Dataset for CDS BCL-2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

268 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      atgcagactgctttgtcacggggagaaagggttcaacacggtactttaat
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ccgactgttgcacatctttgactctctgccaaaccagcgaacaactcctc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      ctccgacgtccgtgtttcgccaccccctttcagggccatcgccagcctcg
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      tatctcggttatcgaacccctgaagctggcctgctagttagcagacgagc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      ----------------------atgtcctctgaagaagggttcagctcag
A0A668TEB6_BCL2-02      ----------------------atgtcctctgaagaagggttcagctcag
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      ----------------------atgtcctctgaagaaagcttgagctcca
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      ----------------------atgtcctctgaagaaagcttgagctcca
A0A3Q3MEY1_BCL2-05      ----------------------atgtcctctgaagaaagcttgagctcca
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      ----------------------atgtcctctgaagaaagcttgagctcca
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      ----------------------atgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      taacgattgtcagatttcacccatgtcctctgaagaagggttgagctcaa
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      ----------------------atgtcctctgaagaagggctgagctcaa
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      ----------------------atgtcctctgaagaagggctgagctcaa
A0A8C2X310_BCL2-03      ----------------------atgtcctctgaagaagggctgagctcaa
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      ----------------------atgtcctcggaagaagggttgagctcaa
A0A8C9ZFJ5_BCL2-02      ----------------------atgtcctcggaagaagggttgagctcaa
A0A8C9ZFJ5_BCL2-03      ----------------------atgtcctcggaagaagggttgagctcaa
A0A8C9ZFJ5_BCL2-04      ----------------------atgtcctcggaagaagggttgagctcaa
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      -------------------atgctgttcgcagagatgtccggggcgctgc
A0A8D2Q1J0_BCL2-03      -------------------atgctgttcgcagagatgtccggggcgctgc
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      cgataacagattggctttttatcaatacctggtggctccttcttccgttc
A0A668TEB6_BCL2-02      cgataacagattggctttttatcaatacctggtggctccttcttccgttc
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      cgatcacagattggcttttcatcaactcctggtggctccttcttcccttc
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      cgatcacagattggcttttcatcaactcctggtggctccttcttcccttc
A0A3Q3MEY1_BCL2-05      cgatcacagattggcttttcatcaactcctggtggctccttcttcccttc
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      cgatcacagattggcttttcatcaactcctggtggctccttcttcccttc
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      cgatcacagattggcttttcatcaactcctggtggctccttctgccattc
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      cgatcacggattggcttttaatcaactcctggtggctccttctgccgttt
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      cgatcacggattggcttttaatcaactcctggtggctccttctgccgttt
A0A8C2X310_BCL2-03      cgatcacggattggcttttaatcaactcctggtggctccttctgccgttt
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      cgatcacagattggcttttcatcaattcctggtggcttcttctgccattc
A0A8C9ZFJ5_BCL2-02      cgatcacagattggcttttcatcaattcctggtggcttcttctgccattc
A0A8C9ZFJ5_BCL2-03      cgatcacagattggcttttcatcaattcctggtggcttcttctgccattc
A0A8C9ZFJ5_BCL2-04      cgatcacagattggcttttcatcaattcctggtggcttcttctgccattc
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      --------------------------------------------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------at------g---------
Q564A4_BCL2-01          --------------------------------at------g---------
X4ZGI8_BCL2-01          --------------------------------at------g---------
A0A673HVU7_BCL2-01      --------------------------------at------g---------
A0A4W4F7Z4_BCL2-01      --------------------------------at------g---------
B9ZYL7_BCL2-01          --------------------------------at------g---------
A0A8C5MT36_BCL2-03      --------------------------------at------g---------
A0A8C5MT36_BCL2-01      --------------------------------at------g---------
A0A8C5MT36_BCL2-02      --------------------------------at------g---------
A0A8C5MT36_BCL2-04      --------------------------------at------g---------
A0A7M4G2E0_BCL2-01      --------------------------------at------g---------
A0A7M4G2E0_BCL2-02      --------------------------------at------g---------
A0A673Z0A3_BCL2-01      -----------------------------atgat------g---------
A0A8C7CHJ0_BCL2-01      -----------------------------atgat------g---------
A0A8C7Q7B4_BCL2-01      --------------------------------at------g---------
A0A0U3DHY6_BCL2-01      --------------------------------at------g---------
A0A4W5NW18_BCL2-01      -----------------------------atgat------g---------
A0A674B8T7_BCL2-01      -----------------------------atgat------g---------
A0A8C7RG50_BCL2-01      -----------------------------atgat------g---------
A0A8C8GL24_BCL2-01      -----------------------------atgat------g---------
A0A6Q2YIU6_BCL2-01      --------------------------------at------g---------
A0A4W5KV00_BCL2-01      --------------------------------at------g---------
A0A8C7G8X1_BCL2-01      --------------------------------at------g---------
A0A674B0E5_BCL2-01      --------------------------------at------g---------
A0A8C8JWJ1_BCL2-02      --------------------------------at------g---------
A0A8C7N3I9_BCL2-01      --------------------------------at------g---------
A0A8C8JWJ1_BCL2-01      --------------------------------at------g---------
A0A8C5C4C3_BCL2-01      --------------------------------at------g---------
A0A3B4A3G8_BCL2-01      --------------------------------at------g---------
A0A3Q3B0R2_BCL2-01      --------------------------------at------g---------
A0A8C7ZK61_BCL2-01      --------------------------------at------g---------
A0A3P8WUE9_BCL2-01      -----atgtacttggtgccaaattctgctggaat------g---------
A0A665U7Y7_BCL2-01      --------------------------------at------g---------
A0A672HHE5_BCL2-01      --------------------------------at------g---------
A0A3Q3G1D7_BCL2-01      --------------------------------at------g---------
A0A8C2X310_BCL2-06      --------------------------------at------g---------
A0A3Q3MEY1_BCL2-01      --------------------------------at------g---------
A0A2U9BJ09_BCL2-01      --------------------------------at------g---------
A0A8C9ZFJ5_BCL2-09      --------------------------------at------g---------
A0A7N6A4C8_BCL2-01      --------------------------------at------g---------
A0A3Q0S5Z7_BCL2-01      --------------------------------at------g---------
A0A668TEB6_BCL2-05      --------------------------------at------g---------
A0A3P8QVM8_BCL2-01      --------------------------------at------g---------
A0A3P9DIG5_BCL2-01      --------------------------------at------g---------
A0A3Q2UYW8_BCL2-01      --------------------------------at------g---------
A0A3B4G3K4_BCL2-01      --------------------------------at------g---------
A0A4W6DDI0_BCL2-01      --------------------------------at------g---------
A0A1X9JZA1_BCL2-01      --------------------------------at------g---------
A0A3B4TX71_BCL2-01      --------------------------------at------g---------
A0A3B4YAG2_BCL2-01      --------------------------------at------g---------
A0A3B5BBQ0_BCL2-01      --------------------------------at------g---------
A0A3Q1B8C3_BCL2-01      --------------------------------at------g---------
A0A3P8S9L3_BCL2-01      --------------------------------at------g---------
A0A3Q1FLK7_BCL2-01      --------------------------------at------g---------
A0A673LV42_BCL2-01      --------------------------------at------g---------
A0A8C1IQE4_BCL2-01      --------------------------------at------g---------
A0A672T179_BCL2-01      --------------------------------at------g---------
A0A3B3TCS4_BCL2-01      --------------------------------at------g---------
A0A8C9T5U7_BCL2-01      --------------------------------at------g---------
W5N4F7_BCL2-01          --------------------------------at------g---------
H9GPE7_BCL2-01          --------------------------------at------g---------
A0A8D2Q1J0_BCL2-01      tgctggcggcggccgccggggtcgccctcctcgt------g---------
A0A8D2Q1J0_BCL2-03      tgctggcggcggccgccggggtcgccctcctcgt------g---------
A0A668TEB6_BCL2-01      ---atgctgcttgttgtcgctgccttcatc--gt------t---------
A0A668TEB6_BCL2-04      atcatgctgcttgttgtcgctgccttcatc--gt------t---------
A0A668TEB6_BCL2-02      atcatgctgcttgttgtcgctgccttcatc--gt------t---------
A0A668TEB6_BCL2-03      ---atgctgcttgttgtcgctgccttcatc--gt------t---------
A0A3Q3MEY1_BCL2-02      ---atgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-10      atcatgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-08      ---actcatctattgg----------------------------------
A0A3Q3MEY1_BCL2-04      atcatgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-05      atcatgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-07      ---atgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-09      ---atgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-03      atcatgcttcttgtagttgccgccttcatt--gt------t---------
A0A3Q3MEY1_BCL2-06      ---atgcttcttgtagttgccgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-02      ---atgcttcttgtaattgctgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-04      ---atgcttcttgtaattgctgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-07      attatgcttcttgtaattgctgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-05      ---atgcttcttgtaattgctgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-03      attatgcttcttgtaattgctgccttcatt--gt------t---------
A0A7N6A4C8_BCL2-06      ---atgcttcttgtaattgctgccttcatt--gt------t---------
A0A8C2X310_BCL2-01      ---atgcttcttgtggtcgctgccttcatt--gt------t---------
A0A8C2X310_BCL2-02      gtcatgcttcttgtggtcgctgccttcatt--gt------t---------
A0A8C2X310_BCL2-04      ---atgcttcttgtggtcgctgccttcatt--gt------t---------
A0A8C2X310_BCL2-05      gtcatgcttcttgtggtcgctgccttcatt--gt------t---------
A0A8C2X310_BCL2-03      gtcatgcttcttgtggtcgctgccttcatt--gt------t---------
A0A8C9ZFJ5_BCL2-01      ---atgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-05      ---atgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-06      atcatgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-02      atcatgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-03      atcatgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-04      atcatgcttcttgtagttgctgccttcatc--gt------t---------
A0A8C9ZFJ5_BCL2-07      ------------gtaacggtagctaacgtccagt------c---------
A0A8C9ZFJ5_BCL2-08      ----------------------tacatttccagt------t---------
A0A674GNG3_BCL2-02      ---atgctgctcctggccgccgccttcatc--gt------g---------
A0A674GNG3_BCL2-04      ---atgctgctcctggccgccgccttcatc--gt------g---------
A0A8C5IH35_BCL2-01      ---atgctgctcctggccgccgccttcatc--gt------g---------
A0A8C5IH35_BCL2-02      ---atgctgctcctggccgccgccttcatc--gt------g---------
A0A670IB81_BCL2-01      ---------------------------atg--at------g---------
A0A8D0BPX3_BCL2-01      --------------------------------at------g---------
A0A8D2Q1J0_BCL2-02      ---------------------------atg--at------g---------
A0A8C5S4J3_BCL2-01      --------------------------------at------g---------
A0A670ZV01_BCL2-01      ---------------------------atg--at------g---------
A0A8D0L5Z6_BCL2-01      --------------------------------at------g---------
A0A7M4EPU7_BCL2-01      --------------------------------at------g---------
A0A7M4G2E0_BCL2-03      --------------------------------at------g---------
A0A8C8SWU7_BCL2-01      --------------------------------at------g---------
K7F5Y3_BCL2-02          --------------------------------at------g---------
K7F5Y3_BCL2-01          --------------------------------at------g---------
K7F5Y3_BCL2-03          --------------------------------at------g---------
A0A452I9V7_BCL2-01      --------------------------------at------gtatttaact
A0A8C3SV21_BCL2-01      --------------------------------at------g---------
A0A8C3ITE1_BCL2-01      --------------------------------at------gtatttaatt
A0A674IMR0_BCL2-01      --------------------------------at------g---------
A0A8C0G2Q6_BCL2-01      --------------------------------at------g---------
A0A8C4VT25_BCL2-01      --------------------------------at------g---------
A0A7N4PQN7_BCL2-01      --------------------------------at------g---------
F6YNL8_BCL2-01          ---------------------------atg--at------g---------
A0A4X2L5Q0_BCL2-01      --------------------------------at------g---------
A0A8C2U1A2_BCL2-01      --------------------------------at------g---------
A0A8C9L7I6_BCL2-01      --------------------------------at------g---------
G1MZW1_BCL2-01          --------------------------------at------g---------
A0A8C3LBC4_BCL2-01      --------------------------------at------g---------
A0A669PDH6_BCL2-01      --------------------------------at------g---------
A0A8C9MG30_BCL2-01      --------------------------------atgaagtgt---------
A0A663MPN9_BCL2-01      --------------------------------at----------------
A0A8C6ZF48_BCL2-01      --------------------------------at------g---------
A0A8B9PRT7_BCL2-01      --------------------------------at------g---------
A0A8B9PRT7_BCL2-02      --------------------------------at------g---------
A0A8C0UAC7_BCL2-01      ---------------cagaggaacatattt--atagcccaa---------
A0A8B9UYC3_BCL2-01      --------------------------------at------g---------
A0A8B9E2U6_BCL2-01      --------------------------------at------g---------
A0A8B9C4H4_BCL2-01      --------------------------------at------g---------
A0A8C3CIW8_BCL2-01      ------------------cccctcggggac--tt------g---------
A0A493T1X3_BCL2-01      --------------------------------at------g---------
A0A8B9SFH3_BCL2-01      --------------------------------at------g---------
A0A8D2P664_BCL2-01      --------------------------------at------g---------
A0A674GNG3_BCL2-01      --------------------------------at------g---------
A0A674GNG3_BCL2-03      --------------------------------at------g---------
A0A8C5TLV4_BCL2-01      --------------------------------at------g---------
A0A672TR23_BCL2-01      --------------------------------at------g---------
A0A8C3JHE5_BCL2-01      --------------------------------at------g---------
A0A8C0BN28_BCL2-01      --------------------------------at------g---------
A0A8B9RWH9_BCL2-01      --------------------------------at------g---------
A0A663FHR0_BCL2-01      --------------------------------at------g---------
A0A8C8ANG9_BCL2-01      --------------------------------at------g---------
A0A8C0IE77_BCL2-01      --------------------------------at------g---------
A0A8D0G0L7_BCL2-01      --------------------------------at------g---------
A0A8C4U538_BCL2-01      ---------------cagaggaacatattt--atagtccaa---------
A0A8C4U538_BCL2-02      --------------------------------at------g---------
A0A8C3TNF2_BCL2-01      --------------------------------at------g---------
A0A8C3QX54_BCL2-01      --------------------------------at------g---------
A0A803VR88_BCL2-01      --------------------------------at------g---------
A0A803VR88_BCL2-02      --------------------------------at------g---------
A0A8C5IH35_BCL2-05      --------------------------------at------g---------
A0A8C5IH35_BCL2-04      --------------------------------at------g---------
A0A8C5IH35_BCL2-03      --------------------------------at------g---------
A0A8D2N8C6_BCL2-01      --------------------------------at------g---------
A0A8D0QLD9_BCL2-07      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A4X1TRR9_BCL2-06      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A8D0QLD9_BCL2-05      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A4X1TRR9_BCL2-05      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A8D0QLD9_BCL2-04      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A4X1TRR9_BCL2-07      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A8D0QLD9_BCL2-06      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A4X1TRR9_BCL2-04      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A4X1TRR9_BCL2-02      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A8D0QLD9_BCL2-02      ---atgctgctgctggctgccgccttcctc--gt------g---------
A0A8C6RID6_BCL2-01      --------------------------------at------g---------
A0A8C6RID6_BCL2-02      --------------------------------at------g---------
Q6R755_BCL2-01          --------------------------------at------g---------
Q923R6_BCL2-01          --------------------------------at------g---------
A0A8C8U7I9_BCL2-01      --------------------------------at------g---------
Q6NTH7_BCL2-01          --------------------------------at------g---------
A0A8C6H5J8_BCL2-01      --------------------------------at------g---------
Q7TSN8_BCL2-01          --------------------------------at------g---------
A0A8I6AJ02_BCL2-01      --------------------------------at------g---------
P49950_BCL2-01          --------------------------------at------g---------
A0A4W2DSR6_BCL2-02      --------------------------------at------g---------
A0A4W2DSR6_BCL2-02      --------------------------------at------g---------
A0A8C6CUJ2_BCL2-01      --------------------------------at------g---------
A0A4W2DSR6_BCL2-01      --------------------------------at------g---------
A0A4W2DSR6_BCL2-01      --------------------------------at------g---------
F6R2C4_BCL2-01          --------------------------------at------g---------
O02718_BCL2-01          --------------------------------at------g---------
A0A076FU27_BCL2-01      --------------------------------at------g---------
A0A076FZV9_BCL2-01      --------------------------------at------g---------
A0A452EV13_BCL2-01      --------------------------------at------g---------
A0A8C5JYS0_BCL2-01      --------------------------------at------g---------
G3SLZ1_BCL2-01          --------------------------------at------g---------
G3SLZ1_BCL2-02          --------------------------------at------g---------
H0W1T3_BCL2-01          --------------------------------at------g---------
A0A5F9CRQ4_BCL2-01      --------------------------------at------g---------
A0A5F9CRQ4_BCL2-02      --------------------------------at------g---------
M3YYK3_BCL2-01          --------------------------------at------g---------
A0A8D2AUF5_BCL2-01      --------------------------------at------g---------
I3MVK9_BCL2-01          --------------------------------at------g---------
A0A8C5YTS1_BCL2-01      --------------------------------at------g---------
A0A8D2IIB8_BCL2-01      --------------------------------at------g---------
A0A250YD83_BCL2-01      --------------------------------at------g---------
A0A452T603_BCL2-01      --------------------------------at------g---------
A0A8C2VKS3_BCL2-01      --------------------------------at------g---------
A0A8C9HUK6_BCL2-02      --------------------------------at------g---------
A0A2K5EB04_BCL2-01      --------------------------------at------g---------
A0A2K6UEL3_BCL2-01      --------------------------------at------g---------
A0A2R8MY14_BCL2-01      --------------------------------at------g---------
A0A2K6R2I5_BCL2-02      --------------------------------at------g---------
A0A2K5HK49_BCL2-01      --------------------------------at------g---------
A0A7I2V3S7_BCL2-04      --------------------------------at------g---------
A0A7I2V3S7_BCL2-10      --------------------------------at------g---------
A0A7I2V3S7_BCL2-05      --------------------------------at------g---------
A0A7I2V3S7_BCL2-08      --------------------------------at------g---------
A0A7N9CNB8_BCL2-01      --------------------------------at------g---------
A0A8D2EFR4_BCL2-01      --------------------------------at------g---------
A0A2K5XRD4_BCL2-01      --------------------------------at------g---------
A0A2K5NZS5_BCL2-01      --------------------------------at------g---------
A0A0D9S017_BCL2-01      --------------------------------at------g---------
A0A5F7ZZ15_BCL2-01      --------------------------------at------g---------
A0A2K6CIX3_BCL2-01      --------------------------------at------g---------
A0A096MPU7_BCL2-01      --------------------------------at------g---------
A0A7I2V3S7_BCL2-03      --------------------------------at------g---------
A9QXG9_BCL2-01          --------------------------------at------g---------
A0A2K6KHG1_BCL2-01      --------------------------------at------g---------
A0A2K6R2I5_BCL2-01      --------------------------------at------g---------
A0A2J8W3J1_BCL2-01      --------------------------------at------g---------
A0A8C9HUK6_BCL2-01      --------------------------------at------g---------
A0A2I3GZF9_BCL2-01      --------------------------------at------g---------
A0A7I2V3S7_BCL2-06      --------------------------------at------g---------
A0A7I2V3S7_BCL2-07      --------------------------------at------g---------
A0A2R9APW6_BCL2-01      --------------------------------at------g---------
G3QES9_BCL2-01          --------------------------------at------g---------
A0A7I2V3S7_BCL2-09      --------------------------------at------g---------
H0WKI0_BCL2-01          --------------------------------at------g---------
A0A8B7H1C6_BCL2-01      --------------------------------at------g---------
A0A8C9AC52_BCL2-01      --------------------------------at------g---------
A0A2K6G3I7_BCL2-01      --------------------------------at------g---------
A0A3Q2HRY3_BCL2-02      --------------------------------at------g---------
A0A8C4L1K6_BCL2-01      --------------------------------at------g---------
A0A3Q2HRY3_BCL2-01      --------------------------------at------g---------
A0A673VDM8_BCL2-01      --------------------------------at------g---------
A0A5F5Y6Y3_BCL2-02      --------------------------------at------g---------
A0A8C9J3W6_BCL2-01      --------------------------------at------g---------
Q8I008_BCL2-01          --------------------------------at------g---------
A0A667GHH0_BCL2-01      --------------------------------at------g---------
A0A5F5Y6Y3_BCL2-01      --------------------------------at------g---------
A0A8C8XJU8_BCL2-01      --------------------------------at------g---------
A0A8C7B9K2_BCL2-01      --------------------------------at------g---------
G1LIC9_BCL2-01          --------------------------------at------g---------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------at------g---------
A0A8I3MLT5_BCL2-02      --------------------------------at------g---------
A0A8C0NC28_BCL2-02      --------------------------------at------g---------
Q75SV7_BCL2-01          --------------------------------at------g---------
A0A8C0KWE3_BCL2-01      --------------------------------at------g---------
A0A8C0NC28_BCL2-01      --------------------------------at------g---------
A0A8I3MLT5_BCL2-01      --------------------------------at------g---------
A0A8C6AXM8_BCL2-01      --------------------------------at------g---------
A0A8C9CJ69_BCL2-01      --------------------------------at------g---------
