaagtgg
aggtagatcgttttaaaaaattgatggaagtgaactacctgggcagcgtttacccaacacgagccgtcataaccaccatg
aaggagcgaagaatgggccgcatcatgttcgtttcctcccaggcgggccagattggtctgtttggttacactgcctactc
cccatctaagtttgccctgcgaggccttgcagagtcgctgcagatggagataaagccctacaatatctacgtgactgtgg
catacccccctgacactgacactccaggactggctgaagagaacaagacaaaacctctggagaccaaattaatctctgaa
acctctggagtttgtcaaccagaccaagtggccaaaatcattgtcagggatgcaattgtcaccatgggattgtttcggac
catcgcacttttttacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggcca
ataagagggagtaa
>gnl|bcl2dbcds|A0A668TEB6_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=561 residues).
atgtcctctgaagaagggttcagctcagcgataacagattggctttttatcaatacctggtggctccttcttccgttcat
catgctgcttgttgtcgctgccttcatcgttgcttttgtgttgctgttatatatgatatcgcccctcattagtcccaagc
ctctaaaattgaacggggcccacgtcgtggtgacaggaggatccagtgggattgggaaatgcattgctattgagtgctac
aagcaaggagcgttcatcactttggtggcacgagacgaggtggtgctctgcatctcagttgatgtttccagtgattacag
tcaagtggaaaacgtgataaaacaggctcaagaaaagctaggtcctgttgatatgcttgtgaactgcgctggaacttcag
tttctgggaagtttgaggaagtggaggtagatcgttttaaaattgtcaccatgggattgtttcggaccatcgcacttttt
tacctggggagctttgacagcatcgtgcgccgctgtatgattcaaagggagcagtcaaaagcggccaataagagggagta
a
>gnl|bcl2dbcds|A0A668TEB6_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis aureus GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggttcaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggggccgga
ttattgctttcttcgagtttgggggcacggtgtgcgtggaatgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagctgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagtctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A5F9CRQ4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=681 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggatgccttcgtgga
actgtacggccccagcgtgcggcctctgtcagacttctcctgggtgtctctgaagactttgttcagcctggccctgatag
gagcttgcatcaccctcggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A5F9CRQ4_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL-2 (length=1170 residues).
atggcgcacgccgggcgaacagggtacgacaaccgggagatcgtgatgaagtacatccactataagctgtcccagagggg
ctacgagtgggacgctggggacgcgggcgccgcctccgcgccgggcgtcttctcctcccagcccgcgcccgctgcgcccc
gggacccggccgccaggacctcgccgccgccgccgccggccgccgcggggcccgcgctcagcccggtgccacctgtggtc
cacctgaccctccgccaggcgggcgacgacttctcccggcgctaccgccgcgacttcgcggagatgtccagccagctgca
cctgacgccctttcacgcgagggggcgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggagga
ttgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatc
gccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataatggaggctgggcagacaaaagccc
ttggatctcggggtgtctttgtacttctcggagagccaccccaggagcacattccctgacggagggctcagccacctctt
ccgcctcattatactctgctcagcaccgagaagcctggcatggtttctgctggaatgaaaagattggcagagctgcccta
gacaacagcaccgcaaaacactgtggcagaaggtttggtctacataccaaggcagccaaagtattaattgcattctctgt
gatcgcaaaaaaggcgctgaattcttctcttcacgttttcagaatgacagacttctgctctgccagctctgagcacagcg
catcacatggaaaggagcggctagatttgagggggaaaactcagaagacggatgatggtagccagctagttcttcaaaaa
gagttccccgtgaactgtttcggaactgtggaaggtcagaagcagagtaaggatgtacttccatgcatttacataatcta
cgaagccttttcccatcttgaagtcttactttatgtgttgcagtgggacctggccagctgccagctgcagtttgagccca
tttccttttgcattggtttctgtgtccagggaaaccttgtttctctatga
>gnl|bcl2dbcds|A0A8C7ZK61_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias sinensis GN=BCL-2 (length=687 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatttgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcccgagaatgctgccaataacggctcggttggggaccattccccgactccggtccgccgccgctgcg
acgcaggaacggggcctgacgaggagagcagcccccgcctcatcagagcgctctcccgggcggacccgctcgcggacatc
cacagggtcctgcgcgaggcgggagacgagctggagcgcctgtaccagcgggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccaacgaggagatgagcacgcaggtggccagc
atcgccgagtggatgacggagtatttaaacggacctctcaacagctggattgaagaaaacgggggatgggatgcctttgt
ggagctgtacgacagacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgtcttcggcctggctgctc
tcggggcggcgagcctgaccattggagcataccttgcacaaaagtga
>gnl|bcl2dbcds|H0WKI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgtgggcgttgcaccccccggggccgccactgcgccgggcgtcttctcctcccagcccg
ggcgcacccctactcccgctgcgccccgggacccggccgccaggacctcgcccccggccgcccccgccgccgccgccgcc
gcggagcctctgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctctcgccgcta
ccgccgcgacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgagaggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctgtttgacttctcctggc
tgtctctgaagaccctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C8ANG9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otus sunia GN=BCL-2 (length=732 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgct
gctagccacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtccacctcgccctgcgccaggcgggcgacga
gttctcccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggcccggggccgct
tcgtggcggtggtggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagtttggcggcgtg
atgtgcgtggagagtgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccg
gcacctgcacaactggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtatgaggcctttct
ttgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctc
ggacataagtag
>gnl|bcl2dbcds|A0A2R9APW6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan paniscus GN=BCL-2 (length=582 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccctcagcccggtgccacctgtggtccacctgaccctccgccagg
ccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcg
cggggacgctttgccacggtggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtt
cggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagt
acctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatg
cggcctctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctggg
tgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C8XJU8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Panthera leo GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccctgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccgccgccgccgccgccgcgggc
cctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccg
cgacttcgcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagc
tcttcagggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgagagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
agacaacggaggctgggatgccttcgtggaactgtacggccccagcatgcagcctctgtttgatttctcctggctgtccc
tgaaggccctgctcagtctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C9J3W6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL-2 (length=498 residues).
atggcgcacgctgggagaacagggtatgacaaccgggagatagtcatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggacgcgagnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgccgccgccgcgggccctgcgc
tcagccctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttc
gcggagatgtccagccagctgcacctgacaccctttaccgcaaggggacgctttgccacggtggtggaggagctcttcag
ggatggagtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgagaga
tgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaagacaac
ggaggctgggtaggtgca
>gnl|bcl2dbcds|A0A096MPU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Papio anubis GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccgggc
acacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgccgcc
gcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccgcta
ccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtggtgg
aggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcctggc
tgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A3B3TCS4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL-2 (length=693 residues).