A0A8B8V3A7_BCL2-02      --------------------------------at------g---------
A0A8B8V3A7_BCL2-01      --------------------------------at------g---------
A0A8B8V3A7_BCL2-03      --------------------------------at------g---------
A0A8C3WCN0_BCL2-01      --------------------------------at------g---------
A0A8D0QLD9_BCL2-03      --------------------------------at------g---------
A0A4X1TRR9_BCL2-01      --------------------------------at------g---------
A0A8D0QLD9_BCL2-01      --------------------------------at------g---------
A0A4X1TRR9_BCL2-03      --------------------------------at------g---------
                                                                          

A3KNH9_BCL2-01          --------------------------------gct---------------
Q564A4_BCL2-01          --------------------------------gct---------------
X4ZGI8_BCL2-01          --------------------------------gcc---------------
A0A673HVU7_BCL2-01      --------------------------------gcc---------------
A0A4W4F7Z4_BCL2-01      --------------------------------gca---------------
B9ZYL7_BCL2-01          --------------------------------gct---------------
A0A8C5MT36_BCL2-03      --------------------------------gct---------------
A0A8C5MT36_BCL2-01      --------------------------------gct---------------
A0A8C5MT36_BCL2-02      --------------------------------gct---------------
A0A8C5MT36_BCL2-04      --------------------------------gct---------------
A0A7M4G2E0_BCL2-01      --------------------------------gaggctgggagattattt
A0A7M4G2E0_BCL2-02      --------------------------------gaggctg-----------
A0A673Z0A3_BCL2-01      --------------------------------gcg---------------
A0A8C7CHJ0_BCL2-01      --------------------------------gca---------------
A0A8C7Q7B4_BCL2-01      --------------------------------gca---------------
A0A0U3DHY6_BCL2-01      --------------------------------gca---------------
A0A4W5NW18_BCL2-01      --------------------------------gca---------------
A0A674B8T7_BCL2-01      --------------------------------gca---------------
A0A8C7RG50_BCL2-01      --------------------------------gca---------------
A0A8C8GL24_BCL2-01      --------------------------------gca---------------
A0A6Q2YIU6_BCL2-01      --------------------------------gca---------------
A0A4W5KV00_BCL2-01      --------------------------------gca---------------
A0A8C7G8X1_BCL2-01      --------------------------------gca---------------
A0A674B0E5_BCL2-01      --------------------------------gca---------------
A0A8C8JWJ1_BCL2-02      --------------------------------gca---------------
A0A8C7N3I9_BCL2-01      --------------------------------gca---------------
A0A8C8JWJ1_BCL2-01      --------------------------------gca---------------
A0A8C5C4C3_BCL2-01      --------------------------------gcg---------------
A0A3B4A3G8_BCL2-01      --------------------------------gcg---------------
A0A3Q3B0R2_BCL2-01      --------------------------------gag---------------
A0A8C7ZK61_BCL2-01      --------------------------------gcg---------------
A0A3P8WUE9_BCL2-01      --------------------------------gcg---------------
A0A665U7Y7_BCL2-01      --------------------------------gag---------------
A0A672HHE5_BCL2-01      --------------------------------gaa---------------
A0A3Q3G1D7_BCL2-01      --------------------------------gcg---------------
A0A8C2X310_BCL2-06      --------------------------------gcg---------------
A0A3Q3MEY1_BCL2-01      --------------------------------gcg---------------
A0A2U9BJ09_BCL2-01      --------------------------------gcg---------------
A0A8C9ZFJ5_BCL2-09      --------------------------------gcg---------------
A0A7N6A4C8_BCL2-01      --------------------------------gcg---------------
A0A3Q0S5Z7_BCL2-01      --------------------------------gcg---------------
A0A668TEB6_BCL2-05      --------------------------------gcg---------------
A0A3P8QVM8_BCL2-01      --------------------------------gag---------------
A0A3P9DIG5_BCL2-01      --------------------------------gag---------------
A0A3Q2UYW8_BCL2-01      --------------------------------gcg---------------
A0A3B4G3K4_BCL2-01      --------------------------------gcg---------------
A0A4W6DDI0_BCL2-01      --------------------------------gcg---------------
A0A1X9JZA1_BCL2-01      --------------------------------gcg---------------
A0A3B4TX71_BCL2-01      --------------------------------gcg---------------
A0A3B4YAG2_BCL2-01      --------------------------------gcg---------------
A0A3B5BBQ0_BCL2-01      --------------------------------gcg---------------
A0A3Q1B8C3_BCL2-01      --------------------------------gcg---------------
A0A3P8S9L3_BCL2-01      --------------------------------gcg---------------
A0A3Q1FLK7_BCL2-01      --------------------------------gcg---------------
A0A673LV42_BCL2-01      --------------------------------gca---------------
A0A8C1IQE4_BCL2-01      --------------------------------gca---------------
A0A672T179_BCL2-01      --------------------------------gca---------------
A0A3B3TCS4_BCL2-01      --------------------------------gca---------------
A0A8C9T5U7_BCL2-01      --------------------------------gca---------------
W5N4F7_BCL2-01          --------------------------------gca---------------
H9GPE7_BCL2-01          --------------------------------gct---------------
A0A8D2Q1J0_BCL2-01      --------------------------------gccttcctgctgttgctg
A0A8D2Q1J0_BCL2-03      --------------------------------gccttcctgctgttgctg
A0A668TEB6_BCL2-01      --------------------------------gcttttgtgttgctgtta
A0A668TEB6_BCL2-04      --------------------------------gcttttgtgttgctgtta
A0A668TEB6_BCL2-02      --------------------------------gcttttgtgttgctgtta
A0A668TEB6_BCL2-03      --------------------------------gcttttgtgttgctgtta
A0A3Q3MEY1_BCL2-02      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-10      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-08      --------------------------------acctttgggtt-------
A0A3Q3MEY1_BCL2-04      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-05      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-07      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-09      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-03      --------------------------------gcctttgtgttgctgtta
A0A3Q3MEY1_BCL2-06      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-02      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-04      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-07      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-05      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-03      --------------------------------gcctttgtgttgctgtta
A0A7N6A4C8_BCL2-06      --------------------------------gcctttgtgttgctgtta
A0A8C2X310_BCL2-01      --------------------------------gcatttgtgttgctgttg
A0A8C2X310_BCL2-02      --------------------------------gcatttgtgttgctgttg
A0A8C2X310_BCL2-04      --------------------------------gcatttgtgttgctgttg
A0A8C2X310_BCL2-05      --------------------------------gcatttgtgttgctgttg
A0A8C2X310_BCL2-03      --------------------------------gcatttgtgttgctgttg
A0A8C9ZFJ5_BCL2-01      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-05      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-06      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-02      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-03      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-04      --------------------------------gcctttgtgttgctgtta
A0A8C9ZFJ5_BCL2-07      --------------------------------attatactgtagct----
A0A8C9ZFJ5_BCL2-08      -----------------------------------------tacct----
A0A674GNG3_BCL2-02      --------------------------------gccttcgtcctcctcctc
A0A674GNG3_BCL2-04      --------------------------------gccttcgtcctcctcctc
A0A8C5IH35_BCL2-01      --------------------------------gccttcgtcctcctcctc
A0A8C5IH35_BCL2-02      --------------------------------gccttcgtcctcctcctc
A0A670IB81_BCL2-01      --------------------------------gct---------------
A0A8D0BPX3_BCL2-01      --------------------------------gct---------------
A0A8D2Q1J0_BCL2-02      --------------------------------gct---------------
A0A8C5S4J3_BCL2-01      --------------------------------gct---------------
A0A670ZV01_BCL2-01      --------------------------------gct---------------
A0A8D0L5Z6_BCL2-01      --------------------------------gct---------------
A0A7M4EPU7_BCL2-01      --------------------------------tct---------------
A0A7M4G2E0_BCL2-03      --------------------------------gct---------------
A0A8C8SWU7_BCL2-01      --------------------------------gct---------------
K7F5Y3_BCL2-02          --------------------------------gct---------------
K7F5Y3_BCL2-01          --------------------------------gct---------------
K7F5Y3_BCL2-03          --------------------------------gct---------------
A0A452I9V7_BCL2-01      gcatgtgtctgtacgttgcactggagggaaaagca---------------
A0A8C3SV21_BCL2-01      --------------------------------gct---------------
A0A8C3ITE1_BCL2-01      gcatgtgtctgtacgttgcactggagggaaaagca---------------
A0A674IMR0_BCL2-01      --------------------------------gct---------------
A0A8C0G2Q6_BCL2-01      --------------------------------gct---------------
A0A8C4VT25_BCL2-01      --------------------------------gct---------------
A0A7N4PQN7_BCL2-01      --------------------------------gct---------------
F6YNL8_BCL2-01          --------------------------------gct---------------
A0A4X2L5Q0_BCL2-01      --------------------------------gct---------------
A0A8C2U1A2_BCL2-01      --------------------------------gct---------------
A0A8C9L7I6_BCL2-01      --------------------------------gct---------------
G1MZW1_BCL2-01          --------------------------------gct---------------
A0A8C3LBC4_BCL2-01      --------------------------------gct---------------
A0A669PDH6_BCL2-01      --------------------------------gct---------------
A0A8C9MG30_BCL2-01      --------------------------------gat---------------
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------gct---------------
A0A8B9PRT7_BCL2-01      --------------------------------gct---------------
A0A8B9PRT7_BCL2-02      --------------------------------gct---------------
A0A8C0UAC7_BCL2-01      --------------------------------gct---------------
A0A8B9UYC3_BCL2-01      --------------------------------gct---------------
A0A8B9E2U6_BCL2-01      --------------------------------gct---------------
A0A8B9C4H4_BCL2-01      --------------------------------gct---------------
A0A8C3CIW8_BCL2-01      --------------------------------aag---------------
A0A493T1X3_BCL2-01      --------------------------------gct---------------
A0A8B9SFH3_BCL2-01      --------------------------------gct---------------
A0A8D2P664_BCL2-01      --------------------------------gct---------------
A0A674GNG3_BCL2-01      --------------------------------gct---------------
A0A674GNG3_BCL2-03      --------------------------------gct---------------
A0A8C5TLV4_BCL2-01      --------------------------------gct---------------
A0A672TR23_BCL2-01      --------------------------------gct---------------
A0A8C3JHE5_BCL2-01      --------------------------------gct---------------
A0A8C0BN28_BCL2-01      --------------------------------gct---------------
A0A8B9RWH9_BCL2-01      --------------------------------gct---------------
A0A663FHR0_BCL2-01      --------------------------------gct---------------
A0A8C8ANG9_BCL2-01      --------------------------------gct---------------
A0A8C0IE77_BCL2-01      --------------------------------gct---------------
A0A8D0G0L7_BCL2-01      --------------------------------gct---------------
A0A8C4U538_BCL2-01      --------------------------------gct---------------
A0A8C4U538_BCL2-02      --------------------------------gct---------------
A0A8C3TNF2_BCL2-01      --------------------------------gct---------------
A0A8C3QX54_BCL2-01      --------------------------------gct---------------
A0A803VR88_BCL2-01      --------------------------------gct---------------
A0A803VR88_BCL2-02      --------------------------------gct---------------
A0A8C5IH35_BCL2-05      --------------------------------gct---------------
A0A8C5IH35_BCL2-04      --------------------------------gct---------------
A0A8C5IH35_BCL2-03      --------------------------------gct---------------
A0A8D2N8C6_BCL2-01      --------------------------------gct---------------
A0A8D0QLD9_BCL2-07      --------------------------------gcgttcgtgctgctgctc
A0A4X1TRR9_BCL2-06      --------------------------------gcgttcgtgctgctgctc
A0A8D0QLD9_BCL2-05      --------------------------------gcgttcgtgctgctgctc
A0A4X1TRR9_BCL2-05      --------------------------------gcgttcgtgctgctgctc
A0A8D0QLD9_BCL2-04      --------------------------------gcgttcgtgctgctgctc
A0A4X1TRR9_BCL2-07      --------------------------------gcgttcgtgctgctgctc
A0A8D0QLD9_BCL2-06      --------------------------------gcgttcgtgctgctgctc
A0A4X1TRR9_BCL2-04      --------------------------------gcgttcgtgctgctgctc
A0A4X1TRR9_BCL2-02      --------------------------------gcgttcgtgctgctgctc
A0A8D0QLD9_BCL2-02      --------------------------------gcgttcgtgctgctgctc
A0A8C6RID6_BCL2-01      --------------------------------gcg---------------
A0A8C6RID6_BCL2-02      --------------------------------gcg---------------
Q6R755_BCL2-01          --------------------------------gcg---------------
Q923R6_BCL2-01          --------------------------------gct---------------
A0A8C8U7I9_BCL2-01      --------------------------------gcg---------------
Q6NTH7_BCL2-01          --------------------------------gcg---------------
A0A8C6H5J8_BCL2-01      --------------------------------gcg---------------
Q7TSN8_BCL2-01          --------------------------------gcg---------------
A0A8I6AJ02_BCL2-01      --------------------------------gcg---------------
P49950_BCL2-01          --------------------------------gcg---------------
A0A4W2DSR6_BCL2-02      --------------------------------gcg---------------
A0A4W2DSR6_BCL2-02      --------------------------------gcg---------------
A0A8C6CUJ2_BCL2-01      --------------------------------gcg---------------
A0A4W2DSR6_BCL2-01      --------------------------------gcg---------------
A0A4W2DSR6_BCL2-01      --------------------------------gcg---------------
F6R2C4_BCL2-01          --------------------------------gcg---------------
O02718_BCL2-01          --------------------------------gcg---------------
A0A076FU27_BCL2-01      --------------------------------gcg---------------
A0A076FZV9_BCL2-01      --------------------------------gcg---------------
A0A452EV13_BCL2-01      --------------------------------gcg---------------
A0A8C5JYS0_BCL2-01      --------------------------------gcg---------------
G3SLZ1_BCL2-01          --------------------------------gcg---------------
G3SLZ1_BCL2-02          --------------------------------gcg---------------
H0W1T3_BCL2-01          --------------------------------gct---------------
A0A5F9CRQ4_BCL2-01      --------------------------------gcg---------------
A0A5F9CRQ4_BCL2-02      --------------------------------gcg---------------
M3YYK3_BCL2-01          --------------------------------gcg---------------
A0A8D2AUF5_BCL2-01      --------------------------------gct---------------
I3MVK9_BCL2-01          --------------------------------gct---------------
A0A8C5YTS1_BCL2-01      --------------------------------gct---------------
A0A8D2IIB8_BCL2-01      --------------------------------gct---------------
A0A250YD83_BCL2-01      --------------------------------gcg---------------
A0A452T603_BCL2-01      --------------------------------gcg---------------
A0A8C2VKS3_BCL2-01      --------------------------------gcg---------------
A0A8C9HUK6_BCL2-02      --------------------------------gcg---------------
A0A2K5EB04_BCL2-01      --------------------------------gcg---------------
A0A2K6UEL3_BCL2-01      --------------------------------gcg---------------
A0A2R8MY14_BCL2-01      --------------------------------gcg---------------
A0A2K6R2I5_BCL2-02      --------------------------------gcg---------------
A0A2K5HK49_BCL2-01      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-04      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-10      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-05      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-08      --------------------------------gcg---------------
A0A7N9CNB8_BCL2-01      --------------------------------gcg---------------
A0A8D2EFR4_BCL2-01      --------------------------------gcg---------------
A0A2K5XRD4_BCL2-01      --------------------------------gcg---------------
A0A2K5NZS5_BCL2-01      --------------------------------gcg---------------
A0A0D9S017_BCL2-01      --------------------------------gcg---------------
A0A5F7ZZ15_BCL2-01      --------------------------------gcg---------------
A0A2K6CIX3_BCL2-01      --------------------------------gcg---------------
A0A096MPU7_BCL2-01      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-03      --------------------------------a-----------------
A9QXG9_BCL2-01          --------------------------------gcg---------------
A0A2K6KHG1_BCL2-01      --------------------------------gcg---------------
A0A2K6R2I5_BCL2-01      --------------------------------gcg---------------
A0A2J8W3J1_BCL2-01      --------------------------------gcg---------------
A0A8C9HUK6_BCL2-01      --------------------------------gcg---------------
A0A2I3GZF9_BCL2-01      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-06      --------------------------------gcg---------------
A0A7I2V3S7_BCL2-07      --------------------------------gcg---------------
A0A2R9APW6_BCL2-01      --------------------------------gcg---------------
G3QES9_BCL2-01          --------------------------------gcg---------------
A0A7I2V3S7_BCL2-09      --------------------------------g-----------------
H0WKI0_BCL2-01          --------------------------------gcg---------------
A0A8B7H1C6_BCL2-01      --------------------------------gcg---------------
A0A8C9AC52_BCL2-01      --------------------------------gcg---------------
A0A2K6G3I7_BCL2-01      --------------------------------gcg---------------
A0A3Q2HRY3_BCL2-02      --------------------------------gcg---------------
A0A8C4L1K6_BCL2-01      --------------------------------gcg---------------
A0A3Q2HRY3_BCL2-01      --------------------------------gcg---------------
A0A673VDM8_BCL2-01      --------------------------------gcg---------------
A0A5F5Y6Y3_BCL2-02      --------------------------------gcg---------------
A0A8C9J3W6_BCL2-01      --------------------------------gcg---------------
Q8I008_BCL2-01          --------------------------------gcg---------------
A0A667GHH0_BCL2-01      --------------------------------gcg---------------
A0A5F5Y6Y3_BCL2-01      --------------------------------gcg---------------
A0A8C8XJU8_BCL2-01      --------------------------------gcg---------------
A0A8C7B9K2_BCL2-01      --------------------------------gcg---------------
G1LIC9_BCL2-01          --------------------------------gcg---------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------gcg---------------
A0A8I3MLT5_BCL2-02      --------------------------------gcg---------------
A0A8C0NC28_BCL2-02      --------------------------------gcg---------------
Q75SV7_BCL2-01          --------------------------------gcg---------------
A0A8C0KWE3_BCL2-01      --------------------------------gcg---------------
A0A8C0NC28_BCL2-01      --------------------------------gcg---------------
A0A8I3MLT5_BCL2-01      --------------------------------gcg---------------
A0A8C6AXM8_BCL2-01      --------------------------------gcg---------------
A0A8C9CJ69_BCL2-01      --------------------------------gcg---------------
A0A8B8V3A7_BCL2-02      --------------------------------gcg---------------
A0A8B8V3A7_BCL2-01      --------------------------------gcg---------------
A0A8B8V3A7_BCL2-03      --------------------------------gcg---------------
A0A8C3WCN0_BCL2-01      --------------------------------gcg---------------
A0A8D0QLD9_BCL2-03      --------------------------------gcg---------------
A0A4X1TRR9_BCL2-01      --------------------------------gcg---------------
A0A8D0QLD9_BCL2-01      --------------------------------gcg---------------
A0A4X1TRR9_BCL2-03      --------------------------------gcg---------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------aacg--------
Q564A4_BCL2-01          --------------------------------------aacg--------
X4ZGI8_BCL2-01          --------------------------------------aacg--------
A0A673HVU7_BCL2-01      --------------------------------------accg--------
A0A4W4F7Z4_BCL2-01      --------------------------------------aacg--------
B9ZYL7_BCL2-01          --------------------------------------catc--------
A0A8C5MT36_BCL2-03      --------------------------------------catc--------
A0A8C5MT36_BCL2-01      --------------------------------------catc--------
A0A8C5MT36_BCL2-02      --------------------------------------catc--------
A0A8C5MT36_BCL2-04      --------------------------------------catc--------
A0A7M4G2E0_BCL2-01      cagccaaaaagaatacatgtaagaaccaggatgtctcaaacagacagacc
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------aacg--------
A0A8C7CHJ0_BCL2-01      --------------------------------------aacg--------
A0A8C7Q7B4_BCL2-01      --------------------------------------aacg--------
A0A0U3DHY6_BCL2-01      --------------------------------------aacg--------
A0A4W5NW18_BCL2-01      --------------------------------------aacg--------
A0A674B8T7_BCL2-01      --------------------------------------aacg--------
A0A8C7RG50_BCL2-01      --------------------------------------aacg--------
A0A8C8GL24_BCL2-01      --------------------------------------aacg--------
A0A6Q2YIU6_BCL2-01      --------------------------------------gacg--------
A0A4W5KV00_BCL2-01      --------------------------------------aacg--------
A0A8C7G8X1_BCL2-01      --------------------------------------aacg--------
A0A674B0E5_BCL2-01      --------------------------------------aacg--------
A0A8C8JWJ1_BCL2-02      --------------------------------------aacg--------
A0A8C7N3I9_BCL2-01      --------------------------------------aacg--------
A0A8C8JWJ1_BCL2-01      --------------------------------------aacg--------
A0A8C5C4C3_BCL2-01      --------------------------------------aacg--------
A0A3B4A3G8_BCL2-01      --------------------------------------aacg--------
A0A3Q3B0R2_BCL2-01      -----------------------------------------g--------
A0A8C7ZK61_BCL2-01      --------------------------------------aacg--------
A0A3P8WUE9_BCL2-01      --------------------------------------agcg--------
A0A665U7Y7_BCL2-01      --------------------------------------agcg--------
A0A672HHE5_BCL2-01      --------------------------------------aacg--------
A0A3Q3G1D7_BCL2-01      --------------------------------------aacg--------
A0A8C2X310_BCL2-06      --------------------------------------aacg--------
A0A3Q3MEY1_BCL2-01      --------------------------------------aacg--------
A0A2U9BJ09_BCL2-01      --------------------------------------agcg--------
A0A8C9ZFJ5_BCL2-09      --------------------------------------aacg--------
A0A7N6A4C8_BCL2-01      --------------------------------------aacg--------
A0A3Q0S5Z7_BCL2-01      --------------------------------------aacg--------
A0A668TEB6_BCL2-05      --------------------------------------aacg--------
A0A3P8QVM8_BCL2-01      --------------------------------------aacg--------
A0A3P9DIG5_BCL2-01      --------------------------------------aacg--------
A0A3Q2UYW8_BCL2-01      --------------------------------------aacg--------
A0A3B4G3K4_BCL2-01      --------------------------------------aacg--------
A0A4W6DDI0_BCL2-01      --------------------------------------agcg--------
A0A1X9JZA1_BCL2-01      --------------------------------------aacg--------
A0A3B4TX71_BCL2-01      --------------------------------------agcg--------
A0A3B4YAG2_BCL2-01      --------------------------------------agcg--------
A0A3B5BBQ0_BCL2-01      --------------------------------------aacg--------
A0A3Q1B8C3_BCL2-01      --------------------------------------aacg--------
A0A3P8S9L3_BCL2-01      --------------------------------------aacg--------
A0A3Q1FLK7_BCL2-01      --------------------------------------aacg--------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------aacg--------
A0A8C9T5U7_BCL2-01      --------------------------------------aacg--------
W5N4F7_BCL2-01          --------------------------------------aata--------
H9GPE7_BCL2-01          --------------------------------------catc--------
A0A8D2Q1J0_BCL2-01      tatctggtgtcgccggtgacaagccccaagccactgtccttg--------
A0A8D2Q1J0_BCL2-03      tatctggtgtcgccggtgacaagccccaagccactgtccttg--------
A0A668TEB6_BCL2-01      tatatgatatcgcccctcattagtcccaagcctctaaaattgaa------
A0A668TEB6_BCL2-04      tatatgatatcgcccctcattagtcccaagcctctaaaattgaa------
A0A668TEB6_BCL2-02      tatatgatatcgcccctcattagtcccaagcctctaaaattgaa------
A0A668TEB6_BCL2-03      tatatgatatcgcccctcattagtcccaagcctctaaaattgaa------
A0A3Q3MEY1_BCL2-02      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-10      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-08      --tatgatct--------------cctgactcttttgaact---------
A0A3Q3MEY1_BCL2-04      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-05      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-07      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-09      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-03      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A3Q3MEY1_BCL2-06      tatatgatatcgccccttattagccccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-02      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-04      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-07      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-05      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-03      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A7N6A4C8_BCL2-06      tacatgatatcacctcttattagtcccaaacctctgaaactgaa------
A0A8C2X310_BCL2-01      tacatgatatcgccacttattagtcccaaacctctgaaactgaa------
A0A8C2X310_BCL2-02      tacatgatatcgccacttattagtcccaaacctctgaaactgaa------
A0A8C2X310_BCL2-04      tacatgatatcgccacttattagtcccaaacctctgaaactgaa------
A0A8C2X310_BCL2-05      tacatgatatcgccacttattagtcccaaacctctgaaactgaa------
A0A8C2X310_BCL2-03      tacatgatatcgccacttattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-01      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-05      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-06      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-02      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-03      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-04      tacatgatatcgcctctcattagtcccaaacctctgaaactgaa------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      tacatggtgtcgccgcttatcagccccaagtccctgaagctg--------
A0A674GNG3_BCL2-04      tacatggtgtcgccgcttatcagccccaagtccctgaagctg--------
A0A8C5IH35_BCL2-01      tacatggtgtcgccgcttatcagccccaagtcgctgaagctg--------
A0A8C5IH35_BCL2-02      tacatggtgtcgccgcttatcagccccaagtcgctgaagctg--------
A0A670IB81_BCL2-01      --------------------------------------caga--------
A0A8D0BPX3_BCL2-01      --------------------------------------catc--------
A0A8D2Q1J0_BCL2-02      --------------------------------------catc--------
A0A8C5S4J3_BCL2-01      --------------------------------------catc--------
A0A670ZV01_BCL2-01      --------------------------------------catc--------
A0A8D0L5Z6_BCL2-01      --------------------------------------catc--------
A0A7M4EPU7_BCL2-01      --------------------------------------tcca--------
A0A7M4G2E0_BCL2-03      --------------------------------------aatc--------
A0A8C8SWU7_BCL2-01      --------------------------------------catc--------
K7F5Y3_BCL2-02          --------------------------------------catc--------
K7F5Y3_BCL2-01          --------------------------------------catc--------
K7F5Y3_BCL2-03          --------------------------------------catc--------
A0A452I9V7_BCL2-01      --------------------------------------cagtacttctgc
A0A8C3SV21_BCL2-01      --------------------------------------catc--------
A0A8C3ITE1_BCL2-01      --------------------------------------cagcacttctgc
A0A674IMR0_BCL2-01      --------------------------------------catc--------
A0A8C0G2Q6_BCL2-01      --------------------------------------catc--------
A0A8C4VT25_BCL2-01      --------------------------------------catc--------
A0A7N4PQN7_BCL2-01      --------------------------------------cacc--------
F6YNL8_BCL2-01          --------------------------------------cacc--------
A0A4X2L5Q0_BCL2-01      --------------------------------------cacc--------
A0A8C2U1A2_BCL2-01      --------------------------------------cacc--------
A0A8C9L7I6_BCL2-01      --------------------------------------cacc--------
G1MZW1_BCL2-01          --------------------------------------cacc--------
A0A8C3LBC4_BCL2-01      --------------------------------------cacc--------
A0A669PDH6_BCL2-01      --------------------------------------cacc--------
A0A8C9MG30_BCL2-01      --------------------------------------ggtctttattt-
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------catc--------
A0A8B9PRT7_BCL2-01      --------------------------------------catc--------
A0A8B9PRT7_BCL2-02      --------------------------------------catc--------
A0A8C0UAC7_BCL2-01      --------------------------------------catc--------
A0A8B9UYC3_BCL2-01      --------------------------------------catc--------
A0A8B9E2U6_BCL2-01      --------------------------------------catc--------
A0A8B9C4H4_BCL2-01      --------------------------------------catc--------
A0A8C3CIW8_BCL2-01      --------------------------------------catcaaagcag-
A0A493T1X3_BCL2-01      --------------------------------------catc--------
A0A8B9SFH3_BCL2-01      --------------------------------------catc--------
A0A8D2P664_BCL2-01      --------------------------------------cacc--------
A0A674GNG3_BCL2-01      --------------------------------------catc--------
A0A674GNG3_BCL2-03      --------------------------------------catc--------
A0A8C5TLV4_BCL2-01      --------------------------------------catc--------
A0A672TR23_BCL2-01      --------------------------------------catc--------
A0A8C3JHE5_BCL2-01      --------------------------------------catc--------
A0A8C0BN28_BCL2-01      --------------------------------------catc--------
A0A8B9RWH9_BCL2-01      --------------------------------------catc--------
A0A663FHR0_BCL2-01      --------------------------------------catc--------
A0A8C8ANG9_BCL2-01      --------------------------------------catc--------
A0A8C0IE77_BCL2-01      --------------------------------------catc--------
A0A8D0G0L7_BCL2-01      --------------------------------------catc--------
A0A8C4U538_BCL2-01      --------------------------------------catc--------
A0A8C4U538_BCL2-02      --------------------------------------catc--------
A0A8C3TNF2_BCL2-01      --------------------------------------catc--------
A0A8C3QX54_BCL2-01      --------------------------------------catc--------
A0A803VR88_BCL2-01      --------------------------------------catc--------
A0A803VR88_BCL2-02      --------------------------------------catc--------
A0A8C5IH35_BCL2-05      --------------------------------------catc--------
A0A8C5IH35_BCL2-04      --------------------------------------catc--------
A0A8C5IH35_BCL2-03      --------------------------------------catc--------
A0A8D2N8C6_BCL2-01      --------------------------------------catc--------
A0A8D0QLD9_BCL2-07      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A4X1TRR9_BCL2-06      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A8D0QLD9_BCL2-05      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A4X1TRR9_BCL2-05      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A8D0QLD9_BCL2-04      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A4X1TRR9_BCL2-07      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A8D0QLD9_BCL2-06      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A4X1TRR9_BCL2-04      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A4X1TRR9_BCL2-02      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A8D0QLD9_BCL2-02      tacatggtgtctccgctcatcagccccaagcccctcgccctg--------
A0A8C6RID6_BCL2-01      --------------------------------------cacg--------
A0A8C6RID6_BCL2-02      --------------------------------------cacg--------
Q6R755_BCL2-01          --------------------------------------caag--------
Q923R6_BCL2-01          --------------------------------------caag--------
A0A8C8U7I9_BCL2-01      --------------------------------------caag--------
Q6NTH7_BCL2-01          --------------------------------------caag--------
A0A8C6H5J8_BCL2-01      --------------------------------------caag--------
Q7TSN8_BCL2-01          --------------------------------------caag--------
A0A8I6AJ02_BCL2-01      --------------------------------------caag--------
P49950_BCL2-01          --------------------------------------caag--------
A0A4W2DSR6_BCL2-02      --------------------------------------cacg--------
A0A4W2DSR6_BCL2-02      --------------------------------------cacg--------
A0A8C6CUJ2_BCL2-01      --------------------------------------cacg--------
A0A4W2DSR6_BCL2-01      --------------------------------------cacg--------
A0A4W2DSR6_BCL2-01      --------------------------------------cacg--------
F6R2C4_BCL2-01          --------------------------------------cacg--------
O02718_BCL2-01          --------------------------------------cacg--------
A0A076FU27_BCL2-01      --------------------------------------cacg--------
A0A076FZV9_BCL2-01      --------------------------------------cacg--------
A0A452EV13_BCL2-01      --------------------------------------cacg--------
A0A8C5JYS0_BCL2-01      --------------------------------------cacg--------
G3SLZ1_BCL2-01          --------------------------------------cacg--------
G3SLZ1_BCL2-02          --------------------------------------cacg--------
H0W1T3_BCL2-01          --------------------------------------cacg--------
A0A5F9CRQ4_BCL2-01      --------------------------------------cacg--------
A0A5F9CRQ4_BCL2-02      --------------------------------------cacg--------
M3YYK3_BCL2-01          --------------------------------------cacg--------
A0A8D2AUF5_BCL2-01      --------------------------------------cacg--------
I3MVK9_BCL2-01          --------------------------------------cacg--------
A0A8C5YTS1_BCL2-01      --------------------------------------cacg--------
A0A8D2IIB8_BCL2-01      --------------------------------------cacg--------
A0A250YD83_BCL2-01      --------------------------------------caag--------
A0A452T603_BCL2-01      --------------------------------------cacg--------
A0A8C2VKS3_BCL2-01      --------------------------------------cacg--------
A0A8C9HUK6_BCL2-02      --------------------------------------cacg--------
A0A2K5EB04_BCL2-01      --------------------------------------cacg--------
A0A2K6UEL3_BCL2-01      --------------------------------------cacg--------
A0A2R8MY14_BCL2-01      --------------------------------------cacg--------
A0A2K6R2I5_BCL2-02      --------------------------------------cacg--------
A0A2K5HK49_BCL2-01      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-04      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-10      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-05      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-08      --------------------------------------cacg--------
A0A7N9CNB8_BCL2-01      --------------------------------------cacg--------
A0A8D2EFR4_BCL2-01      --------------------------------------caag--------
A0A2K5XRD4_BCL2-01      --------------------------------------cacg--------
A0A2K5NZS5_BCL2-01      --------------------------------------cacg--------
A0A0D9S017_BCL2-01      --------------------------------------cacg--------
A0A5F7ZZ15_BCL2-01      --------------------------------------cacg--------
A0A2K6CIX3_BCL2-01      --------------------------------------cacg--------
A0A096MPU7_BCL2-01      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------cacg--------
A0A2K6KHG1_BCL2-01      --------------------------------------cacg--------
A0A2K6R2I5_BCL2-01      --------------------------------------cacg--------
A0A2J8W3J1_BCL2-01      --------------------------------------cacg--------
A0A8C9HUK6_BCL2-01      --------------------------------------cacg--------
A0A2I3GZF9_BCL2-01      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-06      --------------------------------------cacg--------
A0A7I2V3S7_BCL2-07      --------------------------------------cacg--------
A0A2R9APW6_BCL2-01      --------------------------------------cacg--------
G3QES9_BCL2-01          --------------------------------------cacg--------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------cacg--------
A0A8B7H1C6_BCL2-01      --------------------------------------cacg--------
A0A8C9AC52_BCL2-01      --------------------------------------cacg--------
A0A2K6G3I7_BCL2-01      --------------------------------------cacg--------
A0A3Q2HRY3_BCL2-02      --------------------------------------cacg--------
A0A8C4L1K6_BCL2-01      --------------------------------------cacg--------
A0A3Q2HRY3_BCL2-01      --------------------------------------cacg--------
A0A673VDM8_BCL2-01      --------------------------------------cacg--------
A0A5F5Y6Y3_BCL2-02      --------------------------------------cacg--------
A0A8C9J3W6_BCL2-01      --------------------------------------cacg--------
Q8I008_BCL2-01          --------------------------------------cacg--------
A0A667GHH0_BCL2-01      --------------------------------------cacg--------
A0A5F5Y6Y3_BCL2-01      --------------------------------------cacg--------
A0A8C8XJU8_BCL2-01      --------------------------------------cacg--------
A0A8C7B9K2_BCL2-01      --------------------------------------cacg--------
G1LIC9_BCL2-01          --------------------------------------cacg--------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------cacg--------
A0A8I3MLT5_BCL2-02      --------------------------------------cacg--------
A0A8C0NC28_BCL2-02      --------------------------------------cacg--------
Q75SV7_BCL2-01          --------------------------------------cacg--------
A0A8C0KWE3_BCL2-01      --------------------------------------cacg--------
A0A8C0NC28_BCL2-01      --------------------------------------cacg--------
A0A8I3MLT5_BCL2-01      --------------------------------------cacg--------
A0A8C6AXM8_BCL2-01      --------------------------------------cacg--------
A0A8C9CJ69_BCL2-01      --------------------------------------cacg--------
A0A8B8V3A7_BCL2-02      --------------------------------------cacg--------
A0A8B8V3A7_BCL2-01      --------------------------------------cacg--------
A0A8B8V3A7_BCL2-03      --------------------------------------cacg--------
A0A8C3WCN0_BCL2-01      --------------------------------------cacg--------
A0A8D0QLD9_BCL2-03      --------------------------------------cacg--------
A0A4X1TRR9_BCL2-01      --------------------------------------cacg--------
A0A8D0QLD9_BCL2-01      --------------------------------------cacg--------
A0A4X1TRR9_BCL2-03      --------------------------------------cacg--------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          -----ctaga----------------------------------------
A0A8C5MT36_BCL2-03      -----ccagg----------------------------------------
A0A8C5MT36_BCL2-01      -----ccagg----------------------------------------
A0A8C5MT36_BCL2-02      -----ccagg----------------------------------------
A0A8C5MT36_BCL2-04      -----ccagg----------------------------------------
A0A7M4G2E0_BCL2-01      tcaccgagataagccataccgatactacgagagccatggttatgacaggc
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      -----cagga----------------------------------------
A0A8C1IQE4_BCL2-01      -----cagga----------------------------------------
A0A672T179_BCL2-01      -----cagga----------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          -----acgaa----------------------------------------
H9GPE7_BCL2-01          -----ctggg----------------------------------------
A0A8D2Q1J0_BCL2-01      -----tccgg----------------------------------------
A0A8D2Q1J0_BCL2-03      -----tccgg----------------------------------------
A0A668TEB6_BCL2-01      -----cgggg----------------------------------------
A0A668TEB6_BCL2-04      -----cgggg----------------------------------------
A0A668TEB6_BCL2-02      -----cgggg----------------------------------------
A0A668TEB6_BCL2-03      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-02      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-10      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-05      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-07      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-09      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-03      -----cgggg----------------------------------------
A0A3Q3MEY1_BCL2-06      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-02      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-04      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-07      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-05      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-03      -----cgggg----------------------------------------
A0A7N6A4C8_BCL2-06      -----cgggg----------------------------------------
A0A8C2X310_BCL2-01      -----cgggg----------------------------------------
A0A8C2X310_BCL2-02      -----cgggg----------------------------------------
A0A8C2X310_BCL2-04      -----cgggg----------------------------------------
A0A8C2X310_BCL2-05      -----cgggg----------------------------------------
A0A8C2X310_BCL2-03      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-01      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-05      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-06      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-02      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-03      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-04      -----cgggg----------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      -----cccgg----------------------------------------
A0A674GNG3_BCL2-04      -----cccgg----------------------------------------
A0A8C5IH35_BCL2-01      -----cccgg----------------------------------------
A0A8C5IH35_BCL2-02      -----cccgg----------------------------------------
A0A670IB81_BCL2-01      -----ctggg----------------------------------------
A0A8D0BPX3_BCL2-01      -----ccggg----------------------------------------
A0A8D2Q1J0_BCL2-02      -----ctggg----------------------------------------
A0A8C5S4J3_BCL2-01      -----ctggg----------------------------------------
A0A670ZV01_BCL2-01      -----ctggg----------------------------------------
A0A8D0L5Z6_BCL2-01      -----ctggg----------------------------------------
A0A7M4EPU7_BCL2-01      -----cagtg----------------------------------------
A0A7M4G2E0_BCL2-03      -----ctggg----------------------------------------
A0A8C8SWU7_BCL2-01      -----ctggg----------------------------------------
K7F5Y3_BCL2-02          -----ctggg----------------------------------------
K7F5Y3_BCL2-01          -----ctggg----------------------------------------
K7F5Y3_BCL2-03          -----ctggg----------------------------------------
A0A452I9V7_BCL2-01      aagagcttgg----------------------------------------
A0A8C3SV21_BCL2-01      -----ctggg----------------------------------------
A0A8C3ITE1_BCL2-01      aagagcttgg----------------------------------------
A0A674IMR0_BCL2-01      -----ctggg----------------------------------------
A0A8C0G2Q6_BCL2-01      -----ctggg----------------------------------------
A0A8C4VT25_BCL2-01      -----ctggg----------------------------------------
A0A7N4PQN7_BCL2-01      -----ctgga----------------------------------------
F6YNL8_BCL2-01          -----ctgga----------------------------------------
A0A4X2L5Q0_BCL2-01      -----ctgga----------------------------------------
A0A8C2U1A2_BCL2-01      -----ccggg----------------------------------------
A0A8C9L7I6_BCL2-01      -----ccggg----------------------------------------
G1MZW1_BCL2-01          -----ccggg----------------------------------------
A0A8C3LBC4_BCL2-01      -----ccggg----------------------------------------
A0A669PDH6_BCL2-01      -----ccggg----------------------------------------
A0A8C9MG30_BCL2-01      -----caaag---------------------catttactcaaaaaagtgt
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      -----cgggg----------------------------------------
A0A8B9PRT7_BCL2-01      -----cgggg----------------------------------------
A0A8B9PRT7_BCL2-02      -----cgggg----------------------------------------
A0A8C0UAC7_BCL2-01      -----cgggg----------------------------------------
A0A8B9UYC3_BCL2-01      -----ccggg----------------------------------------
A0A8B9E2U6_BCL2-01      -----ccggg----------------------------------------
A0A8B9C4H4_BCL2-01      -----ccggg----------------------------------------
A0A8C3CIW8_BCL2-01      -----ccggagcttaacgtttctgaagacttggcgatgtttgggtcgtgt
A0A493T1X3_BCL2-01      -----ccggg----------------------------------------
A0A8B9SFH3_BCL2-01      -----ccggg----------------------------------------
A0A8D2P664_BCL2-01      -----cgggg----------------------------------------
A0A674GNG3_BCL2-01      -----cgggg----------------------------------------
A0A674GNG3_BCL2-03      -----cgggg----------------------------------------
A0A8C5TLV4_BCL2-01      -----cgggg----------------------------------------
A0A672TR23_BCL2-01      -----cgggg----------------------------------------
A0A8C3JHE5_BCL2-01      -----cgggg----------------------------------------