atggcaaacgacgtcccatacgacagccgaaatattgtagagatctatatataccataaactgctgaaaacaggctatgt
gtgggaattccaggcggccggagacaccgattctcccaataatggatcggtggactcccctcccggctctcaagttttgg
cacgccggtcccaagcagctgccgccggcggagaggacgcgtcgcctgtccgcagccggacgcccagatttgatccacac
gcccggctgcacagggtcctgcgcgaagcgggggacgagatcgagaggatgttccagcgggacttctcagaaatgcacga
agagctgcacatcacgcccagcacggcgcagcgccgcttcacggccgtcatcgaggagctgttcagcgatggcgtgaact
ggggccgtattgtggcgtttctcgagttcggcggcaccatgtgcgtggagagtgtcaaccgagagatgacgtcccaggtg
gataacattgcacactggatgacggagtacctgaacggaccactgcataactggatccaggaaaatggtggctgggacgc
gtttgtggagatttacgggcaacagcggggttcggtgatggcctgcttctggccgtacctgaagacagtgtttggcctgg
ctgctctgggggccgtcggggtcacaatcagcgcctatttcaccaagaagtga
>gnl|bcl2dbcds|A0A8C9L7I6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pavo cristatus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgattgggccgccggcgaggacaggccgcccgtgcccccggccctggctcccgctgctgctcccgccgcggtggctg
ctgctggagcctcctcccatcaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcgcctcccggcgtccacctcgccctgcgccaggccggggacgagttctcgcgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagctcttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacgg
aggatgggatgcctttgtggaattgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|K7F5Y3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=699 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggatgcctttgtggaattgtatggcagcaacatgaggcctttgtttgatttctcctggatctctttgaagactatcc
tcagtcttgctctggtgggagcttgcatcacccttggagcttatctgggacataagtga
>gnl|bcl2dbcds|K7F5Y3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=585 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctgggaccccatctgacc
atgctgggctggtgtctttgccgcctgaaccccctggttcggctgctgctagtaatgtgccccttggtgatgggctgcgc
tcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattttcccgccgctatcacagagattttgccca
gatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctattccgagatg
ggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgtgtgtggagagtgtcaaccgggagatgtcg
cctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacacttgcacaactggatccaggacaatggagg
ttgggctggtgcagtgagcgttctc
>gnl|bcl2dbcds|K7F5Y3_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL-2 (length=513 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgttgaagtacatccattacaaactgtcacagagggg
gtatgattgggctgccaatgaaaacagaggaccagtttcttcaagtctctctcctcctgctgctggttcggctgctgcta
gtaatgtgccccttggtgatgggctgcgctcagcaccacaggctgttcacttgactctgtgccaagccggagatgaattt
tcccgccgctatcacagagattttgcccagatgtctgggcagctgcacttgaccccattcacggccagggggcgctttgt
ggcggtggtggaggagctattccgagatgggattaactggggaaggatcgtggccttctttgaatttggtggcgtgatgt
gtgtggagagtgtcaaccgggagatgtcgcctcttgtggacagtattgctgtgtggatgactgagtacctgaacagacac
ttgcacaactggatccaggacaatggaggttgg
>gnl|bcl2dbcds|A0A8C8SWU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pelusios castaneus GN=BCL-2 (length=711 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgcagaaatacatccattacaaactgtcacagagagg
atatgattgggctgccagtgaaaacatagcaccagtttctccaactctttctcctcctcttcctgctgctgctgctggaa
cctcatctgaccctgctgggctggggtctttgcctgctgaaccccctggctcagctgctgctagtaatgttcctcctggt
gagggactgagcccggtaccgcaggctgttcacttgaccctgtgccaagctggagatgaattttcccgccgctaccatag
agattttgcccagatgtctggccagctgcacttgaccccattcacagccaggggacgctttgtggcggtggtggaggagc
tgttccgtgatggggttaactggggcaggatcgtggccttcttcgaatttggtggtgtgatgtgtgtggagagcgtcaac
cgggagatgtcacctcttgtggatagcattgcggtgtggatgaccgagtacctgaacagacacctgcacaactggatcca
ggacaatggaggctgggatgcctttgtggaattgtatggcagcaacatgagacctgtgtttgatttctcctggatctctt
tgaagactatcctaagtttggctctggtgggagcctgcatcactcttggcgcttacctgggacataagtga
>gnl|bcl2dbcds|A0A3B4A3G8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL-2 (length=660 residues).
atggcgaacgactgcaatcgcaatattgtggaaaagtacatttgccataaactctccaaacgtggcttcgcgtggggttt
tcacgaggacgcagaggatgaaggagacgtggccaataacggttcgatagttgcatcttctccggttctggtgaaccgtc
ggtgccgcgcagagcggctctgttccgctccgtccgacccacacgcggccatccacagagtcctgcgcgaggctggagat
gaacttgagcggctgtaccagcccgacttcaccgagatgtccagacagctgtatctgacatcctcaacggcgcagaggag
gttcgcggaggttatagacgaactgttccgcgatggagtgaactggggcaggattattgcgtttttcgagtttggtggaa
ccgtgtgcgtggagtgcgcgtccaaagaggacatgtcatcccaagtggacaacatcgcagactggatgacggagtatttg
aatggaactctcagcagctggatccaagacaacgggggatgggaagcctttgtggagctgtacgatcgccagagggactc
ggtcttctcctgctcttggccgtccatcaaaaccgtgttcggattagctgctatcggagcggcgagcctgaccatcggcg
cgtacctgtcgcagaagtga
>gnl|bcl2dbcds|A0A8C8U7I9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtcatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatgcgggagatgccgacgccgcgcccctgggggccgcccccacccctggcatcttctccttccagcccc
agagcaacccaacgcccgctgtgcaccgggacacggctgccaggacgtcaccaccacggcccatagtcgccaccgctgga
cctgcgctcagcccggtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaagaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggacgcctttgtggaactgtatggccccagcgtgcggcctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctagccctggtgggggcctgcatcactctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A669PDH6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Phasianus colchicus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtacccccggccctggctcccactgctgctcccactgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccggctgaggggctg
cgccccgcacctcccggcgtccacctcgccctgcgccaggccggggacgagttctcacgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagcttttccgtg
atggggtcaactggggccggatcgtcgccttcttcgagttcggcggtgtgatgtgcgtcgagagcgtcaaccgggagatg
tcaccgctggtggacaacattgccacctggatgaccgagtacctgaacaggcacctgcataactggatccaggacaacgg
aggatgggatgcctttgtggaattgtacggcaacagtatgaggcctttgtttgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A8C9CJ69_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Phocoena sinus GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccacgtccccgggggccgcccccgcgccgggcatcttctcctcccagcctg
ggagcaccccagcgccatccaggacctccccgccgccgccccagaccgctcccgccgcccccgccagggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggagtaaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtacggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8C9HUK6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcgggggcgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C9HUK6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggggatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcgggggcgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggcagcaggccagaggccacggaaattcgttgccacttcacagtatctcattgcat
cattgagaggtttactcctgatcagcaccgaaagaccatttttggcctttaaaaataaagatgaaagtccaagagcc
>gnl|bcl2dbcds|A0A670IB81_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Podarcis muralis GN=BCL-2 (length=699 residues).
atgatggctcagactgggataagaggttacgacacaagagagatagtgcagacgtacatccattacaagctgtcgcagaa
gggatatgactgggttgccagtgaagacagagaagaccttccttctcctcctcttcctccagatcctcctgctgcagaga
ccttccctaaccttgctaggctggcatctcatccttccgagctgcctgtaagtaacgtcgccccggctggcggaccgcac
cctgtgccacaggttgtccacgcgactttacgtcaagccggggatgagttttcgcggcgttacaggagggactttgctca
gatgtctggacagctgcacttgaccccggtcactgccagagctcgctttgcggcagttgtcgaagagctcttccgagacg
gggtgaactgggggaggattgtggcgttctttgagttcggtggcatgatgtgcgtggagagcgtcagccgggagatgtcg
ccccttgtggacaatatcacagtgtggatgactgactacctgaacgggcacctggacaactggatccaagacaatggagg
ctgggatgcttttgtggagctctacagcaacaacatgaggcctttgttcgatttctcgtggctgcctctgaagacaattc
tgagtctggctgttgtgggtgcctgcatcacccttggagcttatctggggcataagtga
>gnl|bcl2dbcds|A0A2J8W3J1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pongo abelii GN=BCL-2 (length=720 residues).
atggcgcacgctgggacaacagggtacgataaccgggagatagtgatgaagtacatccattataagttgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgccaccgcacccggcatcttctcctcccagcccg
ggcacacgcctcatccagccgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccctggcgcc
gccgtggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C9AC52_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Prolemur simus GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctatgagtgggatgccggagacgcaggcgctgcgcccccgggggccgcccccgcgccgggtatcttctcttcccagcccg
ggcgcacccccgctcccgctgcgcctcgggacccggccgccaggacctcgcccccggccgcccccgctgccgccgcgggg
cctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctatttgatttctcctggctgtctc
tgaagactctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6G3I7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL-2 (length=705 residues).
atggcgcacgccgggagaacagggtatgataaccgggagatagtgatgaagtacatccattataagctggcgcagagggg
ctacgagtgggatgccggagacgcgggcgctgcgcccccgggggccgcccccacgccgggcatcttctcctcccagcccg
ggcgcaacccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccgcccgccgccgccgcggggcctgcg
cccagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgcgactt
cgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataa
cggaggctgggacgcctttgtggaattgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaga
ctctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A670ZV01_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pseudonaja textilis GN=BCL-2 (length=669 residues).
atgatggctcatcctgggataagagattacagtaaccgggagatagtgctgaggtacatccattacaagctgtcacagaa
aggatatgactgggttgccagtggagacagagaaaacgtttctcctgctgttgggacctttcctgcccttggaggactgg
tgcctctgccttctgctgctgttagtaacttggctgccactgaagaacatcctgtaccccaagttgtttattccacacta
tgccaagctggtgatgagttttcccggaggtatcaaagggactttacccagatgtctggacaactgcacttgactccagt
gactgccagaagtcatttcatggctgttgtggaagagctgttccgagatggagtaaattggggaaggattgtggcattct
ttgaatttggtggcatgctgtgtgtggaaagtgtcagtcgggagatgtcacctctggtggacagtattgctgaatggatg
actgaatacatgaacaggcacctgcataattggatccaggacaatggaggctgggatgcctttgtggagctgtacagcaa
caacattaggcctttgtttgatttgtcatggctgcctctgaagacgatccttagtctggcagtggtgggcgcctgcatca
cgctgggggcttacctgggacataagtga
>gnl|bcl2dbcds|A0A3B4G3K4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pundamilia nyererei GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
>gnl|bcl2dbcds|A0A8I6AJ02_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccggacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|P49950_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatccattataagctgtcacagagggg
ctacgagtgggatactggagatgaagactccgcgcccctgagggctgcccccacccctggcatcttctccttccagcctg
agagcaaccgaacgcccgctgtgcaccgagacacggctgccaggacgtcgcctctacggccccttgtcgccaacgctggg
cctgcgctcagccctgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
cgactttgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggggagcgtcaac
agggagatgtcacccctggtggacaacatcgctctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagacgctgctcagcctggccctggtgggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|Q7TSN8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rattus norvegicus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6KHG1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6R2I5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2K6R2I5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL-2 (length=627 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ttggatccaggataacggaggctggcgtacaatgtgcacgtggtgccgcttcaggggatgtgattga
>gnl|bcl2dbcds|A0A2K6UEL3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggcgccgcccccgcgccgggcatcttctcctcccagcccg
ggcacacgcccggtcccgctgcgccccgggaccctgtcgccaggaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnncagcccagtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccgccg
ctatcgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A672HHE5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salarias fasciatus GN=BCL-2 (length=693 residues).
atggaaaacgagcgcaatcgcaatatcgtagtgaagtatatctgccataaactctccaaacgcggatacgcgtggagctt
ggacgctgcgcgggatgaggacgcggataataacgggtccctagttgaccccgagccgactctggtccgccggtgccggg
aggcggccggagccgggcccgacagcgaggacgacagcccccgcctgtgcaggcggccgcagcagtccgacccgcacgcc
gccatccaccgggtcctgcgggaggctggggacgaacttgagagactctaccagccggacttcacggagatgtcgcggca
gctgtacctcacctcctccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggg
gccggattatcgccttcttcgagttcggtggcacggtgtgcgtggagtgcgtgtccaaggaggacatgacggcgcaggtg
gacaacatcgcggactggatgacggagtatttaaatggacctcttgacagctggatacgggataacgggggatgggatgc
gtttgtggatctgtacgaccggcagagggagtccgtcttcagctgctcgtggccgtccataaagacggtgttcggcctgg
ccgcgctcggcgccgccagcctcaccatcggagcgtacctcacccagaagtga
>gnl|bcl2dbcds|A0A673Z0A3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=693 residues).
atgatggcgaacgataatccttataacagtcgctttattgttgaaaaatacatccatcacaaactgttgaagaagggatt
tgtatgggaatttaatccagaaaacgattccccaaataatggctttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccagccctccgctgaaggtgtggacactgaatctcagctcccaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacagcacagagaaggtttactgctgtaatagaggagctcttccgcgacggtgtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgacccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgtcttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagcgttgttcatccagaagtga
>gnl|bcl2dbcds|A0A674B0E5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgccgctaataatgggtcgatgatttctcctcggctgggtttggcacggcggtgcc
acggggccaataacgccggcccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcagctggattcaggagaacgggggatgggaggcctttgttga
gctctatgacagacagagggactctgtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A674B8T7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttacaacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaacatgggatt
tgtatggaaatttcaagcagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgaccctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgctcgttggatgatggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgctggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8D0BPX3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salvator merianae GN=BCL-2 (length=690 residues).