A0A8C0BN28_BCL2-01      -----cgggg----------------------------------------
A0A8B9RWH9_BCL2-01      -----cgggg----------------------------------------
A0A663FHR0_BCL2-01      -----cgggg----------------------------------------
A0A8C8ANG9_BCL2-01      -----cgggg----------------------------------------
A0A8C0IE77_BCL2-01      -----cgggg----------------------------------------
A0A8D0G0L7_BCL2-01      -----cgggg----------------------------------------
A0A8C4U538_BCL2-01      -----cgggg----------------------------------------
A0A8C4U538_BCL2-02      -----cgggg----------------------------------------
A0A8C3TNF2_BCL2-01      -----cgggg----------------------------------------
A0A8C3QX54_BCL2-01      -----cgggg----------------------------------------
A0A803VR88_BCL2-01      -----cgggg----------------------------------------
A0A803VR88_BCL2-02      -----cgggg----------------------------------------
A0A8C5IH35_BCL2-05      -----cgggg----------------------------------------
A0A8C5IH35_BCL2-04      -----cgggg----------------------------------------
A0A8C5IH35_BCL2-03      -----cgggg----------------------------------------
A0A8D2N8C6_BCL2-01      -----cgggg----------------------------------------
A0A8D0QLD9_BCL2-07      -----cccgg----------------------------------------
A0A4X1TRR9_BCL2-06      -----cccgg----------------------------------------
A0A8D0QLD9_BCL2-05      -----cccgg----------------------------------------
A0A4X1TRR9_BCL2-05      -----cccgg----------------------------------------
A0A8D0QLD9_BCL2-04      -----cccgg----------------------------------------
A0A4X1TRR9_BCL2-07      -----cccgg----------------------------------------
A0A8D0QLD9_BCL2-06      -----cccgg----------------------------------------
A0A4X1TRR9_BCL2-04      -----cccgg----------------------------------------
A0A4X1TRR9_BCL2-02      -----cccgg----------------------------------------
A0A8D0QLD9_BCL2-02      -----cccgg----------------------------------------
A0A8C6RID6_BCL2-01      -----ccggc----------------------------------------
A0A8C6RID6_BCL2-02      -----ccggc----------------------------------------
Q6R755_BCL2-01          -----ccggg----------------------------------------
Q923R6_BCL2-01          -----ctggg----------------------------------------
A0A8C8U7I9_BCL2-01      -----ccggg----------------------------------------
Q6NTH7_BCL2-01          -----ccggg----------------------------------------
A0A8C6H5J8_BCL2-01      -----ccggg----------------------------------------
Q7TSN8_BCL2-01          -----ccggg----------------------------------------
A0A8I6AJ02_BCL2-01      -----ccggg----------------------------------------
P49950_BCL2-01          -----ccggg----------------------------------------
A0A4W2DSR6_BCL2-02      -----cgggg----------------------------------------
A0A4W2DSR6_BCL2-02      -----cgggg----------------------------------------
A0A8C6CUJ2_BCL2-01      -----cggcg----------------------------------------
A0A4W2DSR6_BCL2-01      -----cgggg----------------------------------------
A0A4W2DSR6_BCL2-01      -----cgggg----------------------------------------
F6R2C4_BCL2-01          -----cgggg----------------------------------------
O02718_BCL2-01          -----cgggg----------------------------------------
A0A076FU27_BCL2-01      -----cgggg----------------------------------------
A0A076FZV9_BCL2-01      -----cgggg----------------------------------------
A0A452EV13_BCL2-01      -----cgggg----------------------------------------
A0A8C5JYS0_BCL2-01      -----cgggg----------------------------------------
G3SLZ1_BCL2-01          -----caggg----------------------------------------
G3SLZ1_BCL2-02          -----caggg----------------------------------------
H0W1T3_BCL2-01          -----ctggg----------------------------------------
A0A5F9CRQ4_BCL2-01      -----ccggg----------------------------------------
A0A5F9CRQ4_BCL2-02      -----ccggg----------------------------------------
M3YYK3_BCL2-01          -----ctggg----------------------------------------
A0A8D2AUF5_BCL2-01      -----ctggg----------------------------------------
I3MVK9_BCL2-01          -----ctggg----------------------------------------
A0A8C5YTS1_BCL2-01      -----ctggg----------------------------------------
A0A8D2IIB8_BCL2-01      -----ctggg----------------------------------------
A0A250YD83_BCL2-01      -----ctggg----------------------------------------
A0A452T603_BCL2-01      -----ctggg----------------------------------------
A0A8C2VKS3_BCL2-01      -----ctggg----------------------------------------
A0A8C9HUK6_BCL2-02      -----ctggg----------------------------------------
A0A2K5EB04_BCL2-01      -----ctggg----------------------------------------
A0A2K6UEL3_BCL2-01      -----ctggg----------------------------------------
A0A2R8MY14_BCL2-01      -----ctggg----------------------------------------
A0A2K6R2I5_BCL2-02      -----ctggg----------------------------------------
A0A2K5HK49_BCL2-01      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-04      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-10      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-05      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-08      -----ctggg----------------------------------------
A0A7N9CNB8_BCL2-01      -----ctggg----------------------------------------
A0A8D2EFR4_BCL2-01      -----ctggg----------------------------------------
A0A2K5XRD4_BCL2-01      -----ctggg----------------------------------------
A0A2K5NZS5_BCL2-01      -----ctggg----------------------------------------
A0A0D9S017_BCL2-01      -----ctggg----------------------------------------
A0A5F7ZZ15_BCL2-01      -----ctggg----------------------------------------
A0A2K6CIX3_BCL2-01      -----ctggg----------------------------------------
A0A096MPU7_BCL2-01      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -----ctggg----------------------------------------
A0A2K6KHG1_BCL2-01      -----ctggg----------------------------------------
A0A2K6R2I5_BCL2-01      -----ctggg----------------------------------------
A0A2J8W3J1_BCL2-01      -----ctggg----------------------------------------
A0A8C9HUK6_BCL2-01      -----ctggg----------------------------------------
A0A2I3GZF9_BCL2-01      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-06      -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-07      -----ctggg----------------------------------------
A0A2R9APW6_BCL2-01      -----ctggg----------------------------------------
G3QES9_BCL2-01          -----ctggg----------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -----ctggg----------------------------------------
A0A8B7H1C6_BCL2-01      -----ctggg----------------------------------------
A0A8C9AC52_BCL2-01      -----ctggg----------------------------------------
A0A2K6G3I7_BCL2-01      -----ccggg----------------------------------------
A0A3Q2HRY3_BCL2-02      -----ctggg----------------------------------------
A0A8C4L1K6_BCL2-01      -----ctggg----------------------------------------
A0A3Q2HRY3_BCL2-01      -----ctggg----------------------------------------
A0A673VDM8_BCL2-01      -----ccggg----------------------------------------
A0A5F5Y6Y3_BCL2-02      -----ctggg----------------------------------------
A0A8C9J3W6_BCL2-01      -----ctggg----------------------------------------
Q8I008_BCL2-01          -----ctggg----------------------------------------
A0A667GHH0_BCL2-01      -----ctggg----------------------------------------
A0A5F5Y6Y3_BCL2-01      -----ctggg----------------------------------------
A0A8C8XJU8_BCL2-01      -----ctggg----------------------------------------
A0A8C7B9K2_BCL2-01      -----ctggg----------------------------------------
G1LIC9_BCL2-01          -----ctggg----------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      -----ctggg----------------------------------------
A0A8I3MLT5_BCL2-02      -----ctggg----------------------------------------
A0A8C0NC28_BCL2-02      -----ctggg----------------------------------------
Q75SV7_BCL2-01          -----ctggg----------------------------------------
A0A8C0KWE3_BCL2-01      -----ctggg----------------------------------------
A0A8C0NC28_BCL2-01      -----ctggg----------------------------------------
A0A8I3MLT5_BCL2-01      -----ctggg----------------------------------------
A0A8C6AXM8_BCL2-01      -----ctggg----------------------------------------
A0A8C9CJ69_BCL2-01      -----ctggg----------------------------------------
A0A8B8V3A7_BCL2-02      -----ctggg----------------------------------------
A0A8B8V3A7_BCL2-01      -----ctggg----------------------------------------
A0A8B8V3A7_BCL2-03      -----ctggg----------------------------------------
A0A8C3WCN0_BCL2-01      -----ctggg----------------------------------------
A0A8D0QLD9_BCL2-03      -----ctggg----------------------------------------
A0A4X1TRR9_BCL2-01      -----ctggg----------------------------------------
A0A8D0QLD9_BCL2-01      -----ctggg----------------------------------------
A0A4X1TRR9_BCL2-03      -----ctggg----------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      acaacacagacagaaggactaaagaaccatacccatcccacggaaggtca
A0A7M4G2E0_BCL2-02      ---------------------------------------------ggtca
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      --------------------------------------------------
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      tttcccccctttttactttaagaaattttacaggtgtaataaaagtttaa
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      cgttgctggtgttttttgtagaggaaacttgacagaggaacatatttata
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          -----aa-------------------------------------------
Q564A4_BCL2-01          -----aa-------------------------------------------
X4ZGI8_BCL2-01          -----aa-------------------------------------------
A0A673HVU7_BCL2-01      -----aa-------------------------------------------
A0A4W4F7Z4_BCL2-01      -----aa-------------------------------------------
B9ZYL7_BCL2-01          -----ag---a---------------------------------------
A0A8C5MT36_BCL2-03      -----cg---a---------------------------------------
A0A8C5MT36_BCL2-01      -----cg---a---------------------------------------
A0A8C5MT36_BCL2-02      -----cg---a---------------------------------------
A0A8C5MT36_BCL2-04      -----cg---a---------------------------------------
A0A7M4G2E0_BCL2-01      gcaaaag-------------------------------------------
A0A7M4G2E0_BCL2-02      gcaaaag-------------------------------------------
A0A673Z0A3_BCL2-01      -----at-------------------------------------------
A0A8C7CHJ0_BCL2-01      -----at-------------------------------------------
A0A8C7Q7B4_BCL2-01      -----at-------------------------------------------
A0A0U3DHY6_BCL2-01      -----ag-------------------------------------------
A0A4W5NW18_BCL2-01      -----ag-------------------------------------------
A0A674B8T7_BCL2-01      -----ag-------------------------------------------
A0A8C7RG50_BCL2-01      -----ag-------------------------------------------
A0A8C8GL24_BCL2-01      -----ag-------------------------------------------
A0A6Q2YIU6_BCL2-01      -----ac-------------------------------------------
A0A4W5KV00_BCL2-01      -----ac-------------------------------------------
A0A8C7G8X1_BCL2-01      -----ac-------------------------------------------
A0A674B0E5_BCL2-01      -----ac-------------------------------------------
A0A8C8JWJ1_BCL2-02      -----ac-------------------------------------------
A0A8C7N3I9_BCL2-01      -----ac-------------------------------------------
A0A8C8JWJ1_BCL2-01      -----ac-------------------------------------------
A0A8C5C4C3_BCL2-01      -----tg-------------------------------------------
A0A3B4A3G8_BCL2-01      -----ac-------------------------------------------
A0A3Q3B0R2_BCL2-01      -----tg-------------------------------------------
A0A8C7ZK61_BCL2-01      -----tg-------------------------------------------
A0A3P8WUE9_BCL2-01      -----ag-------------------------------------------
A0A665U7Y7_BCL2-01      -----ag-------------------------------------------
A0A672HHE5_BCL2-01      -----ag-------------------------------------------
A0A3Q3G1D7_BCL2-01      -----ag-------------------------------------------
A0A8C2X310_BCL2-06      -----ag-------------------------------------------
A0A3Q3MEY1_BCL2-01      -----ag-------------------------------------------
A0A2U9BJ09_BCL2-01      -----ag-------------------------------------------
A0A8C9ZFJ5_BCL2-09      -----ag-------------------------------------------
A0A7N6A4C8_BCL2-01      -----ag-------------------------------------------
A0A3Q0S5Z7_BCL2-01      -----ag-------------------------------------------
A0A668TEB6_BCL2-05      -----ag-------------------------------------------
A0A3P8QVM8_BCL2-01      -----ag-------------------------------------------
A0A3P9DIG5_BCL2-01      -----ag-------------------------------------------
A0A3Q2UYW8_BCL2-01      -----ag-------------------------------------------
A0A3B4G3K4_BCL2-01      -----ag-------------------------------------------
A0A4W6DDI0_BCL2-01      -----ag-------------------------------------------
A0A1X9JZA1_BCL2-01      -----ag-------------------------------------------
A0A3B4TX71_BCL2-01      -----ag-------------------------------------------
A0A3B4YAG2_BCL2-01      -----ag-------------------------------------------
A0A3B5BBQ0_BCL2-01      -----ag-------------------------------------------
A0A3Q1B8C3_BCL2-01      -----ag-------------------------------------------
A0A3P8S9L3_BCL2-01      -----ag-------------------------------------------
A0A3Q1FLK7_BCL2-01      -----ag-------------------------------------------
A0A673LV42_BCL2-01      ----------g---------------------------------------
A0A8C1IQE4_BCL2-01      ----------g---------------------------------------
A0A672T179_BCL2-01      ----------g---------------------------------------
A0A3B3TCS4_BCL2-01      -----ac-------------------------------------------
A0A8C9T5U7_BCL2-01      -----ag-------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          -----at---a---------------------------------------
A0A8D2Q1J0_BCL2-01      -----cg---c---------------------------------------
A0A8D2Q1J0_BCL2-03      -----cg---c---------------------------------------
A0A668TEB6_BCL2-01      ----------c---------------------------------------
A0A668TEB6_BCL2-04      ----------c---------------------------------------
A0A668TEB6_BCL2-02      ----------c---------------------------------------
A0A668TEB6_BCL2-03      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-02      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-10      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-05      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-07      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-09      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-03      ----------c---------------------------------------
A0A3Q3MEY1_BCL2-06      ----------c---------------------------------------
A0A7N6A4C8_BCL2-02      ----------c---------------------------------------
A0A7N6A4C8_BCL2-04      ----------c---------------------------------------
A0A7N6A4C8_BCL2-07      ----------c---------------------------------------
A0A7N6A4C8_BCL2-05      ----------c---------------------------------------
A0A7N6A4C8_BCL2-03      ----------c---------------------------------------
A0A7N6A4C8_BCL2-06      ----------c---------------------------------------
A0A8C2X310_BCL2-01      ----------c---------------------------------------
A0A8C2X310_BCL2-02      ----------c---------------------------------------
A0A8C2X310_BCL2-04      ----------c---------------------------------------
A0A8C2X310_BCL2-05      ----------c---------------------------------------
A0A8C2X310_BCL2-03      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-01      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-05      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-06      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-02      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-03      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-04      ----------c---------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      -----cg---c---------------------------------------
A0A674GNG3_BCL2-04      -----cg---c---------------------------------------
A0A8C5IH35_BCL2-01      -----cg---c---------------------------------------
A0A8C5IH35_BCL2-02      -----cg---c---------------------------------------
A0A670IB81_BCL2-01      -----at---a---------------------------------------
A0A8D0BPX3_BCL2-01      -----at---a---------------------------------------
A0A8D2Q1J0_BCL2-02      -----at---a---------------------------------------
A0A8C5S4J3_BCL2-01      -----at---a---------------------------------------
A0A670ZV01_BCL2-01      -----at---a---------------------------------------
A0A8D0L5Z6_BCL2-01      -----ag---a---------------------------------------
A0A7M4EPU7_BCL2-01      -----aa---a---------------------------------------
A0A7M4G2E0_BCL2-03      -----ag---a---------------------------------------
A0A8C8SWU7_BCL2-01      -----ag---a---------------------------------------
K7F5Y3_BCL2-02          -----ag---a---------------------------------------
K7F5Y3_BCL2-01          -----ag---a---------------------------------------
K7F5Y3_BCL2-03          -----ag---a---------------------------------------
A0A452I9V7_BCL2-01      -----agtcaa---------------------------------------
A0A8C3SV21_BCL2-01      -----ag---a---------------------------------------
A0A8C3ITE1_BCL2-01      -----agtcaa---------------------------------------
A0A674IMR0_BCL2-01      -----ag---a---------------------------------------
A0A8C0G2Q6_BCL2-01      -----ag---a---------------------------------------
A0A8C4VT25_BCL2-01      -----ag---a---------------------------------------
A0A7N4PQN7_BCL2-01      -----ag---a---------------------------------------
F6YNL8_BCL2-01          -----ag---a---------------------------------------
A0A4X2L5Q0_BCL2-01      -----ag---a---------------------------------------
A0A8C2U1A2_BCL2-01      -----ag---a---------------------------------------
A0A8C9L7I6_BCL2-01      -----ag---a---------------------------------------
G1MZW1_BCL2-01          -----ag---a---------------------------------------
A0A8C3LBC4_BCL2-01      -----ag---a---------------------------------------
A0A669PDH6_BCL2-01      -----ag---a---------------------------------------
A0A8C9MG30_BCL2-01      gaatcag---agatggatgttcctgtttgtctagaagactgtttggatca
A0A663MPN9_BCL2-01      -----gc---a---------------------------------------
A0A8C6ZF48_BCL2-01      -----ag---a---------------------------------------
A0A8B9PRT7_BCL2-01      -----ag---a---------------------------------------
A0A8B9PRT7_BCL2-02      -----ag---a---------------------------------------
A0A8C0UAC7_BCL2-01      -----ag---a---------------------------------------
A0A8B9UYC3_BCL2-01      -----ag---a---------------------------------------
A0A8B9E2U6_BCL2-01      -----ag---a---------------------------------------
A0A8B9C4H4_BCL2-01      -----ag---a---------------------------------------
A0A8C3CIW8_BCL2-01      gtcccaa---a---------------------------------------
A0A493T1X3_BCL2-01      -----ag---a---------------------------------------
A0A8B9SFH3_BCL2-01      -----ag---a---------------------------------------
A0A8D2P664_BCL2-01      -----ag---a---------------------------------------
A0A674GNG3_BCL2-01      -----ag---a---------------------------------------
A0A674GNG3_BCL2-03      -----ag---a---------------------------------------
A0A8C5TLV4_BCL2-01      -----ag---a---------------------------------------
A0A672TR23_BCL2-01      -----ag---a---------------------------------------
A0A8C3JHE5_BCL2-01      -----ag---a---------------------------------------
A0A8C0BN28_BCL2-01      -----ag---a---------------------------------------
A0A8B9RWH9_BCL2-01      -----ag---a---------------------------------------
A0A663FHR0_BCL2-01      -----ag---a---------------------------------------
A0A8C8ANG9_BCL2-01      -----ag---a---------------------------------------
A0A8C0IE77_BCL2-01      -----ag---a---------------------------------------
A0A8D0G0L7_BCL2-01      -----ag---a---------------------------------------
A0A8C4U538_BCL2-01      -----ag---a---------------------------------------
A0A8C4U538_BCL2-02      -----ag---a---------------------------------------
A0A8C3TNF2_BCL2-01      -----ag---a---------------------------------------
A0A8C3QX54_BCL2-01      -----ag---a---------------------------------------
A0A803VR88_BCL2-01      -----ag---a---------------------------------------
A0A803VR88_BCL2-02      -----ag---a---------------------------------------
A0A8C5IH35_BCL2-05      -----ag---a---------------------------------------
A0A8C5IH35_BCL2-04      -----ag---a---------------------------------------
A0A8C5IH35_BCL2-03      -----ag---a---------------------------------------
A0A8D2N8C6_BCL2-01      -----ag---a---------------------------------------
A0A8D0QLD9_BCL2-07      -----ag---c---------------------------------------
A0A4X1TRR9_BCL2-06      -----ag---c---------------------------------------
A0A8D0QLD9_BCL2-05      -----ag---c---------------------------------------
A0A4X1TRR9_BCL2-05      -----ag---c---------------------------------------
A0A8D0QLD9_BCL2-04      -----ag---c---------------------------------------
A0A4X1TRR9_BCL2-07      -----ag---c---------------------------------------
A0A8D0QLD9_BCL2-06      -----ag---c---------------------------------------
A0A4X1TRR9_BCL2-04      -----ag---c---------------------------------------
A0A4X1TRR9_BCL2-02      -----ag---c---------------------------------------
A0A8D0QLD9_BCL2-02      -----ag---c---------------------------------------
A0A8C6RID6_BCL2-01      -----ag---a---------------------------------------
A0A8C6RID6_BCL2-02      -----ag---a---------------------------------------
Q6R755_BCL2-01          -----ag---a---------------------------------------
Q923R6_BCL2-01          -----ag---a---------------------------------------
A0A8C8U7I9_BCL2-01      -----ag---a---------------------------------------
Q6NTH7_BCL2-01          -----ag---a---------------------------------------
A0A8C6H5J8_BCL2-01      -----ag---a---------------------------------------
Q7TSN8_BCL2-01          -----ag---a---------------------------------------
A0A8I6AJ02_BCL2-01      -----ag---a---------------------------------------
P49950_BCL2-01          -----ag---a---------------------------------------
A0A4W2DSR6_BCL2-02      -----gg---a---------------------------------------
A0A4W2DSR6_BCL2-02      -----gg---a---------------------------------------
A0A8C6CUJ2_BCL2-01      -----gg---c---------------------------------------
A0A4W2DSR6_BCL2-01      -----gg---a---------------------------------------
A0A4W2DSR6_BCL2-01      -----gg---a---------------------------------------
F6R2C4_BCL2-01          -----gg---a---------------------------------------
O02718_BCL2-01          -----gg---a---------------------------------------
A0A076FU27_BCL2-01      -----gg---c---------------------------------------
A0A076FZV9_BCL2-01      -----gg---c---------------------------------------
A0A452EV13_BCL2-01      -----gg---c---------------------------------------
A0A8C5JYS0_BCL2-01      -----ac---c---------------------------------------
G3SLZ1_BCL2-01          -----ag---a---------------------------------------
G3SLZ1_BCL2-02          -----ag---a---------------------------------------
H0W1T3_BCL2-01          -----ag---a---------------------------------------
A0A5F9CRQ4_BCL2-01      -----cg---a---------------------------------------
A0A5F9CRQ4_BCL2-02      -----cg---a---------------------------------------
M3YYK3_BCL2-01          -----ag---a---------------------------------------
A0A8D2AUF5_BCL2-01      -----ag---a---------------------------------------
I3MVK9_BCL2-01          -----ag---a---------------------------------------
A0A8C5YTS1_BCL2-01      -----ag---a---------------------------------------
A0A8D2IIB8_BCL2-01      -----ag---a---------------------------------------
A0A250YD83_BCL2-01      -----ag---a---------------------------------------
A0A452T603_BCL2-01      -----ag---a---------------------------------------
A0A8C2VKS3_BCL2-01      -----ag---a---------------------------------------
A0A8C9HUK6_BCL2-02      -----ag---a---------------------------------------
A0A2K5EB04_BCL2-01      -----ag---a---------------------------------------
A0A2K6UEL3_BCL2-01      -----ag---a---------------------------------------
A0A2R8MY14_BCL2-01      -----ag---a---------------------------------------
A0A2K6R2I5_BCL2-02      -----ag---a---------------------------------------
A0A2K5HK49_BCL2-01      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-04      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-10      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-05      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-08      -----ag---a---------------------------------------
A0A7N9CNB8_BCL2-01      -----ag---a---------------------------------------
A0A8D2EFR4_BCL2-01      -----ag---a---------------------------------------
A0A2K5XRD4_BCL2-01      -----ag---a---------------------------------------
A0A2K5NZS5_BCL2-01      -----ag---a---------------------------------------
A0A0D9S017_BCL2-01      -----ag---a---------------------------------------
A0A5F7ZZ15_BCL2-01      -----ag---a---------------------------------------
A0A2K6CIX3_BCL2-01      -----ag---a---------------------------------------
A0A096MPU7_BCL2-01      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -----ag---a---------------------------------------
A0A2K6KHG1_BCL2-01      -----ag---a---------------------------------------
A0A2K6R2I5_BCL2-01      -----ag---a---------------------------------------
A0A2J8W3J1_BCL2-01      -----ac---a---------------------------------------
A0A8C9HUK6_BCL2-01      -----ag---a---------------------------------------
A0A2I3GZF9_BCL2-01      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-06      -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-07      -----ag---a---------------------------------------
A0A2R9APW6_BCL2-01      -----ag---a---------------------------------------
G3QES9_BCL2-01          -----ag---a---------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -----ag---a---------------------------------------
A0A8B7H1C6_BCL2-01      -----ag---a---------------------------------------
A0A8C9AC52_BCL2-01      -----ag---a---------------------------------------
A0A2K6G3I7_BCL2-01      -----ag---a---------------------------------------
A0A3Q2HRY3_BCL2-02      -----ag---a---------------------------------------
A0A8C4L1K6_BCL2-01      -----ag---a---------------------------------------
A0A3Q2HRY3_BCL2-01      -----ag---a---------------------------------------
A0A673VDM8_BCL2-01      -----ag---a---------------------------------------
A0A5F5Y6Y3_BCL2-02      -----ag---a---------------------------------------
A0A8C9J3W6_BCL2-01      -----ag---a---------------------------------------
Q8I008_BCL2-01          -----ag---a---------------------------------------
A0A667GHH0_BCL2-01      -----ag---a---------------------------------------
A0A5F5Y6Y3_BCL2-01      -----ag---a---------------------------------------
A0A8C8XJU8_BCL2-01      -----ag---a---------------------------------------
A0A8C7B9K2_BCL2-01      -----ag---a---------------------------------------
G1LIC9_BCL2-01          -----ag---a---------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      -----cg---a---------------------------------------
A0A8I3MLT5_BCL2-02      -----cg---a---------------------------------------
A0A8C0NC28_BCL2-02      -----cg---a---------------------------------------
Q75SV7_BCL2-01          -----cg---a---------------------------------------
A0A8C0KWE3_BCL2-01      -----cg---a---------------------------------------
A0A8C0NC28_BCL2-01      -----cg---a---------------------------------------
A0A8I3MLT5_BCL2-01      -----cg---a---------------------------------------
A0A8C6AXM8_BCL2-01      -----ag---a---------------------------------------
A0A8C9CJ69_BCL2-01      -----ag---a---------------------------------------
A0A8B8V3A7_BCL2-02      -----ag---a---------------------------------------
A0A8B8V3A7_BCL2-01      -----ag---a---------------------------------------
A0A8B8V3A7_BCL2-03      -----ag---a---------------------------------------
A0A8C3WCN0_BCL2-01      -----ag---a---------------------------------------
A0A8D0QLD9_BCL2-03      -----ag---a---------------------------------------
A0A4X1TRR9_BCL2-01      -----ag---a---------------------------------------
A0A8D0QLD9_BCL2-01      -----ag---a---------------------------------------
A0A4X1TRR9_BCL2-03      -----ag---a---------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      --------------------------------------------------
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      cctattccttcgtgcagaacctgcctgctttgctcctctgcagtttcatc
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          --------------------------------------------------
A0A8C5MT36_BCL2-03      --------------------------------------------------
A0A8C5MT36_BCL2-01      --------------------------------------------------
A0A8C5MT36_BCL2-02      --------------------------------------------------
A0A8C5MT36_BCL2-04      --------------------------------------------------
A0A7M4G2E0_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-02      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      --------------------------------------------------
A0A8C9T5U7_BCL2-01      --------------------------------------------------
W5N4F7_BCL2-01          --------------------------------------------------
H9GPE7_BCL2-01          --------------------------------------------------
A0A8D2Q1J0_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-03      --------------------------------------------------
A0A668TEB6_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------------------------------------------------
A0A668TEB6_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-02      --------------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------------------------------------------------
A0A3Q3MEY1_BCL2-04      --------------------------------------------------
A0A3Q3MEY1_BCL2-05      --------------------------------------------------
A0A3Q3MEY1_BCL2-07      --------------------------------------------------
A0A3Q3MEY1_BCL2-09      --------------------------------------------------
A0A3Q3MEY1_BCL2-03      --------------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------------------------------------------------
A0A7N6A4C8_BCL2-04      --------------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------------------------------------------------
A0A7N6A4C8_BCL2-03      --------------------------------------------------
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      --------------------------------------------------
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------------------------------------------------
A0A8C9ZFJ5_BCL2-03      --------------------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
A0A674GNG3_BCL2-02      --------------------------------------------------
A0A674GNG3_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-01      --------------------------------------------------
A0A8C5IH35_BCL2-02      --------------------------------------------------
A0A670IB81_BCL2-01      --------------------------------------------------
A0A8D0BPX3_BCL2-01      --------------------------------------------------
A0A8D2Q1J0_BCL2-02      --------------------------------------------------
A0A8C5S4J3_BCL2-01      --------------------------------------------------
A0A670ZV01_BCL2-01      --------------------------------------------------
A0A8D0L5Z6_BCL2-01      --------------------------------------------------
A0A7M4EPU7_BCL2-01      --------------------------------------------------
A0A7M4G2E0_BCL2-03      --------------------------------------------------
A0A8C8SWU7_BCL2-01      --------------------------------------------------
K7F5Y3_BCL2-02          --------------------------------------------------
K7F5Y3_BCL2-01          --------------------------------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3ITE1_BCL2-01      --------------------------------------------------
A0A674IMR0_BCL2-01      --------------------------------------------------
A0A8C0G2Q6_BCL2-01      --------------------------------------------------
A0A8C4VT25_BCL2-01      --------------------------------------------------
A0A7N4PQN7_BCL2-01      --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      --------------------------------------------------
A0A8C2U1A2_BCL2-01      --------------------------------------------------
A0A8C9L7I6_BCL2-01      --------------------------------------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      --------------------------------------------------
A0A669PDH6_BCL2-01      --------------------------------------------------
A0A8C9MG30_BCL2-01      tgagaagttgctgtccaatcctttttcacagagcagaaagacagggcatg
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-01      --------------------------------------------------
A0A8B9PRT7_BCL2-02      --------------------------------------------------
A0A8C0UAC7_BCL2-01      --------------------------------------------------
A0A8B9UYC3_BCL2-01      --------------------------------------------------
A0A8B9E2U6_BCL2-01      --------------------------------------------------
A0A8B9C4H4_BCL2-01      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A493T1X3_BCL2-01      --------------------------------------------------
A0A8B9SFH3_BCL2-01      --------------------------------------------------
A0A8D2P664_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-01      --------------------------------------------------
A0A674GNG3_BCL2-03      --------------------------------------------------
A0A8C5TLV4_BCL2-01      --------------------------------------------------
A0A672TR23_BCL2-01      --------------------------------------------------
A0A8C3JHE5_BCL2-01      --------------------------------------------------
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      --------------------------------------------------
A0A663FHR0_BCL2-01      --------------------------------------------------
A0A8C8ANG9_BCL2-01      --------------------------------------------------
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-01      --------------------------------------------------
A0A8C4U538_BCL2-02      --------------------------------------------------
A0A8C3TNF2_BCL2-01      --------------------------------------------------
A0A8C3QX54_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-01      --------------------------------------------------
A0A803VR88_BCL2-02      --------------------------------------------------
A0A8C5IH35_BCL2-05      --------------------------------------------------
A0A8C5IH35_BCL2-04      --------------------------------------------------
A0A8C5IH35_BCL2-03      --------------------------------------------------
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      --------------------------------------------------
A0A4X1TRR9_BCL2-06      --------------------------------------------------
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      --------------------------------------------------
A0A4X1TRR9_BCL2-02      --------------------------------------------------
A0A8D0QLD9_BCL2-02      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
Q6R755_BCL2-01          --------------------------------------------------
Q923R6_BCL2-01          --------------------------------------------------
A0A8C8U7I9_BCL2-01      --------------------------------------------------
Q6NTH7_BCL2-01          --------------------------------------------------
A0A8C6H5J8_BCL2-01      --------------------------------------------------
Q7TSN8_BCL2-01          --------------------------------------------------
A0A8I6AJ02_BCL2-01      --------------------------------------------------
P49950_BCL2-01          --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A4W2DSR6_BCL2-02      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
A0A4W2DSR6_BCL2-01      --------------------------------------------------
F6R2C4_BCL2-01          --------------------------------------------------
O02718_BCL2-01          --------------------------------------------------
A0A076FU27_BCL2-01      --------------------------------------------------
A0A076FZV9_BCL2-01      --------------------------------------------------
A0A452EV13_BCL2-01      --------------------------------------------------
A0A8C5JYS0_BCL2-01      --------------------------------------------------
G3SLZ1_BCL2-01          --------------------------------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      --------------------------------------------------
A0A5F9CRQ4_BCL2-02      --------------------------------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      --------------------------------------------------
I3MVK9_BCL2-01          --------------------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      --------------------------------------------------
A0A250YD83_BCL2-01      --------------------------------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-02      --------------------------------------------------
A0A2K5EB04_BCL2-01      --------------------------------------------------
A0A2K6UEL3_BCL2-01      --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K5HK49_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-04      --------------------------------------------------
A0A7I2V3S7_BCL2-10      --------------------------------------------------
A0A7I2V3S7_BCL2-05      --------------------------------------------------
A0A7I2V3S7_BCL2-08      --------------------------------------------------
A0A7N9CNB8_BCL2-01      --------------------------------------------------
A0A8D2EFR4_BCL2-01      --------------------------------------------------
A0A2K5XRD4_BCL2-01      --------------------------------------------------
A0A2K5NZS5_BCL2-01      --------------------------------------------------
A0A0D9S017_BCL2-01      --------------------------------------------------
A0A5F7ZZ15_BCL2-01      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A096MPU7_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------------------------------
A0A2K6KHG1_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2J8W3J1_BCL2-01      --------------------------------------------------
A0A8C9HUK6_BCL2-01      --------------------------------------------------
A0A2I3GZF9_BCL2-01      --------------------------------------------------
A0A7I2V3S7_BCL2-06      --------------------------------------------------
A0A7I2V3S7_BCL2-07      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------------------------------
A0A8B7H1C6_BCL2-01      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A2K6G3I7_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-02      --------------------------------------------------
A0A8C4L1K6_BCL2-01      --------------------------------------------------
A0A3Q2HRY3_BCL2-01      --------------------------------------------------
A0A673VDM8_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
A0A667GHH0_BCL2-01      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
G1LIC9_BCL2-01          --------------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------------------------------
A0A8I3MLT5_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-02      --------------------------------------------------
Q75SV7_BCL2-01          --------------------------------------------------
A0A8C0KWE3_BCL2-01      --------------------------------------------------
A0A8C0NC28_BCL2-01      --------------------------------------------------
A0A8I3MLT5_BCL2-01      --------------------------------------------------
A0A8C6AXM8_BCL2-01      --------------------------------------------------
A0A8C9CJ69_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-02      --------------------------------------------------
A0A8B8V3A7_BCL2-01      --------------------------------------------------
A0A8B8V3A7_BCL2-03      --------------------------------------------------
A0A8C3WCN0_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-03      --------------------------------------------------
A0A4X1TRR9_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-01      --------------------------------------------------
A0A4X1TRR9_BCL2-03      --------------------------------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------attagctatgacaatcgga-----
Q564A4_BCL2-01          --------------------------attagctatgacaatcgga-----
X4ZGI8_BCL2-01          --------------------------attcgctatgacaatcgga-----
A0A673HVU7_BCL2-01      --------------------------attcgctttgacaatcgga-----
A0A4W4F7Z4_BCL2-01      --------------------------aatctcgatcataatcgta-----
B9ZYL7_BCL2-01          --------------------------ggaggctatgatcaccggg-----
A0A8C5MT36_BCL2-03      --------------------------gcggggtacgaccaccggg-----
A0A8C5MT36_BCL2-01      --------------------------gcggggtacgaccaccggg-----
A0A8C5MT36_BCL2-02      --------------------------gcggggtacgaccaccggg-----
A0A8C5MT36_BCL2-04      --------------------------gcggggtacgaccaccggg-----
A0A7M4G2E0_BCL2-01      ---------------------------agactcacagcacccagaactcc
A0A7M4G2E0_BCL2-02      ---------------------------agactcacagcacccagaactcc
A0A673Z0A3_BCL2-01      --------------------------aatccttataacagtcgct-----
A0A8C7CHJ0_BCL2-01      --------------------------aatccttataacagtcgct-----
A0A8C7Q7B4_BCL2-01      --------------------------aatccttataacagtcgct-----
A0A0U3DHY6_BCL2-01      --------------------------aatccttatgacagtcgct-----
A0A4W5NW18_BCL2-01      --------------------------aatccttatgacagtcgct-----
A0A674B8T7_BCL2-01      --------------------------aatccttacaacagtcgct-----
A0A8C7RG50_BCL2-01      --------------------------aatccttataacagtcgct-----
A0A8C8GL24_BCL2-01      --------------------------aatccttataacagtcgct-----
A0A6Q2YIU6_BCL2-01      -----------------------------------gataaccgtt-----
A0A4W5KV00_BCL2-01      -----------------------------------gacaaccgct-----
A0A8C7G8X1_BCL2-01      -----------------------------------gacaaccgct-----
A0A674B0E5_BCL2-01      -----------------------------------gacaaccgct-----
A0A8C8JWJ1_BCL2-02      -----------------------------------gacaaccgct-----
A0A8C7N3I9_BCL2-01      -----------------------------------gacaaccgct-----
A0A8C8JWJ1_BCL2-01      -----------------------------------gacaaccgct-----
A0A8C5C4C3_BCL2-01      -----------------------------------tgcaaccgcg-----
A0A3B4A3G8_BCL2-01      -----------------------------------tgcaatcgca-----
A0A3Q3B0R2_BCL2-01      --------------------------------------aatcgct-----
A0A8C7ZK61_BCL2-01      -----------------------------------tctaatcgca-----
A0A3P8WUE9_BCL2-01      -----------------------------------tgtaaccgct-----
A0A665U7Y7_BCL2-01      -----------------------------------tggaaccgca-----
A0A672HHE5_BCL2-01      -----------------------------------cgcaatcgca-----
A0A3Q3G1D7_BCL2-01      -----------------------------------tgtaatcgca-----
A0A8C2X310_BCL2-06      -----------------------------------tgcaatcgca-----
A0A3Q3MEY1_BCL2-01      -----------------------------------tgtaatcgca-----
A0A2U9BJ09_BCL2-01      -----------------------------------tgtaatcgca-----
A0A8C9ZFJ5_BCL2-09      -----------------------------------tgtaatcgca-----
A0A7N6A4C8_BCL2-01      -----------------------------------tgtaatcgca-----
A0A3Q0S5Z7_BCL2-01      -----------------------------------tataatcgca-----
A0A668TEB6_BCL2-05      -----------------------------------tataatcgca-----
A0A3P8QVM8_BCL2-01      -----------------------------------tataatcgca-----
A0A3P9DIG5_BCL2-01      -----------------------------------tataatcgca-----
A0A3Q2UYW8_BCL2-01      -----------------------------------tataatcgca-----
A0A3B4G3K4_BCL2-01      -----------------------------------tataatcgca-----
A0A4W6DDI0_BCL2-01      -----------------------------------tgtaatcgca-----
A0A1X9JZA1_BCL2-01      -----------------------------------tgtaatcgca-----
A0A3B4TX71_BCL2-01      -----------------------------------tataatcgca-----
A0A3B4YAG2_BCL2-01      -----------------------------------tataatcgca-----
A0A3B5BBQ0_BCL2-01      -----------------------------------tgtaatcgca-----
A0A3Q1B8C3_BCL2-01      -----------------------------------tgtaatcgca-----
A0A3P8S9L3_BCL2-01      -----------------------------------tgtaatcgca-----
A0A3Q1FLK7_BCL2-01      -----------------------------------tgtaatcgca-----
A0A673LV42_BCL2-01      --------------------------aatgtgtatgataaccgga-----
A0A8C1IQE4_BCL2-01      --------------------------aatgtgtatgataaccgca-----
A0A672T179_BCL2-01      --------------------------aatgtgtatgataaccgca-----
A0A3B3TCS4_BCL2-01      --------------------------gtcccatacgacagccgaa-----
A0A8C9T5U7_BCL2-01      --------------------------ggcgcgtacgacagccggg-----
W5N4F7_BCL2-01          --------------------------gccccgtacgatactcgga-----
H9GPE7_BCL2-01          --------------------------agaggttacgacaacaggg-----
A0A8D2Q1J0_BCL2-01      --------------------------ccacgtcgtggtaactggt-----
A0A8D2Q1J0_BCL2-03      --------------------------ccacgtcgtggtaactggt-----
A0A668TEB6_BCL2-01      --------------------------ccacgtcgtggtgacagga-----
A0A668TEB6_BCL2-04      --------------------------ccacgtcgtggtgacagga-----
A0A668TEB6_BCL2-02      --------------------------ccacgtcgtggtgacagga-----
A0A668TEB6_BCL2-03      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-02      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-10      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-08      -------------------------------ttcaggtgacagga-----