atggctcatcccgggataagaggttacgataacagggagatagtgctaaggtacatccattacaagctgtcacaaaaagg
atatgattgggttgccagcggagatggagaaaacgtttctgatactgctgctgctgcttctgctgctactgagaccttcc
atacccttactggtctggtgtctctgccttctgagctgcctggctctgtcgctccagtcgacgagtggcgccctgtgcca
cangtggtccactcaactttacgtcaagctggtgatgagttttctcgacgttaccggagagactttgctcagatgtctgg
gcagctgcacttgaccccacgcactgccagagctcgttttacggcagttgtggaagagctgttccgagatgggataaact
ggggcaggattgtggcattctttgaatttggtggcatgatgtgtgtggagagcgtcagtcgggagatgacgccccttgtg
gacagtgttactatgtggatgactgagtacctgaataggcatctgcacaactggatccaggacaatggaggctgggatgc
ttttgtggagctttacagcaacaacatgaggcctttgtttgatttctcatggctgccgctgaagacaatcctgagtctgg
ctttggtgggcgcgtgcatcacccttggtgcttaccttgggcataagtga
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1017 residues).
atgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctaca
agcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaaca
ggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtgg
aagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactc
cccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtgg
cctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaa
acttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctgt
gggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcagg
ctgcctttgtggagctgtatgacagacagagggactccctcttcagctgctcctggccctccattaagacggtctttggc
ctagctgcactcggggcagctagcctcaccttcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1104 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaac
aggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtg
gaagtggaccgttttaagtcagaaaggaggttaaattcccagaaactgatggaagtaaactacctgggcagcgtttaccc
gacacgggccgtcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcg
gcctgtttggatacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaag
ccatacaatatctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcc
tctagagactaaattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcag
tgcaggggaactttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacg
tccatcacagaaggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttga
cagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1080 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaac
aggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtg
gaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccat
gaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctact
ccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtg
gcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctga
aacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctg
tgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcag
attgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgat
tcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=1014 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgc
catcaatgacaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaa
agtttgaggacgtggaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggcc
gtcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttgg
atacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaata
tctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagact
aaattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaa
ctttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacag
aaggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtg
cgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=894 residues).
atgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctaca
agcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaaca
ggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtgg
aagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatg
aaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactc
cccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtgg
cctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaa
acttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcaattgttaccatgggattatttcggac
catcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctg
acaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=561 residues).
atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcatcaattcctggtggcttcttctgccattcat
catgcttcttgtagttgctgccttcatcgttgcctttgtgttgctgttatacatgatatcgcctctcattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctac
aagcaaggagcattcatcactttggtggcacgggatgaggtggtgctctgcatatcagtggatgtttccagtgattatag
ccaggtggaaagtgtgataaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagcca
tttctggaaagtttgaggacgtggaagtggaccgttttaagattgttaccatgggattatttcggaccatcgccctcttc
tacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagta
a
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=933 residues).
gtaacggtagctaacgtccagtcattatactgtagcttcatagtgacaggaggctcaagtgggattgggaaatccattgc
agttgagtgctacaagcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagagg
tggagaaatttgccatcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaa
agtgtgataaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaa
gtttgaggacgtggaagtggaccgttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccg
tcataaccaccatgaaggagcgaagaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttgga
tacaccgcctactccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatat
ctatgtgactgtggcctacccccctgacactgagactccaggattagctgaggaaaataagacaaagcctctagagacta
aattaatctctgaaacttctggagtttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaac
tttaacagctctgtgggacccgatggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacaga
aggcctccagcagattgttaccatgggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgc
gccgctgcatgattcagagggagcagtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-08 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=909 residues).
tacatttccagtttacctgtgacaggaggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaaggagc
attcatcactttggtggcacgggatgaggctaaattgcttcaagcaaagaaagaggtggagaaatttgccatcaatgaca
aacaggtggtgctctgcatatcagtggatgtttccagtgattatagccaggtggaaagtgtgataaaacaggctcaagag
aagctgggtccggttgatatgttagtgaactgtgctggattagccatttctggaaagtttgaggacgtggaagtggaccg
ttttaagaaactgatggaagtaaactacctgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcgaa
gaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcctgtttggatacaccgcctactccccatccaag
tttgctctgcgtggcttagcagagtcgctgcagatggagataaagccatacaatatctatgtgactgtggcctacccccc
tgacactgagactccaggattagctgaggaaaataagacaaagcctctagagactaaattaatctctgaaacttctggag
tttgtcaaccagaccaagtagccaaaatcattgttcgagatgcagtgcaggggaactttaacagctctgtgggacccgat
ggttacatgctatcagccctcacctgtggaatgtcacctgttacgtccatcacagaaggcctccagcagattgttaccat
gggattatttcggaccatcgccctcttctacctggggagttttgacagcattgtgcgccgctgcatgattcagagggagc
agtcaaaagccgctgacaagagggagtaa
>gnl|bcl2dbcds|A0A8C9ZFJ5_BCL2-09 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sander lucioperca GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtacatctgccataaactctccaaacggggctacgtgtttggatt
tgatgatgtccgggatgaagatgctgctaataatgggtcaatagttgtccctccaccgagtttggttcgccggtgccgtg
aaggcagcactgggcctgacagcgagagcatccctcacctctgcaaacggctcccccagtccgacccgaccgccgccatc
cacagagttctccgcgaggctggagacgaacttgagagactataccagccggacttcacggagatgtcgcggcaactgta
tctcacctccaccacggcgcaaaggagattcgccgaggtgatcgacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgccgccaaagaggagatgacatcacaggtggacaac
atcgccgagtggatgactgagtatctaaatggacctctaaacagctggatacaagataacggaggatgggctgcctttgt
ggagctgtatgacagacagagggactccctcttcagctgctcctggccctccattaagacggtctttggcctagctgcac
tcggggcagctagcctcaccttcggagcatacctgacacagaagtga
>gnl|bcl2dbcds|A0A7N4PQN7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL-2 (length=768 residues).
atggctcaccctggaagaagaggatatgataaccgggaaatagtgatgaaatacattcattataagctatcacagagagg
gtacgagtgggatgctggaaatctgaggacaccagcctctccaagtcttcctcctgttgttgcttctgcccctgctgttg
gaatcttctctaaccagccaagacatacacctctgcctgctgcaccccaggacttggccacttctactactgctgctgct
agaaactcacctttgcctcctcctcctgctgttgctgctgctactgttgctgctggaccagctgtcagtccagtgccacc
tgtggtccacctgactcttcgtcaagctggagatgatttctctcgaagatatcgaagagatttcgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtagtggaagagctgttcagggatggggtgaactgg
gggcggattgtggccttctttgaatttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtcgcctctggtgga
cagcatagccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataacggaggatgggatgcct
ttgtggaattatatggcaacagcatgagacctttgttcgatttctcctggctgtctctgaagactctcctcagcctggct
ctggtgggagcttgcatcactcttggtgcctacctaggacacaagtga
>gnl|bcl2dbcds|A0A8D2AUF5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sciurus vulgaris GN=BCL-2 (length=720 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgcgggcgctgcgcccccaggggccgcccccgtgccgggcatcttctcttcccagcccg
gccgcaaccccccgcccgctgcgccccaggacccagcagccaggacctcaccaccgccacccccggatgcccccgctgcc
gccgcggggcctgtgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcg
ctatcgccgggacttcgccgagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcgttcgtggaactatacggccccagcgtgcggcccctctttgacttctcct
ggctgtctctgaagactctgctcagcctggccctggtgggagcctgcatcaccctgggggcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C9T5U7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scleropages formosus GN=BCL-2 (length=735 residues).