A0A3Q3MEY1_BCL2-04      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-05      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-07      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-09      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-03      --------------------------ccacgtcgtggtgacagga-----
A0A3Q3MEY1_BCL2-06      --------------------------ccacgtcgtggtgacagga-----
A0A7N6A4C8_BCL2-02      --------------------------ccacgtcgtggtgacggga-----
A0A7N6A4C8_BCL2-04      --------------------------ccacgtcgtggtgacggga-----
A0A7N6A4C8_BCL2-07      --------------------------ccacgtcgtggtgacggga-----
A0A7N6A4C8_BCL2-05      --------------------------ccacgtcgtggtgacggga-----
A0A7N6A4C8_BCL2-03      --------------------------ccacgtcgtggtgacggga-----
A0A7N6A4C8_BCL2-06      --------------------------ccacgtcgtggtgacggga-----
A0A8C2X310_BCL2-01      --------------------------ccacgtcgtggtgactggg-----
A0A8C2X310_BCL2-02      --------------------------ccacgtcgtggtgactggg-----
A0A8C2X310_BCL2-04      --------------------------ccacgtcgtggtgactggg-----
A0A8C2X310_BCL2-05      --------------------------ccacgtcgtggtgactggg-----
A0A8C2X310_BCL2-03      --------------------------ccacgtcgtggtgactggg-----
A0A8C9ZFJ5_BCL2-01      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-05      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-06      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-02      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-03      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-04      --------------------------ccacgtcgtggtgacagga-----
A0A8C9ZFJ5_BCL2-07      -------------------------------tcatagtgacagga-----
A0A8C9ZFJ5_BCL2-08      ------------------------------------gtgacagga-----
A0A674GNG3_BCL2-02      --------------------------gcacgtcgtggtaactgga-----
A0A674GNG3_BCL2-04      --------------------------gcacgtcgtggtaactgga-----
A0A8C5IH35_BCL2-01      --------------------------gcacgtcgtggtaactgga-----
A0A8C5IH35_BCL2-02      --------------------------gcacgtcgtggtaactgga-----
A0A670IB81_BCL2-01      --------------------------agaggttacgacacaagag-----
A0A8D0BPX3_BCL2-01      --------------------------agaggttacgataacaggg-----
A0A8D2Q1J0_BCL2-02      --------------------------agagcttatgataataggg-----
A0A8C5S4J3_BCL2-01      --------------------------agagattacagtaaccggg-----
A0A670ZV01_BCL2-01      --------------------------agagattacagtaaccggg-----
A0A8D0L5Z6_BCL2-01      --------------------------agaagctatgataacaggg-----
A0A7M4EPU7_BCL2-01      --------------------------acaggctatcataaccggg-----
A0A7M4G2E0_BCL2-03      --------------------------agaggctatgataaccggg-----
A0A8C8SWU7_BCL2-01      --------------------------agaggctatgataaccggg-----
K7F5Y3_BCL2-02          --------------------------agaggctatgataaccggg-----
K7F5Y3_BCL2-01          --------------------------agaggctatgataaccggg-----
K7F5Y3_BCL2-03          --------------------------agaggctatgataaccggg-----
A0A452I9V7_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A8C3SV21_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A8C3ITE1_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A674IMR0_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A8C0G2Q6_BCL2-01      --------------------------agaggctatgataaccgag-----
A0A8C4VT25_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A7N4PQN7_BCL2-01      --------------------------agaggatatgataaccggg-----
F6YNL8_BCL2-01          --------------------------agaggatatgataaccggg-----
A0A4X2L5Q0_BCL2-01      --------------------------agagggtacgataatcggg-----
A0A8C2U1A2_BCL2-01      --------------------------agaggctacgacaaccgcg-----
A0A8C9L7I6_BCL2-01      --------------------------agaggctacgacaaccgcg-----
G1MZW1_BCL2-01          --------------------------agaggctacgacaaccgcg-----
A0A8C3LBC4_BCL2-01      --------------------------agaggctatgacaaccgcg-----
A0A669PDH6_BCL2-01      --------------------------agaggctacgacaaccgcg-----
A0A8C9MG30_BCL2-01      ggcggcactgcctcagtcacaagcacagaggctacgataaccggg-----
A0A663MPN9_BCL2-01      --------------------------aga---------------------
A0A8C6ZF48_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9PRT7_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9PRT7_BCL2-02      --------------------------agaggctacgataaccggg-----
A0A8C0UAC7_BCL2-01      --------------------------agaggctatgataaccggg-----
A0A8B9UYC3_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9E2U6_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9C4H4_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C3CIW8_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A493T1X3_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9SFH3_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8D2P664_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A674GNG3_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A674GNG3_BCL2-03      --------------------------agaggctacgataaccggg-----
A0A8C5TLV4_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A672TR23_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C3JHE5_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C0BN28_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8B9RWH9_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A663FHR0_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C8ANG9_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C0IE77_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8D0G0L7_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C4U538_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C4U538_BCL2-02      --------------------------agaggctacgataaccggg-----
A0A8C3TNF2_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8C3QX54_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A803VR88_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A803VR88_BCL2-02      --------------------------agaggctacgataaccggg-----
A0A8C5IH35_BCL2-05      --------------------------agaggctacgataaccggg-----
A0A8C5IH35_BCL2-04      --------------------------agaggctacgataaccggg-----
A0A8C5IH35_BCL2-03      --------------------------agaggctacgataaccggg-----
A0A8D2N8C6_BCL2-01      --------------------------agaggctacgataaccggg-----
A0A8D0QLD9_BCL2-07      --------------------------tcatgtggtggttactgga-----
A0A4X1TRR9_BCL2-06      --------------------------tcatgtggtggttactgga-----
A0A8D0QLD9_BCL2-05      --------------------------tcatgtggtggttactgga-----
A0A4X1TRR9_BCL2-05      --------------------------tcatgtggtggttactgga-----
A0A8D0QLD9_BCL2-04      --------------------------tcatgtggtggttactgga-----
A0A4X1TRR9_BCL2-07      --------------------------tcatgtggtggttactgga-----
A0A8D0QLD9_BCL2-06      --------------------------tcatgtggtggttactgga-----
A0A4X1TRR9_BCL2-04      --------------------------tcatgtggtggttactgga-----
A0A4X1TRR9_BCL2-02      --------------------------tcatgtggtggttactgga-----
A0A8D0QLD9_BCL2-02      --------------------------tcatgtggtggttactgga-----
A0A8C6RID6_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C6RID6_BCL2-02      --------------------------acagggtatgataaccggg-----
Q6R755_BCL2-01          --------------------------acagggtatgataaccggg-----
Q923R6_BCL2-01          --------------------------acagggtatgataaccgag-----
A0A8C8U7I9_BCL2-01      --------------------------acagggtatgataaccggg-----
Q6NTH7_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A8C6H5J8_BCL2-01      --------------------------acagggtatgataaccggg-----
Q7TSN8_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A8I6AJ02_BCL2-01      --------------------------acagggtatgataaccggg-----
P49950_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A4W2DSR6_BCL2-02      --------------------------acaggctacgataaccgag-----
A0A4W2DSR6_BCL2-02      --------------------------acaggctacgataaccgag-----
A0A8C6CUJ2_BCL2-01      --------------------------acaggctacgataaccgcg-----
A0A4W2DSR6_BCL2-01      --------------------------acaggctacgataaccgag-----
A0A4W2DSR6_BCL2-01      --------------------------acaggctacgataaccgag-----
F6R2C4_BCL2-01          --------------------------acaggctacgataaccgag-----
O02718_BCL2-01          --------------------------acaggctacgataaccgag-----
A0A076FU27_BCL2-01      --------------------------acaggctacgataaccgcg-----
A0A076FZV9_BCL2-01      --------------------------acaggctacgataaccgcg-----
A0A452EV13_BCL2-01      --------------------------acaggctacgataaccgcg-----
A0A8C5JYS0_BCL2-01      --------------------------accgggtacgataaccggg-----
G3SLZ1_BCL2-01          --------------------------acaggttatgacaaccggg-----
G3SLZ1_BCL2-02          --------------------------acaggttatgacaaccggg-----
H0W1T3_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A5F9CRQ4_BCL2-01      --------------------------acagggtacgacaaccggg-----
A0A5F9CRQ4_BCL2-02      --------------------------acagggtacgacaaccggg-----
M3YYK3_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A8D2AUF5_BCL2-01      --------------------------acagggtatgataaccggg-----
I3MVK9_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A8C5YTS1_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8D2IIB8_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A250YD83_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A452T603_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C2VKS3_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C9HUK6_BCL2-02      --------------------------acagggtacgataaccggg-----
A0A2K5EB04_BCL2-01      --------------------------acagggtacgataaccgag-----
A0A2K6UEL3_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2R8MY14_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2K6R2I5_BCL2-02      --------------------------acagggtacgataaccggg-----
A0A2K5HK49_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-04      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-10      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-05      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-08      --------------------------acagggtacgataaccggg-----
A0A7N9CNB8_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A8D2EFR4_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2K5XRD4_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2K5NZS5_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A0D9S017_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A5F7ZZ15_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2K6CIX3_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A096MPU7_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------------acggggtacgataaccggg-----
A0A2K6KHG1_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2K6R2I5_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2J8W3J1_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A8C9HUK6_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A2I3GZF9_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-06      --------------------------acagggtacgataaccggg-----
A0A7I2V3S7_BCL2-07      --------------------------acagggtacgataaccggg-----
A0A2R9APW6_BCL2-01      --------------------------acagggtacgataaccggg-----
G3QES9_BCL2-01          --------------------------acagggtacgataaccgag-----
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A8B7H1C6_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C9AC52_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A2K6G3I7_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A3Q2HRY3_BCL2-02      --------------------------acagggtatgataaccggg-----
A0A8C4L1K6_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A3Q2HRY3_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A673VDM8_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A5F5Y6Y3_BCL2-02      --------------------------acagggtatgataaccggg-----
A0A8C9J3W6_BCL2-01      --------------------------acagggtatgacaaccggg-----
Q8I008_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A667GHH0_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A5F5Y6Y3_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C8XJU8_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C7B9K2_BCL2-01      --------------------------acagggtatgataaccggg-----
G1LIC9_BCL2-01          --------------------------acagggtatgataaccggg-----
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------------acagggtacgataaccggg-----
A0A8I3MLT5_BCL2-02      --------------------------acagggtacgataaccggg-----
A0A8C0NC28_BCL2-02      --------------------------acagggtacgataaccggg-----
Q75SV7_BCL2-01          --------------------------acagggtacgataaccggg-----
A0A8C0KWE3_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A8C0NC28_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A8I3MLT5_BCL2-01      --------------------------acagggtacgataaccggg-----
A0A8C6AXM8_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8C9CJ69_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8B8V3A7_BCL2-02      --------------------------acagggtatgataaccggg-----
A0A8B8V3A7_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8B8V3A7_BCL2-03      --------------------------acagggtatgataaccggg-----
A0A8C3WCN0_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8D0QLD9_BCL2-03      --------------------------acagggtatgataaccggg-----
A0A4X1TRR9_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A8D0QLD9_BCL2-01      --------------------------acagggtatgataaccggg-----
A0A4X1TRR9_BCL2-03      --------------------------acagggtatgataaccggg-----
                                                                          

A3KNH9_BCL2-01          --------------------atat-------tgtggagaaatacct--ca
Q564A4_BCL2-01          --------------------atat-------tgtggagaaatacct--ca
X4ZGI8_BCL2-01          --------------------atat-------tgtggagaaatacct--ca
A0A673HVU7_BCL2-01      --------------------atat-------tgtggagaaatacat--ca
A0A4W4F7Z4_BCL2-01      --------------------acat-------agtagaaaagtatct--ca
B9ZYL7_BCL2-01          --------------------acat-------agtggtaaaatatat--cc
A0A8C5MT36_BCL2-03      --------------------acat-------agtggtaaaatatat--tc
A0A8C5MT36_BCL2-01      --------------------acat-------agtggtaaaatatat--tc
A0A8C5MT36_BCL2-02      --------------------acat-------agtggtaaaatatat--tc
A0A8C5MT36_BCL2-04      --------------------acat-------agtggtaaaatatat--tc
A0A7M4G2E0_BCL2-01      agaccttccagactttgttcagat-------ccttataaaaaaaac--gc
A0A7M4G2E0_BCL2-02      agaccttccagactttgttcagat-------ccttataaaaaaaac--gc
A0A673Z0A3_BCL2-01      --------------------ttat-------tgttgaaaaatacat--cc
A0A8C7CHJ0_BCL2-01      --------------------ttat-------tgttgaaaaatacat--ac
A0A8C7Q7B4_BCL2-01      --------------------ttat-------tgttgaaaaatacat--ac
A0A0U3DHY6_BCL2-01      --------------------ttat-------tgtcgaaaaatacat--cc
A0A4W5NW18_BCL2-01      --------------------ttat-------tgtcgaaaaatacat--cc
A0A674B8T7_BCL2-01      --------------------ttat-------tgtcgaaaaatacat--cc
A0A8C7RG50_BCL2-01      --------------------ttat-------tgtcgaaaaatacat--cc
A0A8C8GL24_BCL2-01      --------------------ttat-------tgtcgaaaaatacat--cc
A0A6Q2YIU6_BCL2-01      --------------------ttat-------agtggaaaagtacat--tt
A0A4W5KV00_BCL2-01      --------------------ttat-------agtggaaaagtacat--tt
A0A8C7G8X1_BCL2-01      --------------------ttat-------agtggaaaagtacat--tt
A0A674B0E5_BCL2-01      --------------------ttat-------agtggaaaagtacat--tt
A0A8C8JWJ1_BCL2-02      --------------------gtat-------agtggaaaagtacat--tt
A0A8C7N3I9_BCL2-01      --------------------gtat-------agtggaaaagtacat--tt
A0A8C8JWJ1_BCL2-01      --------------------gtat-------agtggaaaagtacat--tt
A0A8C5C4C3_BCL2-01      --------------------atat-------cgtgcaaaagtacat--tt
A0A3B4A3G8_BCL2-01      --------------------atat-------tgtggaaaagtacat--tt
A0A3Q3B0R2_BCL2-01      --------------------tcat-------tgtggaaaactatat--tt
A0A8C7ZK61_BCL2-01      --------------------gtat-------tgtagaaaagtacat--tt
A0A3P8WUE9_BCL2-01      --------------------atat-------agtggaaaagtacat--ct
A0A665U7Y7_BCL2-01      --------------------atat-------tgtggaaaattattt--ac
A0A672HHE5_BCL2-01      --------------------atat-------cgtagtgaagtatat--ct
A0A3Q3G1D7_BCL2-01      --------------------acat-------tgtggaaaagtatat--ct
A0A8C2X310_BCL2-06      --------------------acat-------tgtggaaaagtacat--ct
A0A3Q3MEY1_BCL2-01      --------------------acat-------tgtggaaaagtatat--ct
A0A2U9BJ09_BCL2-01      --------------------atat-------tgtggaaaagtacat--ct
A0A8C9ZFJ5_BCL2-09      --------------------acat-------tgtggaaaagtacat--ct
A0A7N6A4C8_BCL2-01      --------------------atat-------tgtagaaaagtatat--ct
A0A3Q0S5Z7_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A668TEB6_BCL2-05      --------------------atat-------tgtggaaaagtatat--ct
A0A3P8QVM8_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A3P9DIG5_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A3Q2UYW8_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A3B4G3K4_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A4W6DDI0_BCL2-01      --------------------atat-------cgtggaaaagtatat--ct
A0A1X9JZA1_BCL2-01      --------------------acat-------tgtggaaaagtatat--ct
A0A3B4TX71_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A3B4YAG2_BCL2-01      --------------------atat-------tgtggaaaagtacat--ct
A0A3B5BBQ0_BCL2-01      --------------------atat-------tgtggaaaagtatat--ct
A0A3Q1B8C3_BCL2-01      --------------------atat-------tgtagaaaagtatat--ct
A0A3P8S9L3_BCL2-01      --------------------atat-------tgtagaaaagtatat--ct
A0A3Q1FLK7_BCL2-01      --------------------atat-------tgtagaaaagtacat--ct
A0A673LV42_BCL2-01      --------------------gcat-------agtggtgaagtacat--cc
A0A8C1IQE4_BCL2-01      --------------------gtat-------agtggagaagtacat--cc
A0A672T179_BCL2-01      --------------------gtct-------agtggtgaagtacat--cc
A0A3B3TCS4_BCL2-01      --------------------atat-------tgtagagatctatat--at
A0A8C9T5U7_BCL2-01      --------------------acat-------cgtggaagtgtacct--gt
W5N4F7_BCL2-01          --------------------atat-------cgtgacaaaatacat--cc
H9GPE7_BCL2-01          --------------------aaat-------cgtgctgaggtacat--cc
A0A8D2Q1J0_BCL2-01      --------------------ggctccagtggcattgggaaaagcattgct
A0A8D2Q1J0_BCL2-03      --------------------ggctccagtggcattgggaaaagcattgct
A0A668TEB6_BCL2-01      --------------------ggatccagtgggattgggaaatgcattgct
A0A668TEB6_BCL2-04      --------------------ggatccagtgggattgggaaatgcattgct
A0A668TEB6_BCL2-02      --------------------ggatccagtgggattgggaaatgcattgct
A0A668TEB6_BCL2-03      --------------------ggatccagtgggattgggaaatgcattgct
A0A3Q3MEY1_BCL2-02      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-10      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-08      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-04      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-05      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-07      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-09      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-03      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A3Q3MEY1_BCL2-06      --------------------ggctcaagtggaattgggaagtgcatcgcg
A0A7N6A4C8_BCL2-02      --------------------ggctctagtgggattgggaagtgcattgca
A0A7N6A4C8_BCL2-04      --------------------ggctctagtgggattgggaagtgcattgca
A0A7N6A4C8_BCL2-07      --------------------ggctctagtgggattgggaagtgcattgca
A0A7N6A4C8_BCL2-05      --------------------ggctctagtgggattgggaagtgcattgca
A0A7N6A4C8_BCL2-03      --------------------ggctctagtgggattgggaagtgcattgca
A0A7N6A4C8_BCL2-06      --------------------ggctctagtgggattgggaagtgcattgca
A0A8C2X310_BCL2-01      --------------------ggctcaagtgggatcgggaaatgcattgca
A0A8C2X310_BCL2-02      --------------------ggctcaagtgggatcgggaaatgcattgca
A0A8C2X310_BCL2-04      --------------------ggctcaagtgggatcgggaaatgcattgca
A0A8C2X310_BCL2-05      --------------------ggctcaagtgggatcgggaaatgcattgca
A0A8C2X310_BCL2-03      --------------------ggctcaagtgggatcgggaaatgcattgca
A0A8C9ZFJ5_BCL2-01      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-05      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-06      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-02      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-03      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-04      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-07      --------------------ggctcaagtgggattgggaaatccattgca
A0A8C9ZFJ5_BCL2-08      --------------------ggctcaagtgggattgggaaatccattgca
A0A674GNG3_BCL2-02      --------------------ggctccagtggaattggaaaatgtattgct
A0A674GNG3_BCL2-04      --------------------ggctccagtggaattggaaaatgtattgct
A0A8C5IH35_BCL2-01      --------------------ggctccagtggaattggaaaatgcattgct
A0A8C5IH35_BCL2-02      --------------------ggctccagtggaattggaaaatgcattgct
A0A670IB81_BCL2-01      --------------------agat-------agtgcagacgtacat--cc
A0A8D0BPX3_BCL2-01      --------------------agat-------agtgctaaggtacat--cc
A0A8D2Q1J0_BCL2-02      --------------------agat-------tgtgctgaggtacat--cc
A0A8C5S4J3_BCL2-01      --------------------agat-------agtgctgaggtacat--cc
A0A670ZV01_BCL2-01      --------------------agat-------agtgctgaggtacat--cc
A0A8D0L5Z6_BCL2-01      --------------------agat-------agtgctgaggtacat--cc
A0A7M4EPU7_BCL2-01      --------------------agat-------agtgctaaagtacat--cc
A0A7M4G2E0_BCL2-03      --------------------agat-------agtgctgaagtacat--cc
A0A8C8SWU7_BCL2-01      --------------------agat-------agtgcagaaatacat--cc
K7F5Y3_BCL2-02          --------------------agat-------agtgttgaagtacat--cc
K7F5Y3_BCL2-01          --------------------agat-------agtgttgaagtacat--cc
K7F5Y3_BCL2-03          --------------------agat-------agtgttgaagtacat--cc
A0A452I9V7_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C3SV21_BCL2-01      --------------------agat-------agtgctgaattacat--cc
A0A8C3ITE1_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A674IMR0_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C0G2Q6_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C4VT25_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A7N4PQN7_BCL2-01      --------------------aaat-------agtgatgaaatacat--tc
F6YNL8_BCL2-01          --------------------agat-------agtgatgaaatacat--tc
A0A4X2L5Q0_BCL2-01      --------------------agat-------agtgatgaagtacat--tc
A0A8C2U1A2_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C9L7I6_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
G1MZW1_BCL2-01          --------------------agat-------agtgctgaagtacat--cc
A0A8C3LBC4_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A669PDH6_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C9MG30_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A663MPN9_BCL2-01      ----------------------at-------ataacggcagtgatt--tt
A0A8C6ZF48_BCL2-01      --------------------agat-------agtgctcaagtacat--cc
A0A8B9PRT7_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9PRT7_BCL2-02      --------------------agat-------agtgctgaagtacat--cc