atggcaaacgagggcgcgtacgacagccgggacatcgtggaagtgtacctgtaccacaagctgctcaagacgggctatgt
gtgggaattccgcgccgccgccgccgccgacgccgatccctccaataacggattaacggactccggctcgcccggcttgc
ccgggtcgcccggctcccaggtggtggcacggaggtcgcaggctgccggggccgcggacgcagaggacgcgcccctctcc
cgcagccgcgcgccccactgcgacccccgctgcgaccaccacgccgcactgcaccgggtcctgcgcgaggcgggcgacga
gatcgagcggatgtaccagcgggacttcgcgcagatgcccgagcggctgcacttcacgcccagcacggcgcagcgcaagt
tcacggccgtcatcgaggagctcttcagcgacggcgtgaactgggggcgcatcgtggcctttttcgagttcgggggcacc
atgtgcgtggagagcgtgaaccgggagatgacgtcccaggtggataacattgcgcgctggatgacggagtatctaaacgg
acccctccgtaactggatccaggaaaatggaggatgggatgccttcgtggagctctacgggcagcagaggggctccgtgt
tccgctgttcctggccgtacataaagaccgttttcggtctggccgctttgggagcggccggcgtcaccatcggggcgtac
ctcacccacaagtga
>gnl|bcl2dbcds|A0A2U9BJ09_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL-2 (length=687 residues).
atggcgagcgagtgtaatcgcaatattgtggaaaagtacatctgccataaactctccaagcggggctacgtgtgggggtt
tgatgatgtccgagatgaagatgccgctgataacgggtcgatagttgcccctccaccgactctggtgcgccggtgccatg
gagccagcaccgggcccgacgacgagagccaccccgacctctgtaggcggccgcctcagtccgagccgcgcgccgccgtc
caccgggtcctgcgcgaggcgggcgacgaacttgagagactgtaccagccggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgcagaggcgcttcgccgaggtgatcgacgaactgttccgggacggggtgaactggggccgga
ttatcgcgttcttcgagttcgggggcaccgtgtgcgtggagtgcgccgacaccgaggagatgacatcgcaggtggacaac
atcgcggagtggatgacagagtatttaaatggaccgcttaacagctggattatggacaacgggggatgggacgccttcgt
ggagctgtacgacagacacggggagtccgtcttcagctgctcctggccctccatcaagaccgtcttcggcctggctgcac
tcggggcggcgagcctcaccatcggagcgtacctcacgcagaagtga
>gnl|bcl2dbcds|A0A8C9MG30_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Serinus canaria GN=BCL-2 (length=891 residues).
atgaagtgtgatggtctttatttcaaagcatttactcaaaaaagtgttttcccccctttttactttaagaaattttacag
gtgtaataaaagtttaagaatcagagatggatgttcctgtttgtctagaagactgtttggatcacctattccttcgtgca
gaacctgcctgctttgctcctctgcagtttcatctgagaagttgctgtccaatcctttttcacagagcagaaagacaggg
catgggcggcactgcctcagtcacaagcacagaggctacgataaccgggagatagtgctgaagtacatccactataaact
ctctcagaggggatacgactggcctgccagcgaggacagggcatccctgcctccaggtctctctgctcctgctgctgctg
cggttgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccctggctcggccgct
gctagccacgcgcccccagcagaggggctgcgccccgcaccccaggtcgtccaccttgtcctgcgccaggcgggggacga
gttctcccgacgctaccagagggacttcgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgct
tcgtggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtg
atgtgcgtggagagcgtcaaccgggagatgtctcaccttgtggacagcattgccacctggatgactgagtacctgaaccg
gcagctgcacaactggatccaggacaacggaggctgggtaagtcccccgactgctcggttcctctgccggctccggcccc
tggctggtggg
>gnl|bcl2dbcds|A0A3B4TX71_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola dumerili GN=BCL-2 (length=687 residues).
atggcgagcgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaaacaaggatacgtgtggggatt
tgatgatgtccgagatgaagatgctgctaataatggctcaatagttgcccctccaccgactttggtccgccggtgccgtg
aagccaacaccgggcctgacaacgacagctcacctaacctctgcagacggctctctcagtccgacccgcacgccgagatc
cacagagtcctgcgcgaggctggagacgaacttgagagattataccagccggacttcacggagatgtcgcggcagctcta
tctcacctccaccacggcgcagagaagattcgccgaggtgatagacgaactgttccgggacggggtgaattggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgttgagtgcgcggccaaggaggagatgacatcgcaggtggacaac
atcgtggagtggatgacggagtatttaaatggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacagtcttcggcctggctgcac
tcggggcagcgagcctcaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A3B4YAG2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL-2 (length=687 residues).
atggcgagcgagtataatcgcaatattgtggaaaagtacatctgccataaactctccaaacggggatacgtgtggggatt
tgatgatgtccgagatgaagatgctgctaataatggctcaatagttgcccctccaccgactttggtccgccggtgccgtg
aagccaacaccgggcctgacaacgacagctcacctaacctctgcagacggctctctcagtccgacccgcacgccgagatc
cacagagtcctgcgcgaggctggagacgaacttgagagattataccagccggacttcacggagatgtcgcggcagctcta
tctcacctccaccacggcgcagagaagattcgccgaggttatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgttgagtgcgcggccaaggaggagatgacatcgcaggtggacaac
atcgtggagtggatgacggagtatttaaatggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggagtccgtcttcagttgctcctggccctccatcaagacagtcttcggcctggctgcac
tcggggcagcgagcctcaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A672T179_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL-2 (length=624 residues).
atggcacaggagaatgtgtatgataaccgcagtctagtggtgaagtacatccaccataagctctggaagaagggatacgt
gtgggaagtgaacggacacgatgacagtgtctcgaatggactgatgatggggaggcaggaggaccgcggcggctcccgtc
acgacccgtgcagcgctcttcacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggactttgcg
gagatgtccaaacagctgcatctcacgtccatcacggcgcaccagcgcttcaccgcggtcatagacgagctgttcaggga
cggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgcgtcgaatgcgtgaataaggagatga
cggtgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacggctggatccaggagaacggc
ggctgggaggcgtttgtggagctctacggcaggcagagggactctgtgtttcgcagctcgtggtcatcgatagtaacggt
cttcggtctagctgcgcttggggccgttggcttgaccataggagcctaccttgctcagaaatga
>gnl|bcl2dbcds|A0A673HVU7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL-2 (length=690 residues).
atggccaccgaaattcgctttgacaatcggaatattgtggagaaatacatcaatcacaaactttcaaagaagggatatgt
gtggaaatctcaatcttctggggaggatgatgacaccgccaataaaggaatcgagggttcctctctaaactctggcagga
ggcttcaggctccctcagccggaggggggaacaactctgaatgcctgatagctcaccgggtcactcgttcagacccttat
tcaaggatctaccgggcgctacgcgaggctggagacgagatagaaaggctataccagcgtgaatttgaggagatgtccca
ccgcatgatattcagtcccaatacaacgcaacgcagcttcttagccgtggcagaagagctctttaaagacggagtgaact
gggggcggatcatcgctttctttgagtttggtgggaccatgtgtgtggagagcgtcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggcctctggaaaactggatcgaggaaaatggaggctgggatgc
cttcgtggagttgtacagtcagcagagagactcagtgttccacccattttcgtacctaactaaagtacttggattggcag
tgctcggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A673LV42_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL-2 (length=672 residues).
atggcacaggagaatgtgtatgataaccggagcatagtggtgaagtacatccaccataagctctggaagaagggatacgt
gtgggaagtgaacggacacgatgacagcgtctcgaatggactgatgatggagaggcgggaggacggcggcatctctccca
gctcccgtcacgacccgtgcagggctcttcataaggtgctctcccgtcacgacccgtgcagggctcttcataaggtgctg
cgggaggccggggatgaactggagcggctttatcagtcggactttgcggagatgtccaaacggctgcacctcacgtccat
cacggcgcatcagcgcttcaccgcggtcatagacgagctgttcggggacggcgtgaactggggcagaatcatcgcttttt
tcgagtttggagggactgtttgtgtcgaatgcgtgaataaggagatgatggcgcatgtggataacattgcgggctggatg
accgagtatctgaacgggccgctgcacggctggatccaggagaacggcggatgggaggcgtttgtggagctctacggcag
gcagagggactctgtgtttcgcagctcgtggtcatcgatagtaacggtcttcggtctagcggctctcggggccgttggct
tgaccataggagcctaccttgctcagaaatga
>gnl|bcl2dbcds|A0A8D0L5Z6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL-2 (length=654 residues).
atggctcatcctgggagaagaagctatgataacagggagatagtgctgaggtacatccattacaaactgtcacagagagg
atatgactgggcttccagcagagatggagcaagtgtcccttctgctgctacgggcacttcctctgaccatggtgggctgg
tgtctttgccccctgagcctcctggctcagctgctgctaataatgtgccctctgatgatgcactaaacccagtactacag
gctgttcacctgactctctgccatgctggtgacgaagtttcccgccgataccagagggatttttcccagatggctggccg
gttgcttttgatcccttttgctgccagggagagctttatggaagtggcagaagagctgttccgagatggggttaactggg
ggaggatcgtggccttccttgaatttggtggcatgatgtgtgtggagagtgttaaccgggagatgtcaccccttgtggac
agcattgctgtatggatgaccgagtacctgaacagacacctgcacaactggatcgaggacaatggaggctgggtatgtgg
ctatatgcatatgcagcctattgtatgcatttggtttatgcaagttaaaatattacagtacttagtttttattatcacat
catcatgtagttag
>gnl|bcl2dbcds|A0A3B5BBQ0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Stegastes partitus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtggaaaagtatatctgccataaactctccaaacggggctacgcgtggggctt
tgatgatgtccgggatgaagatgctgctaataacgggtcagtagttgaccctccgccgactttggtgcgccggtgccatg
aagccagcaccgggcccgacaacgagagcgacccccacctctgcagacggctcccccagtccgacccgcacgctgccatc
cacagagtcctgcgggaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtccaggcagctgta
tctcacctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggaaccgtgtgcgtcgagtgcgcggccaaagaggagatgacgtcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctcttaacagctggatacaggataacgggggatgggacgcctttgt
ggagctgtatgacagacagagggactcagtcttcagttgctcttggccctccatcaagacggtcttcggtctggcagcac
tcggggcagcgagcctcaccatcggagcgtaccttacacaaaagtga
>gnl|bcl2dbcds|A0A672TR23_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Strigops habroptila GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcacagagggg
atacgactgggctgccggggaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgctgctgcgg
ttgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgct
agccatgcgcccctggccgaggggctgcgccctgcgccccaggtcgtccacctcaccctgcgccaggcaggggacgagtt
ctcccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcg
tggcggtggtggaggagctcttccgagacggggttaactggggcaggatcgtggccttcttcgagttcggcggcgtcatg
tgcgtggagagcgtcaaccgagagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggcctttgttcg
atttctcctggatctcgctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A8D0G0L7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Strix occidentalis caurina GN=BCL-2 (length=726 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagc
cacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtccacctcgccctgcgccaggcgggcgatgagttctc
ccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtgg
cagtggtggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgc
gtggagagcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacct
gcacaactggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtatgaggcctttgtttgatt
tctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacat
aagtag
>gnl|bcl2dbcds|A0A673VDM8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Suricata suricatta GN=BCL-2 (length=720 residues).
atggcgcacgccgggagaacagggtacgataaccgggagatcgtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggacgccggagacgcgggcgccgcgcccccgggggtcgcccccgcgccgggcatctcctcctcccagcccg
ggcgcacccccctccccgccgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgcccccgccgcc
gccgcgggccccgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcg
ctaccgccgcgacttcgcggagatgtccagccagctgcacctgaccccgttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtttggtggggtcatgtgtgtggag
agcgtcaaccgagagatgtcgcccctggtggacaacatcgccctatggatgactgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggagctgtacggccctagcatgcagcctctgtttgatttctcct
ggctgtctctgaaggccctgctcagcctggccctggtgggggcgtgcgtcaccttgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgtttggcttcacagcctactc
ttcctcgaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=591 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctggattacttga
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=999 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgtttggcttcacagcctactc
ttcctcgaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
tggtcaccatgggccttttccgcactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatg
cagagagctagatcggaaattgcagacaaaactgcctaa
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=915 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgtttggcttcacagcctactc
ttcctcgaagtttgccatcaggggattggcagaagctctgcagatggagcctttggagactcgtcttatttcagagacca
catctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccatcggc
tcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcaggtggt
caccatgggccttttccgcactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcaga
gagctagatcggaaattgcagacaaaactgcctaa
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=897 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgtttggcttcacagcctactc
ttcctcgaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatagtggtcaccatgggccttttccg
cactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattg
cagacaaaactgcctaa
>gnl|bcl2dbcds|A0A4X1TRR9_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=807 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgaggtgaagccatataatgtttatgtcacagtggcctaccctccagacacagacacccctgggttt
gccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagagaccacatctgtttgcaaaccagagcaagtggc
caaacaaattgttaaagatgccatacaaggaaatttcaatagttccatcggctcagatgggtacatgctgtcctccctga
cctgtggaatggctccagtaacttccatcactgaagggctccagcaggtggtcaccatgggccttttccgcactatcgct
ttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattgcagacaaaac
tgcctaa
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggatgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggc
tgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=1014 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
atgcctttgtggagctgtatgggcccagcatgcggcctctatttgatttctcctggctgtctctgaaggcgctgctcagt
ctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=774 residues).