A0A8C0UAC7_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9UYC3_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9E2U6_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9C4H4_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C3CIW8_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A493T1X3_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9SFH3_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8D2P664_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A674GNG3_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A674GNG3_BCL2-03      --------------------agat-------agtgctgaagtacat--cc
A0A8C5TLV4_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A672TR23_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C3JHE5_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C0BN28_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8B9RWH9_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A663FHR0_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C8ANG9_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C0IE77_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8D0G0L7_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C4U538_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C4U538_BCL2-02      --------------------agat-------agtgctgaagtacat--cc
A0A8C3TNF2_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8C3QX54_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A803VR88_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A803VR88_BCL2-02      --------------------agat-------agtgctgaagtacat--cc
A0A8C5IH35_BCL2-05      --------------------agat-------agtgctgaagtacat--cc
A0A8C5IH35_BCL2-04      --------------------agat-------agtgctgaagtacat--cc
A0A8C5IH35_BCL2-03      --------------------agat-------agtgctgaagtacat--cc
A0A8D2N8C6_BCL2-01      --------------------agat-------agtgctgaagtacat--cc
A0A8D0QLD9_BCL2-07      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A4X1TRR9_BCL2-06      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A8D0QLD9_BCL2-05      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A4X1TRR9_BCL2-05      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A8D0QLD9_BCL2-04      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A4X1TRR9_BCL2-07      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A8D0QLD9_BCL2-06      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A4X1TRR9_BCL2-04      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A4X1TRR9_BCL2-02      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A8D0QLD9_BCL2-02      --------------------ggctccagcggcatcggaaagtgcattgcc
A0A8C6RID6_BCL2-01      --------------------agat-------tgtgatgaagtacat--cc
A0A8C6RID6_BCL2-02      --------------------agat-------tgtgatgaagtacat--cc
Q6R755_BCL2-01          --------------------agat-------cgtgatgaagtacat--ac
Q923R6_BCL2-01          --------------------agat-------cgtgatgaagtacat--cc
A0A8C8U7I9_BCL2-01      --------------------agat-------cgtcatgaagtacat--cc
Q6NTH7_BCL2-01          --------------------agat-------cgtgatgaagtacat--ac
A0A8C6H5J8_BCL2-01      --------------------agat-------cgtgatgaagtacat--ac
Q7TSN8_BCL2-01          --------------------agat-------cgtgatgaagtacat--ac
A0A8I6AJ02_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
P49950_BCL2-01          --------------------agat-------cgtgatgaagtacat--cc
A0A4W2DSR6_BCL2-02      --------------------agat-------cgtgatgaagtacat--cc
A0A4W2DSR6_BCL2-02      --------------------agat-------cgtgatgaagtacat--cc
A0A8C6CUJ2_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A4W2DSR6_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A4W2DSR6_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
F6R2C4_BCL2-01          --------------------agat-------cgtgatgaagtacat--cc
O02718_BCL2-01          --------------------agat-------cgtgatgaagtacat--cc
A0A076FU27_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A076FZV9_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A452EV13_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A8C5JYS0_BCL2-01      --------------------aaat-------cgtgaggaactacat--cc
G3SLZ1_BCL2-01          --------------------agat-------agtgatgaagtatat--cc
G3SLZ1_BCL2-02          --------------------agat-------agtgatgaagtatat--cc
H0W1T3_BCL2-01          --------------------aaat-------agtgatgaagtacat--cc
A0A5F9CRQ4_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A5F9CRQ4_BCL2-02      --------------------agat-------cgtgatgaagtacat--cc
M3YYK3_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A8D2AUF5_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
I3MVK9_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A8C5YTS1_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8D2IIB8_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A250YD83_BCL2-01      --------------------agat-------agtgatgaaatacat--cc
A0A452T603_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C2VKS3_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C9HUK6_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
A0A2K5EB04_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K6UEL3_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2R8MY14_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K6R2I5_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
A0A2K5HK49_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-04      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-10      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-05      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-08      --------------------agat-------agtgatgaagtacat--cc
A0A7N9CNB8_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8D2EFR4_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K5XRD4_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K5NZS5_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A0D9S017_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A5F7ZZ15_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K6CIX3_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A096MPU7_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A2K6KHG1_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K6R2I5_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2J8W3J1_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C9HUK6_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2I3GZF9_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-06      --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-07      --------------------agat-------agtgatgaagtacat--cc
A0A2R9APW6_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
G3QES9_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A8B7H1C6_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C9AC52_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A2K6G3I7_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A3Q2HRY3_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
A0A8C4L1K6_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A3Q2HRY3_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A673VDM8_BCL2-01      --------------------agat-------cgtgatgaagtacat--cc
A0A5F5Y6Y3_BCL2-02      --------------------agat-------agtcatgaagtacat--cc
A0A8C9J3W6_BCL2-01      --------------------agat-------agtcatgaagtacat--cc
Q8I008_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A667GHH0_BCL2-01      --------------------agat-------agtcatgaagtacat--cc
A0A5F5Y6Y3_BCL2-01      --------------------agat-------agtcatgaagtacat--cc
A0A8C8XJU8_BCL2-01      --------------------agat-------agtcatgaagtacat--cc
A0A8C7B9K2_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
G1LIC9_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --------------------agat-------agtgatgaagtacat--cc
A0A8I3MLT5_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
A0A8C0NC28_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
Q75SV7_BCL2-01          --------------------agat-------agtgatgaagtacat--cc
A0A8C0KWE3_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C0NC28_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8I3MLT5_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C6AXM8_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8C9CJ69_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8B8V3A7_BCL2-02      --------------------agat-------agtgatgaagtacat--cc
A0A8B8V3A7_BCL2-01      --------------------agat-------agtgatgaagtacat--cc
A0A8B8V3A7_BCL2-03      --------------------agat-------agtgatgaagtacat--cc
A0A8C3WCN0_BCL2-01      --------------------aaat-------agtgatgaagtacat--cc
A0A8D0QLD9_BCL2-03      --------------------aaat-------agtgatgaagtacat--cc
A0A4X1TRR9_BCL2-01      --------------------aaat-------agtgatgaagtacat--cc
A0A8D0QLD9_BCL2-01      --------------------aaat-------agtgatgaagtacat--cc
A0A4X1TRR9_BCL2-03      --------------------aaat-------agtgatgaagtacat--cc
                                                                          

A3KNH9_BCL2-01          agc-----------------------------------------------
Q564A4_BCL2-01          agc-----------------------------------------------
X4ZGI8_BCL2-01          atc-----------------------------------------------
A0A673HVU7_BCL2-01      atc-----------------------------------------------
A0A4W4F7Z4_BCL2-01      acc-----------------------------------------------
B9ZYL7_BCL2-01          att-----------------------------------------------
A0A8C5MT36_BCL2-03      att-----------------------------------------------
A0A8C5MT36_BCL2-01      att-----------------------------------------------
A0A8C5MT36_BCL2-02      att-----------------------------------------------
A0A8C5MT36_BCL2-04      att-----------------------------------------------
A0A7M4G2E0_BCL2-01      agtatcaactcatggctacgtcagctcttctcctcacttttatcctccca
A0A7M4G2E0_BCL2-02      agtatcaactcatggctacgtcagctcttctcctcacttttatcctccca
A0A673Z0A3_BCL2-01      atc-----------------------------------------------
A0A8C7CHJ0_BCL2-01      atc-----------------------------------------------
A0A8C7Q7B4_BCL2-01      atc-----------------------------------------------
A0A0U3DHY6_BCL2-01      ata-----------------------------------------------
A0A4W5NW18_BCL2-01      atc-----------------------------------------------
A0A674B8T7_BCL2-01      atc-----------------------------------------------
A0A8C7RG50_BCL2-01      atc-----------------------------------------------
A0A8C8GL24_BCL2-01      atc-----------------------------------------------
A0A6Q2YIU6_BCL2-01      gtc-----------------------------------------------
A0A4W5KV00_BCL2-01      gtc-----------------------------------------------
A0A8C7G8X1_BCL2-01      gtc-----------------------------------------------
A0A674B0E5_BCL2-01      gtc-----------------------------------------------
A0A8C8JWJ1_BCL2-02      gtc-----------------------------------------------
A0A8C7N3I9_BCL2-01      gtc-----------------------------------------------
A0A8C8JWJ1_BCL2-01      gtc-----------------------------------------------
A0A8C5C4C3_BCL2-01      tcc-----------------------------------------------
A0A3B4A3G8_BCL2-01      gcc-----------------------------------------------
A0A3Q3B0R2_BCL2-01      gcc-----------------------------------------------
A0A8C7ZK61_BCL2-01      gcc-----------------------------------------------
A0A3P8WUE9_BCL2-01      gcc-----------------------------------------------
A0A665U7Y7_BCL2-01      gct-----------------------------------------------
A0A672HHE5_BCL2-01      gcc-----------------------------------------------
A0A3Q3G1D7_BCL2-01      gtc-----------------------------------------------
A0A8C2X310_BCL2-06      gcc-----------------------------------------------
A0A3Q3MEY1_BCL2-01      gcc-----------------------------------------------
A0A2U9BJ09_BCL2-01      gcc-----------------------------------------------
A0A8C9ZFJ5_BCL2-09      gcc-----------------------------------------------
A0A7N6A4C8_BCL2-01      gcc-----------------------------------------------
A0A3Q0S5Z7_BCL2-01      gcc-----------------------------------------------
A0A668TEB6_BCL2-05      gcc-----------------------------------------------
A0A3P8QVM8_BCL2-01      gcc-----------------------------------------------
A0A3P9DIG5_BCL2-01      gcc-----------------------------------------------
A0A3Q2UYW8_BCL2-01      gcc-----------------------------------------------
A0A3B4G3K4_BCL2-01      gcc-----------------------------------------------
A0A4W6DDI0_BCL2-01      gcc-----------------------------------------------
A0A1X9JZA1_BCL2-01      gcc-----------------------------------------------
A0A3B4TX71_BCL2-01      gcc-----------------------------------------------
A0A3B4YAG2_BCL2-01      gcc-----------------------------------------------
A0A3B5BBQ0_BCL2-01      gcc-----------------------------------------------
A0A3Q1B8C3_BCL2-01      gcc-----------------------------------------------
A0A3P8S9L3_BCL2-01      gcc-----------------------------------------------
A0A3Q1FLK7_BCL2-01      gcc-----------------------------------------------
A0A673LV42_BCL2-01      acc-----------------------------------------------
A0A8C1IQE4_BCL2-01      acc-----------------------------------------------
A0A672T179_BCL2-01      acc-----------------------------------------------
A0A3B3TCS4_BCL2-01      acc-----------------------------------------------
A0A8C9T5U7_BCL2-01      acc-----------------------------------------------
W5N4F7_BCL2-01          atc-----------------------------------------------
H9GPE7_BCL2-01          att-----------------------------------------------
A0A8D2Q1J0_BCL2-01      atcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatga
A0A8D2Q1J0_BCL2-03      atcgaatgttttaaacaaggtgctttcataacgataattgcaaggaatga
A0A668TEB6_BCL2-01      attgagtgctacaagcaaggagcgttcatcactttggtggcacgagacga
A0A668TEB6_BCL2-04      attgagtgctacaagcaaggagcgttcatcactttggtggcacgagacg-
A0A668TEB6_BCL2-02      attgagtgctacaagcaaggagcgttcatcactttggtggcacgagacga
A0A668TEB6_BCL2-03      attgagtgctacaagcaaggagcgttcatcactttggtggcacgagacga
A0A3Q3MEY1_BCL2-02      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-10      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-08      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-04      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-05      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-07      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-09      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-03      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A3Q3MEY1_BCL2-06      atcgagtgctacaggcaaggagcgttcatcactctggtggcacgagatga
A0A7N6A4C8_BCL2-02      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatga
A0A7N6A4C8_BCL2-04      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatga
A0A7N6A4C8_BCL2-07      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatg-
A0A7N6A4C8_BCL2-05      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatga
A0A7N6A4C8_BCL2-03      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatga
A0A7N6A4C8_BCL2-06      attgaatgctacagacaaggagcattcatcactttagtggcacgaaatga
A0A8C2X310_BCL2-01      attgagtgctacaggcaaggagcattcatcactttggtggcacgggatga
A0A8C2X310_BCL2-02      attgagtgctacaggcaaggagcattcatcactttggtggcacgggatga
A0A8C2X310_BCL2-04      attgagtgctacaggcaaggagcattcatcactttggtggcacgggatga
A0A8C2X310_BCL2-05      attgagtgctacaggcaaggagcattcatcactttggtggcacgggatga
A0A8C2X310_BCL2-03      attgagtgctacaggcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-01      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-05      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-06      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-02      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-03      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-04      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-07      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A8C9ZFJ5_BCL2-08      gttgagtgctacaagcaaggagcattcatcactttggtggcacgggatga
A0A674GNG3_BCL2-02      attgaatgctataagcaaggtgctttcataacactgattgcaagggatga
A0A674GNG3_BCL2-04      attgaatgctataagcaaggtgctttcataacactgattgcaagggatga
A0A8C5IH35_BCL2-01      attgaatgctataagcaaggtgctttcataacactgattgcaagggatga
A0A8C5IH35_BCL2-02      attgaatgctataagcaaggtgctttcataacactgattgcaagggatga
A0A670IB81_BCL2-01      att-----------------------------------------------
A0A8D0BPX3_BCL2-01      att-----------------------------------------------
A0A8D2Q1J0_BCL2-02      gtt-----------------------------------------------
A0A8C5S4J3_BCL2-01      att-----------------------------------------------
A0A670ZV01_BCL2-01      att-----------------------------------------------
A0A8D0L5Z6_BCL2-01      att-----------------------------------------------
A0A7M4EPU7_BCL2-01      att-----------------------------------------------
A0A7M4G2E0_BCL2-03      att-----------------------------------------------
A0A8C8SWU7_BCL2-01      att-----------------------------------------------
K7F5Y3_BCL2-02          att-----------------------------------------------
K7F5Y3_BCL2-01          att-----------------------------------------------
K7F5Y3_BCL2-03          att-----------------------------------------------
A0A452I9V7_BCL2-01      att-----------------------------------------------
A0A8C3SV21_BCL2-01      att-----------------------------------------------
A0A8C3ITE1_BCL2-01      att-----------------------------------------------
A0A674IMR0_BCL2-01      att-----------------------------------------------
A0A8C0G2Q6_BCL2-01      att-----------------------------------------------
A0A8C4VT25_BCL2-01      att-----------------------------------------------
A0A7N4PQN7_BCL2-01      att-----------------------------------------------
F6YNL8_BCL2-01          att-----------------------------------------------
A0A4X2L5Q0_BCL2-01      att-----------------------------------------------
A0A8C2U1A2_BCL2-01      act-----------------------------------------------
A0A8C9L7I6_BCL2-01      act-----------------------------------------------
G1MZW1_BCL2-01          act-----------------------------------------------
A0A8C3LBC4_BCL2-01      act-----------------------------------------------
A0A669PDH6_BCL2-01      act-----------------------------------------------
A0A8C9MG30_BCL2-01      act-----------------------------------------------
A0A663MPN9_BCL2-01      acttggttg-----------------------------------------
A0A8C6ZF48_BCL2-01      att-----------------------------------------------
A0A8B9PRT7_BCL2-01      att-----------------------------------------------
A0A8B9PRT7_BCL2-02      att-----------------------------------------------
A0A8C0UAC7_BCL2-01      act-----------------------------------------------
A0A8B9UYC3_BCL2-01      act-----------------------------------------------
A0A8B9E2U6_BCL2-01      act-----------------------------------------------
A0A8B9C4H4_BCL2-01      act-----------------------------------------------
A0A8C3CIW8_BCL2-01      act-----------------------------------------------
A0A493T1X3_BCL2-01      act-----------------------------------------------
A0A8B9SFH3_BCL2-01      act-----------------------------------------------
A0A8D2P664_BCL2-01      act-----------------------------------------------
A0A674GNG3_BCL2-01      act-----------------------------------------------
A0A674GNG3_BCL2-03      act-----------------------------------------------
A0A8C5TLV4_BCL2-01      act-----------------------------------------------
A0A672TR23_BCL2-01      act-----------------------------------------------
A0A8C3JHE5_BCL2-01      act-----------------------------------------------
A0A8C0BN28_BCL2-01      act-----------------------------------------------
A0A8B9RWH9_BCL2-01      act-----------------------------------------------
A0A663FHR0_BCL2-01      act-----------------------------------------------
A0A8C8ANG9_BCL2-01      act-----------------------------------------------
A0A8C0IE77_BCL2-01      act-----------------------------------------------
A0A8D0G0L7_BCL2-01      act-----------------------------------------------
A0A8C4U538_BCL2-01      act-----------------------------------------------
A0A8C4U538_BCL2-02      act-----------------------------------------------
A0A8C3TNF2_BCL2-01      act-----------------------------------------------
A0A8C3QX54_BCL2-01      act-----------------------------------------------
A0A803VR88_BCL2-01      act-----------------------------------------------
A0A803VR88_BCL2-02      act-----------------------------------------------
A0A8C5IH35_BCL2-05      act-----------------------------------------------
A0A8C5IH35_BCL2-04      act-----------------------------------------------
A0A8C5IH35_BCL2-03      act-----------------------------------------------
A0A8D2N8C6_BCL2-01      act-----------------------------------------------
A0A8D0QLD9_BCL2-07      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A4X1TRR9_BCL2-06      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A8D0QLD9_BCL2-05      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A4X1TRR9_BCL2-05      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A8D0QLD9_BCL2-04      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A4X1TRR9_BCL2-07      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A8D0QLD9_BCL2-06      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A4X1TRR9_BCL2-04      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A4X1TRR9_BCL2-02      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A8D0QLD9_BCL2-02      attgagtgctataaacaaggagcgtttataactctggttgcacgaaatga
A0A8C6RID6_BCL2-01      act-----------------------------------------------
A0A8C6RID6_BCL2-02      act-----------------------------------------------
Q6R755_BCL2-01          att-----------------------------------------------
Q923R6_BCL2-01          att-----------------------------------------------
A0A8C8U7I9_BCL2-01      att-----------------------------------------------
Q6NTH7_BCL2-01          att-----------------------------------------------
A0A8C6H5J8_BCL2-01      att-----------------------------------------------
Q7TSN8_BCL2-01          att-----------------------------------------------
A0A8I6AJ02_BCL2-01      att-----------------------------------------------
P49950_BCL2-01          att-----------------------------------------------
A0A4W2DSR6_BCL2-02      act-----------------------------------------------
A0A4W2DSR6_BCL2-02      act-----------------------------------------------
A0A8C6CUJ2_BCL2-01      act-----------------------------------------------
A0A4W2DSR6_BCL2-01      act-----------------------------------------------
A0A4W2DSR6_BCL2-01      act-----------------------------------------------
F6R2C4_BCL2-01          act-----------------------------------------------
O02718_BCL2-01          act-----------------------------------------------
A0A076FU27_BCL2-01      act-----------------------------------------------
A0A076FZV9_BCL2-01      act-----------------------------------------------
A0A452EV13_BCL2-01      act-----------------------------------------------
A0A8C5JYS0_BCL2-01      act-----------------------------------------------
G3SLZ1_BCL2-01          act-----------------------------------------------