atggcgcacgctgggagaacagggtatgataaccgggaaatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgtccccgggggccgctcccgcaccgggcatcttctcctcccagcccg
ggcgaacccccgctcccgccaggacctcgccgccgccgaccccgaccgcccccgccgccaccgccgccgccgccgccgcc
gcggggcctgtactcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctctcgtcgcta
ccgccgcgactttgccgagatgtccagccagctgcacctgactcccttcaccgcgaggggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggctgactcaagcaaagtggggaaaaaatcgcatctggacaaaggaagcttatctcccc
gaatctcaaaacctatgtcaagagaacctttactgaagagagccatagagttaaacactgtacttaattccaaccaaaaa
ctagataaagggttagaaatcagtgttattagtggcctctccttccttccttaa
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=999 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccat
cggctcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcagg
tggtcaccatgggccttttccgcactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatg
cagagagctagatcggaaattgcagacaaaactgcctaa
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=915 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggagcctttggagactcgtcttatttcagagacca
catctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatacaaggaaatttcaatagttccatcggc
tcagatgggtacatgctgtcctccctgacctgtggaatggctccagtaacttccatcactgaagggctccagcaggtggt
caccatgggccttttccgcactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcaga
gagctagatcggaaattgcagacaaaactgcctaa
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=807 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgaggtgaagccatataatgtttatgtcacagtggcctaccctccagacacagacacccctgggttt
gccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagagaccacatctgtttgcaaaccagagcaagtggc
caaacaaattgttaaagatgccatacaaggaaatttcaatagttccatcggctcagatgggtacatgctgtcctccctga
cctgtggaatggctccagtaacttccatcactgaagggctccagcaggtggtcaccatgggccttttccgcactatcgct
ttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattgcagacaaaac
tgcctaa
>gnl|bcl2dbcds|A0A8D0QLD9_BCL2-07 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sus scrofa GN=BCL-2 (length=897 residues).
atgctgctgctggctgccgccttcctcgtggcgttcgtgctgctgctctacatggtgtctccgctcatcagccccaagcc
cctcgccctgcccggagctcatgtggtggttactggaggctccagcggcatcggaaagtgcattgccattgagtgctata
aacaaggagcgtttataactctggttgcacgaaatgaggacaagctgttgcaggcaaagaaagaaattgaaaaacactct
attaatgataaacaggtggtgctttgtatatcagttgatgtgtctcaagactatagccaagtagagaatgtcataaaaca
agcacaggagaaactgggcccagtggacatgcttgtaaactgtgcaggaatgtcactttcaggaaaatttgaagatcttg
aagttagtacttttgagaggctcatgagtgtcaactacctgggcagcgtgtacccgagccgagcggtgatcaccaccatg
aaggagcgccgcgtgggcaggatcgtcttcgtgtcctctcaggccgggcagctgggcctgttcggcttcacagcctactc
ttcctcaaagtttgccatcaggggattggcagaagctctgcagatggaggtgaagccatataatgtttatgtcacagtgg
cctaccctccagacacagacacccctgggtttgccgaagaaaacaaaaccaagcctttggagactcgtcttatttcagag
accacatctgtttgcaaaccagagcaagtggccaaacaaattgttaaagatgccatagtggtcaccatgggccttttccg
cactatcgctttgttttacctgggaagtttcgacagcatagttcgtcgctgcatgatgcagagagctagatcggaaattg
cagacaaaactgcctaa
>gnl|bcl2dbcds|A0A674GNG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctacgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacaatatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A674GNG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=1014 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
cctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaataagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacgaacaggtggagaatgttctcaaaca
ggctcaggagaagttggggccagttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtcaattacctggggagtgtttacccaagccgagcagtaatcgctaccatg
aaggaacgcagaatgggaaggattgtctttgtatcatcccaggctgggcagttaggcctgtttggatatacagcttattc
tcccacgaaatttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacagtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctaatttctgag
acctcatctgtttgccaagcagaacaagttgccagagttatagtgaaagatgccatacaagggaatttcaacagctctgt
tggatcagatggttacatgctgtcaatattgacaagtggaatgtcaccagtcacttctattactgaaggtcttcagcagg
atgcctttgtggagttgtatggcaacaatatgaggcctttgtttgatttctcctggatctctctgaagactatcctgagt
ctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A674GNG3_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=804 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctacgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctggtcacagagagggcagcgtaaaatagctgcgaggcaattcccgtaca
gtaaaatggaagtctctttggctcttcattcaatacaatgtggctcaagaggatatcctgccaaaccaatgataacgagg
gaaataaagtcacttcctcaccagctgtttgattcaggatgcctttgtggagttgtatggcaacaatatgaggcctttgt
ttga
>gnl|bcl2dbcds|A0A674GNG3_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=999 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
cctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaataagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacgaacaggtggagaatgttctcaaaca
ggctcaggagaagttggggccagttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtcaattacctggggagtgtttacccaagccgagcagtaatcgctaccatg
aaggaacgcagaatgggaaggattgtctttgtatcatcccaggctgggcagttaggcctgtttggatatacagcttattc
tcccacgaaatttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacagtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctaatttctgag
acctcatctgtttgccaagcagaacaagttgccagagttatagtgaaagatgccatacaagggaatttcaacagctctgt
tggatcagatggttacatgctgtcaatattgacaagtggaatgtcaccagtcacttctattactgaaggtcttcagcagg
ttgtttgcatgggcatttttcgcatcattggcctattttacctaggaagttttgacagcatagttcgtcgctgcatgatg
caaagggaaaaatctgaaagtgcagataagaccgagtaa
>gnl|bcl2dbcds|A0A674IMR0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttctccaaatctctctccccctactgttgctgggacctcatctg
accatgctgggctggtgtctctgcctcctgagccccctggctcggctgctgctagtaacgtaccccttggtgatgggctg
cgcccagcaccgcaggctgttctcttgactctgtgccaagctggagatgaattttcccgccgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaattcggtggcgtgatgtgcgtggagagtgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgagtacctgaacagacacctacacaactggatccaagacaacgg
aggctgggatgcctttgtggaattgtacggcagcaacatgaggcctttgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8D2EFR4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Theropithecus gelada GN=BCL-2 (length=720 residues).
atggcgcaagctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8D2IIB8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Urocitellus parryii GN=BCL-2 (length=720 residues).
atggctcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcacagagggg
ctacgagtgggatgctggagacgtgggcgctgcgtccccaggagccgcccccgggccgggcatcttctcttcccaaccgg
ggagccatcccccgcccgctgcgccccgggacccggccgccaggacctcgccaccgccacccccggctgcccccgctgcc
gccgcggggcccgtgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctctcgtcg
ctatcgtcgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcaaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggagctgtatggccccagcgtgcggcccctgtacgacttctcct
ggctgtccctgaagactctgctcagcctggccctggtgggagcctgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A452R110_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=618 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtctctgaaggccctgct
cagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A452R110_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus americanus GN=BCL-2 (length=492 residues).
atgccggagacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcctgggctcaccccc
gcgcccgccaggacctcgccgcttaccgcccccggccgcccccgccgccgccgccgccgccgcgggccctgcgctcagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggag
atgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatgg
ggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgc
ccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggc
tgggcacactaa
>gnl|bcl2dbcds|A0A452T603_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ursus maritimus GN=BCL-2 (length=534 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgaccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgact
tcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttc
agggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccggga
gatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggaca
acggaggctgggtaggtgcacgtccgcttgaatgtgcgtctgggctgcacgtttcaaatctgaggctgagaatccgtggt
tggagtgtgggtgggctcttgggccaagggcaaactgatgagccagggaaataa
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1050 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggatgcctttgtggagctgtacagcaacaacatgaggcctttgttt
gacttttcctggctgcctctgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctggg
ccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=711 residues).
atgatggctcatcctgggataagagcttatgataatagggagattgtgctgaggtacatccgttacaaactctcacagaa
aggatatgactgggtggctggtggagacccagaaaaccttcctgctcctgctcctgctcctgctcctgctgggagcatcc
ctgcccttgctgggctggcatccctgccttctgagctgcctgactctgctgctgtgaggaatgttgcccctgctgacgaa
ctacacccagtgccagcgccacaggttgtccattcaactttacgccaagctggagatgagttttcacggctttaccggag
ggattttgctcagatgtctggccagttgcacttgactccagtcactgccagaagccgtttcgtggctgtggtggaagagc
tgttccgtgatgggatcaattggggcaggattgtagcgttctttgaattcggtggcatgctgagcgtggagagtgtcagt
cgggagatgtcaccccttgtggacaatatcactgtgtggatgactgagtacctgaacaggcacctgcacaactggatcca
ggacaatggaggctgggatgcctttgtggagctgtacagcaacaacatgaggcctttgtttgacttttcctggctgcctc
tgaaaacaatcctgagcctggcggtcgtgggcgcgtgcatcaccctcggtgcttacctgggccacaagtga
>gnl|bcl2dbcds|A0A8D2Q1J0_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Varanus komodoensis GN=BCL-2 (length=1026 residues).
atgctgttcgcagagatgtccggggcgctgctgctggcggcggccgccggggtcgccctcctcgtggccttcctgctgtt
gctgtatctggtgtcgccggtgacaagccccaagccactgtccttgtccggcgcccacgtcgtggtaactggtggctcca
gtggcattgggaaaagcattgctatcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatgagaaccgt
ctgatggaaacaaaaaaagaaattgagaaattctctgttaatgataagcaggttgtacagtccatttctgtggatgtttc
caaggatggtacaaatgtggcaagggttctaaaacaggctcaagagaagttgggtccagttgacatgctcataaattgtg
ctggaacatcagttaatgcaaaatttgaagatcttgacatcagtaagtttgagcaactgatggctatcaactacttgggg
agcatttacccaactcgtgcagtagttaccaccatgaaggaacgaagaatgggaaggatcgtatttgtgtcatcccaggc
tgggcaggttggagtatttggctacacagcttattctgcaacaaagtttgcacttcgaggactagctgaagctttgcaga
tggaggtaaagccctacaatatctacataacagttgcgtatcctccagatacagacacccctggctatgcagaagaaaat
aagcataaggttttagagaccaagcttatttcagaagcatcatcaatctgccaacctgattatgttgctagaatcattgt
aaaagatgcaattcaaggaaaattcagcagttctattggtacggatggtcacatgttgacagtattgaccagtgggatgt
caccagtttcttctattgctgaagtcctagaggcggttatttgcatgggtatttttcgtttcgttagtctttattttata
gcaggttttgacagcatagttcgtcgttgcatggtacaaagagaaaagtctgaaaagactgactga
>gnl|bcl2dbcds|A0A4X2L5Q0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Vombatus ursinus GN=BCL-2 (length=771 residues).
atggctcaccctggaagaagagggtacgataatcgggagatagtgatgaagtacattcattataagttgtcacagagagg
gtacgagtgggatgctggaaatctgagggcaccagcctctccaagccttccttctgttgttgcttctgcccctgctgttg
gggtcttctctacccagccaagacatacacctctgcctgctgaaccccaggacttggccacttctacgactgctgctgct
agaaactcacctttgcctcctcctcctgccgttgctgctgctactgctgccgctggacctgctgtcagtccagtgccacc
tgtggtccacctgacccttcgtcaagctggagatgatttctctcgaaggtaccggagagactttgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtggtggaggagttgttcagggatggggtgaactgg
gggcggatcgtggccttctttgaatttggtggtgtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtgga
cagcattgccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataatggaggatgggtagcaa
aggttttctctatgttttcctttacttttctttcccccttccctttcacaccccactggacgacccctttccatcaacgt
ggtttcaaagtattgttgcaagtgaagcatttactaacttgtgccttctga
>gnl|bcl2dbcds|B9ZYL7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Xenopus laevis GN=BCL-2 (length=885 residues).
atggctcatcctagaagaggaggctatgatcaccgggacatagtggtaaaatatatccattataaactatctcagaaggg
gtatgcatgggaagagggaaggcagcaggtctctgctgagcaccctcaagcttctgctgctattagtaattattctgatg
atggagaaatgcctgctgcttccgcagattcacgtggaccacctcagtcttcactcgcatctgctgcttcctcagatgag
gaaaccccaagtaatactccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgcatctgctgtttcacc
cttagctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgccagtcgtgctgcagatggtgataataatg
atgctgatggtggtgatgaagctgttatgcagccagtcccttcggcagtgctacagaccttgagtcgagctggagatgag
ttctctcgcctatatcagcaagatttcagacagatctcagggctcctccatttaaccccatccacagttagggtgcgctt
tgcaacagtggtggaggagctctttcatgatggggtaaactggggaaggattgttgcttttttcgagtttggtggggtca
tgtgcgtggagattgttaaccgcgaaatgtctcctctggtggactccattgtgggttggatgacagagtacctaaaccgt
cacttacaaaattggatccaggaacaggatgcatttgtggagctgtacaacagcaatatccagccaccgtttgaccagag
ctggttatccatcaagacaatattaagccttgctgtggttggagcctgcatcacaatagggggcatatccttggccacca
aataa
>gnl|bcl2dbcds|A0A8D2N8C6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Zonotrichia albicollis GN=BCL-2 (length=675 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggactntcttttccttatggacgaagcggggtcccggggctgccggggccgagcccggggcgagcggcggccgc
tgggtggcaacagcgggggacgagttctcccgacgctaccagagggacttcgcccagatgtccggccagctgcacctgac
gcccctcacggccaggagccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtgg
ccttcttcgagtttggcggtgtgatgtgcgtggagagcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcc
tggatgaccgagtacctgaaccggcagctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgta
tggcaatggtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagctt
gcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8D2P664_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Zosterops lateralis melanops GN=BCL-2 (length=714 residues).
atggctcacccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccagntctctctgttcctgctgctgctgggacttcctctg
atcacactgggccggtgtctccgcaccccgagccccccggctcggctgctgctagccaggtgccnccggccgaggggctg
cgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggagacgagttctcccgacgctaccagagggacnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnngggttaactggggcagaattgtggccttcttcgagtttggcggtgtcatgtgtgtggagagcgtc
aaccgggagatgtcncccctcgtggacagcatcgctgcctggatgactgagtacctgaaccggcacctgcacaactggat
ccaggacaacggaggctgggatgcctttgtggagttgtatggcaacagcatgaggcctttgttcgatttctcctggatct
ctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
© 1998-2023Legal notice