G3SLZ1_BCL2-02          act-----------------------------------------------
H0W1T3_BCL2-01          act-----------------------------------------------
A0A5F9CRQ4_BCL2-01      act-----------------------------------------------
A0A5F9CRQ4_BCL2-02      act-----------------------------------------------
M3YYK3_BCL2-01          act-----------------------------------------------
A0A8D2AUF5_BCL2-01      act-----------------------------------------------
I3MVK9_BCL2-01          act-----------------------------------------------
A0A8C5YTS1_BCL2-01      act-----------------------------------------------
A0A8D2IIB8_BCL2-01      act-----------------------------------------------
A0A250YD83_BCL2-01      act-----------------------------------------------
A0A452T603_BCL2-01      act-----------------------------------------------
A0A8C2VKS3_BCL2-01      act-----------------------------------------------
A0A8C9HUK6_BCL2-02      act-----------------------------------------------
A0A2K5EB04_BCL2-01      act-----------------------------------------------
A0A2K6UEL3_BCL2-01      act-----------------------------------------------
A0A2R8MY14_BCL2-01      act-----------------------------------------------
A0A2K6R2I5_BCL2-02      act-----------------------------------------------
A0A2K5HK49_BCL2-01      act-----------------------------------------------
A0A7I2V3S7_BCL2-04      att-----------------------------------------------
A0A7I2V3S7_BCL2-10      att-----------------------------------------------
A0A7I2V3S7_BCL2-05      att-----------------------------------------------
A0A7I2V3S7_BCL2-08      att-----------------------------------------------
A0A7N9CNB8_BCL2-01      act-----------------------------------------------
A0A8D2EFR4_BCL2-01      act-----------------------------------------------
A0A2K5XRD4_BCL2-01      act-----------------------------------------------
A0A2K5NZS5_BCL2-01      act-----------------------------------------------
A0A0D9S017_BCL2-01      act-----------------------------------------------
A0A5F7ZZ15_BCL2-01      act-----------------------------------------------
A0A2K6CIX3_BCL2-01      act-----------------------------------------------
A0A096MPU7_BCL2-01      act-----------------------------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          att-----------------------------------------------
A0A2K6KHG1_BCL2-01      act-----------------------------------------------
A0A2K6R2I5_BCL2-01      act-----------------------------------------------
A0A2J8W3J1_BCL2-01      att-----------------------------------------------
A0A8C9HUK6_BCL2-01      act-----------------------------------------------
A0A2I3GZF9_BCL2-01      att-----------------------------------------------
A0A7I2V3S7_BCL2-06      att-----------------------------------------------
A0A7I2V3S7_BCL2-07      att-----------------------------------------------
A0A2R9APW6_BCL2-01      att-----------------------------------------------
G3QES9_BCL2-01          att-----------------------------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          act-----------------------------------------------
A0A8B7H1C6_BCL2-01      act-----------------------------------------------
A0A8C9AC52_BCL2-01      act-----------------------------------------------
A0A2K6G3I7_BCL2-01      att-----------------------------------------------
A0A3Q2HRY3_BCL2-02      act-----------------------------------------------
A0A8C4L1K6_BCL2-01      act-----------------------------------------------
A0A3Q2HRY3_BCL2-01      act-----------------------------------------------
A0A673VDM8_BCL2-01      act-----------------------------------------------
A0A5F5Y6Y3_BCL2-02      act-----------------------------------------------
A0A8C9J3W6_BCL2-01      act-----------------------------------------------
Q8I008_BCL2-01          act-----------------------------------------------
A0A667GHH0_BCL2-01      act-----------------------------------------------
A0A5F5Y6Y3_BCL2-01      act-----------------------------------------------
A0A8C8XJU8_BCL2-01      act-----------------------------------------------
A0A8C7B9K2_BCL2-01      act-----------------------------------------------
G1LIC9_BCL2-01          act-----------------------------------------------
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      act-----------------------------------------------
A0A8I3MLT5_BCL2-02      act-----------------------------------------------
A0A8C0NC28_BCL2-02      act-----------------------------------------------
Q75SV7_BCL2-01          act-----------------------------------------------
A0A8C0KWE3_BCL2-01      act-----------------------------------------------
A0A8C0NC28_BCL2-01      act-----------------------------------------------
A0A8I3MLT5_BCL2-01      act-----------------------------------------------
A0A8C6AXM8_BCL2-01      act-----------------------------------------------
A0A8C9CJ69_BCL2-01      act-----------------------------------------------
A0A8B8V3A7_BCL2-02      act-----------------------------------------------
A0A8B8V3A7_BCL2-01      act-----------------------------------------------
A0A8B8V3A7_BCL2-03      act-----------------------------------------------
A0A8C3WCN0_BCL2-01      act-----------------------------------------------
A0A8D0QLD9_BCL2-03      act-----------------------------------------------
A0A4X1TRR9_BCL2-01      act-----------------------------------------------
A0A8D0QLD9_BCL2-01      act-----------------------------------------------
A0A4X1TRR9_BCL2-03      act-----------------------------------------------
                                                                          

A3KNH9_BCL2-01          --ataaactttcaaagcgag------g--------------------ata
Q564A4_BCL2-01          --ataaactttcaaagcgag------g--------------------ata
X4ZGI8_BCL2-01          --acaaactttcaaagaagg------g--------------------ata
A0A673HVU7_BCL2-01      --acaaactttcaaagaagg------g--------------------ata
A0A4W4F7Z4_BCL2-01      --acaaactgtcgaaaaatg------g--------------------gta
B9ZYL7_BCL2-01          --ataaactatctcagaagg------g--------------------gta
A0A8C5MT36_BCL2-03      --ataagctatcacagaggg------g--------------------cta
A0A8C5MT36_BCL2-01      --ataagctatcacagaggg------g--------------------cta
A0A8C5MT36_BCL2-02      --ataagctatcacagaggg------g--------------------cta
A0A8C5MT36_BCL2-04      --ataagctatcacagaggg------g--------------------cta
A0A7M4G2E0_BCL2-01      a-acagaccttttcagagaaatgtgca----------aacatatgctcaa
A0A7M4G2E0_BCL2-02      a-acagaccttttcagagaaatgtgca----------aacatatgctcaa
A0A673Z0A3_BCL2-01      --acaaactgttgaagaagg------g--------------------att
A0A8C7CHJ0_BCL2-01      --acaaactgttgaagaagg------g--------------------att
A0A8C7Q7B4_BCL2-01      --acaaactgttgaagaagg------g--------------------att
A0A0U3DHY6_BCL2-01      --acaaactgttgaagaagg------g--------------------att
A0A4W5NW18_BCL2-01      --acaaactgttgaaaatgg------g--------------------att
A0A674B8T7_BCL2-01      --acaaactgttgaacatgg------g--------------------att
A0A8C7RG50_BCL2-01      --acaaactgttgaaaatgg------g--------------------att
A0A8C8GL24_BCL2-01      --acaaactgttgaaagtgg------g--------------------att
A0A6Q2YIU6_BCL2-01      --acaaactcttaaaacggg------g--------------------ata
A0A4W5KV00_BCL2-01      --acaaactcttgaaacgag------g--------------------ata
A0A8C7G8X1_BCL2-01      --acaaactcttgaaacgag------g--------------------ata
A0A674B0E5_BCL2-01      --acaaactcttgaaacgag------g--------------------ata
A0A8C8JWJ1_BCL2-02      --acaaactcttgaaaaggg------g--------------------ata
A0A8C7N3I9_BCL2-01      --acaaactcttgaaaaggg------g--------------------ata
A0A8C8JWJ1_BCL2-01      --acaaactcttgaaaaggg------g--------------------ata
A0A8C5C4C3_BCL2-01      --ataaactgtccaagcagg------g--------------------gta
A0A3B4A3G8_BCL2-01      --ataaactctccaaacgtg------g--------------------ctt
A0A3Q3B0R2_BCL2-01      --acaaactctccaagcgcg------g--------------------cta
A0A8C7ZK61_BCL2-01      --acaaactctccaagaggg------g--------------------cta
A0A3P8WUE9_BCL2-01      --ataaactcgccaagcgtg------g--------------------gta
A0A665U7Y7_BCL2-01      --ataaactcgccaaacggg------g--------------------cta
A0A672HHE5_BCL2-01      --ataaactctccaaacgcg------g--------------------ata
A0A3Q3G1D7_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A8C2X310_BCL2-06      --ataaactctccaaacggg------g--------------------cta
A0A3Q3MEY1_BCL2-01      --ataaactctccaaacgcg------g--------------------cta
A0A2U9BJ09_BCL2-01      --ataaactctccaagcggg------g--------------------cta
A0A8C9ZFJ5_BCL2-09      --ataaactctccaaacggg------g--------------------cta
A0A7N6A4C8_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A3Q0S5Z7_BCL2-01      --ataaactctccaaacggg------g--------------------ata
A0A668TEB6_BCL2-05      --ataaactctccaagcggg------g--------------------ata
A0A3P8QVM8_BCL2-01      --ataaactctccaagcggg------g--------------------gtt
A0A3P9DIG5_BCL2-01      --ataaactctccaagcggg------g--------------------gtt
A0A3Q2UYW8_BCL2-01      --ataaactctccaagcggg------g--------------------gtt
A0A3B4G3K4_BCL2-01      --ataaactctccaagcggg------g--------------------gtt
A0A4W6DDI0_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A1X9JZA1_BCL2-01      --ataaactctccaaacagg------g--------------------cta
A0A3B4TX71_BCL2-01      --ataaactctccaaacaag------g--------------------ata
A0A3B4YAG2_BCL2-01      --ataaactctccaaacggg------g--------------------ata
A0A3B5BBQ0_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A3Q1B8C3_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A3P8S9L3_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A3Q1FLK7_BCL2-01      --ataaactctccaaacggg------g--------------------cta
A0A673LV42_BCL2-01      --ataagctctggaagaagg------g--------------------ata
A0A8C1IQE4_BCL2-01      --ataagctctggaagaagg------g--------------------gta
A0A672T179_BCL2-01      --ataagctctggaagaagg------g--------------------ata
A0A3B3TCS4_BCL2-01      --ataaactgctgaaaacag------g--------------------cta
A0A8C9T5U7_BCL2-01      --acaagctgctcaagacgg------g--------------------cta
W5N4F7_BCL2-01          --acaaactcctgaagaagg------g--------------------cta
H9GPE7_BCL2-01          --acaagctgtcgcagaaag------g--------------------ata
A0A8D2Q1J0_BCL2-01      gaaccgtctgatggaaacaa------aaaaagaaattgagaaattctctg
A0A8D2Q1J0_BCL2-03      gaaccgtctgatggaaacaa------aaaaagaaattgagaaattctctg
A0A668TEB6_BCL2-01      ggagaagttgcttcaggcaa------agaaggaagtggagaaatttgcca
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ggagaagttgcttcaggcaa------agaaggaagtggagaaatttgcca
A0A668TEB6_BCL2-03      ggagaagttgcttcaggcaa------agaaggaagtggagaaatttgcca
A0A3Q3MEY1_BCL2-02      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-10      gcctg-gttgtct-------------------------------------
A0A3Q3MEY1_BCL2-08      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-04      gccgatgccatttaacttaaggtttcataagactgtgtacaatttcttaa
A0A3Q3MEY1_BCL2-05      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-07      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-09      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-03      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A3Q3MEY1_BCL2-06      gactaagttgcttcaagcaa------aaaaagaggtggagaaatttgcca
A0A7N6A4C8_BCL2-02      ggctaaattgcttcaggcaa------agaaggaaatagagaaatttgcca
A0A7N6A4C8_BCL2-04      ggctaaattgcttcaggcaa------agaaggaaatagagaaatttgcca
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ggctaaattgcttcaggcaa------agaaggaaatagagaaatttgcca
A0A7N6A4C8_BCL2-03      ggctaaattgcttcaggcaa------agaaggaaatagagaaatttgcca
A0A7N6A4C8_BCL2-06      ggctaaattgcttcaggcaa------agaaggaaatagagaaatttgcca
A0A8C2X310_BCL2-01      ggctaaattgcttcaagcga------agaaagagttggagaaatttgcca
A0A8C2X310_BCL2-02      ggctaaattgcttcaagcga------agaaagagttggagaaatttgcca
A0A8C2X310_BCL2-04      ggctaaattgcttcaagcga------agaaagagttggagaaatttgcca
A0A8C2X310_BCL2-05      ggtca---------------------------------------------
A0A8C2X310_BCL2-03      ggctaaattgcttcaagcga------agaaagagttggagaaatttgcca
A0A8C9ZFJ5_BCL2-01      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-05      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-06      gg------------------------------------------------
A0A8C9ZFJ5_BCL2-02      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-03      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-04      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-07      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A8C9ZFJ5_BCL2-08      ggctaaattgcttcaagcaa------agaaagaggtggagaaatttgcca
A0A674GNG3_BCL2-02      gaataagctgttgcagacga------agaaggaaatagaaaagtactctg
A0A674GNG3_BCL2-04      gaataagctgttgcagacga------agaaggaaatagaaaagtactctg
A0A8C5IH35_BCL2-01      gaacaagctgttgcagacga------agaaggaaatagaaaagtactctg
A0A8C5IH35_BCL2-02      gaacaagctgttgcagacga------agaaggaaatagaaaagtactctg
A0A670IB81_BCL2-01      --acaagctgtcgcagaagg------g--------------------ata
A0A8D0BPX3_BCL2-01      --acaagctgtcacaaaaag------g--------------------ata
A0A8D2Q1J0_BCL2-02      --acaaactctcacagaaag------g--------------------ata
A0A8C5S4J3_BCL2-01      --acaagctgtcacagaaag------g--------------------ata
A0A670ZV01_BCL2-01      --acaagctgtcacagaaag------g--------------------ata
A0A8D0L5Z6_BCL2-01      --acaaactgtcacagagag------g--------------------ata
A0A7M4EPU7_BCL2-01      --acaaactatcacagaggg------g--------------------ata
A0A7M4G2E0_BCL2-03      --acaaactgtcacagaggg------g--------------------gta
A0A8C8SWU7_BCL2-01      --acaaactgtcacagagag------g--------------------ata
K7F5Y3_BCL2-02          --acaaactgtcacagaggg------g--------------------gta
K7F5Y3_BCL2-01          --acaaactgtcacagaggg------g--------------------gta
K7F5Y3_BCL2-03          --acaaactgtcacagaggg------g--------------------gta
A0A452I9V7_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A8C3SV21_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A8C3ITE1_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A674IMR0_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A8C0G2Q6_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A8C4VT25_BCL2-01      --acaaactgtcacagaggg------g--------------------ata
A0A7N4PQN7_BCL2-01      --ataagctatcacagagag------g--------------------gta
F6YNL8_BCL2-01          --ataaactgtcacagaggg------g--------------------gta
A0A4X2L5Q0_BCL2-01      --ataagttgtcacagagag------g--------------------gta
A0A8C2U1A2_BCL2-01      --ataaactctctcagcggg------g--------------------cta
A0A8C9L7I6_BCL2-01      --ataaactctcgcagcggg------g--------------------cta
G1MZW1_BCL2-01          --ataaactctcgcagcggg------g--------------------cta
A0A8C3LBC4_BCL2-01      --ataaactctcgcagcggg------g--------------------cta
A0A669PDH6_BCL2-01      --ataaactctcgcagcggg------g--------------------cta
A0A8C9MG30_BCL2-01      --ataaactctctcagaggg------g--------------------ata
A0A663MPN9_BCL2-01      --acaaatccccttg----------------------------------c
A0A8C6ZF48_BCL2-01      --acaaactctcgcagaggg------g--------------------ata
A0A8B9PRT7_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8B9PRT7_BCL2-02      --ataaactctcgcagaggg------g--------------------ata
A0A8C0UAC7_BCL2-01      --ataaactctcccagaggg------g--------------------ata
A0A8B9UYC3_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8B9E2U6_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8B9C4H4_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8C3CIW8_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A493T1X3_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8B9SFH3_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8D2P664_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A674GNG3_BCL2-01      --ataaactctctcagaggg------g--------------------ata
A0A674GNG3_BCL2-03      --ataaactctctcagaggg------g--------------------ata
A0A8C5TLV4_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A672TR23_BCL2-01      --ataaactctcacagaggg------g--------------------ata
A0A8C3JHE5_BCL2-01      --ataaactctcgcagagag------g--------------------ata
A0A8C0BN28_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8B9RWH9_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A663FHR0_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8C8ANG9_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8C0IE77_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8D0G0L7_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A8C4U538_BCL2-01      --ataaactctcgcagcggg------g--------------------ata
A0A8C4U538_BCL2-02      --ataaactctcgcagcggg------g--------------------ata
A0A8C3TNF2_BCL2-01      --ataaactctcccagaggg------g--------------------ata
A0A8C3QX54_BCL2-01      --ataaactctcacagaggg------g--------------------ata
A0A803VR88_BCL2-01      --ataaactctcgcagaggg------g--------------------ata
A0A803VR88_BCL2-02      --ataaactctcgcagaggg------g--------------------ata
A0A8C5IH35_BCL2-05      --ataaactctctcagaggg------g--------------------ata
A0A8C5IH35_BCL2-04      --ataaactctctcagaggg------g--------------------ata
A0A8C5IH35_BCL2-03      --ataaactctctcagaggg------g--------------------ata
A0A8D2N8C6_BCL2-01      --ataaactctctcagaggg------g--------------------ata
A0A8D0QLD9_BCL2-07      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A4X1TRR9_BCL2-06      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A8D0QLD9_BCL2-05      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A4X1TRR9_BCL2-05      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A8D0QLD9_BCL2-04      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A4X1TRR9_BCL2-07      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A8D0QLD9_BCL2-06      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A4X1TRR9_BCL2-04      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A4X1TRR9_BCL2-02      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A8D0QLD9_BCL2-02      ggacaagctgttgcaggcaa------agaaagaaattgaaaaacactcta
A0A8C6RID6_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
A0A8C6RID6_BCL2-02      --ataagctgtcacagaggg------g--------------------cta
Q6R755_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
Q923R6_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
A0A8C8U7I9_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
Q6NTH7_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
A0A8C6H5J8_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
Q7TSN8_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
A0A8I6AJ02_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
P49950_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
A0A4W2DSR6_BCL2-02      --ataagctgtcgcagcggg------g--------------------cta
A0A4W2DSR6_BCL2-02      --ataagctgtcgcagcggg------g--------------------cta
A0A8C6CUJ2_BCL2-01      --ataagctgtcgcagcggg------g--------------------cta
A0A4W2DSR6_BCL2-01      --ataagctgtcgcagcggg------g--------------------cta
A0A4W2DSR6_BCL2-01      --ataagctgtcgcagcggg------g--------------------cta
F6R2C4_BCL2-01          --ataagctgtcgcagcggg------g--------------------cta
O02718_BCL2-01          --ataagctgtcgcagcggg------g--------------------cta
A0A076FU27_BCL2-01      --acaagctgtcgcagcgcg------g--------------------cta
A0A076FZV9_BCL2-01      --acaagctgtcgcagcgcg------g--------------------cta
A0A452EV13_BCL2-01      --acaagctgtcgcagcgcg------g--------------------cta
A0A8C5JYS0_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
G3SLZ1_BCL2-01          --ataagctgtcgcagcggg------g--------------------cta
G3SLZ1_BCL2-02          --ataagctgtcgcagcggg------g--------------------cta
H0W1T3_BCL2-01          --ataagctgtcccagagag------g--------------------cta
A0A5F9CRQ4_BCL2-01      --ataagctgtcccagaggg------g--------------------cta
A0A5F9CRQ4_BCL2-02      --ataagctgtcccagaggg------g--------------------cta
M3YYK3_BCL2-01          --ataagctgtcgcagaggg------g-----------------------
A0A8D2AUF5_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
I3MVK9_BCL2-01          --ataagctgtcacagaggg------g--------------------cta
A0A8C5YTS1_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
A0A8D2IIB8_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
A0A250YD83_BCL2-01      --ataagctgtcacagaggg------g--------------------cta
A0A452T603_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C2VKS3_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C9HUK6_BCL2-02      --ataagctgtcgcagaggg------g--------------------cta
A0A2K5EB04_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K6UEL3_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2R8MY14_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K6R2I5_BCL2-02      --ataagctgtcgcagaggg------g--------------------cta
A0A2K5HK49_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-04      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-10      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-05      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-08      --ataagctgtcgcagaggg------g--------------------cta
A0A7N9CNB8_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8D2EFR4_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K5XRD4_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K5NZS5_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A0D9S017_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A5F7ZZ15_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K6CIX3_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A096MPU7_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          --ataagctgtcgcagaggg------g--------------------cta
A0A2K6KHG1_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K6R2I5_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2J8W3J1_BCL2-01      --ataagttgtcgcagaggg------g--------------------cta
A0A8C9HUK6_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2I3GZF9_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-06      --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-07      --ataagctgtcgcagaggg------g--------------------cta
A0A2R9APW6_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
G3QES9_BCL2-01          --ataagctgtcgcagaggg------g--------------------cta
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          --ataagctgtcgcagaggg------g--------------------cta
A0A8B7H1C6_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C9AC52_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A2K6G3I7_BCL2-01      --ataagctggcgcagaggg------g--------------------cta
A0A3Q2HRY3_BCL2-02      --ataagctgtcgcagaggg------g--------------------cta
A0A8C4L1K6_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A3Q2HRY3_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A673VDM8_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A5F5Y6Y3_BCL2-02      --ataagctgtcgcagaggg------g--------------------cta
A0A8C9J3W6_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
Q8I008_BCL2-01          --atgagctgccgcagaggg------g--------------------cta
A0A667GHH0_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A5F5Y6Y3_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C8XJU8_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C7B9K2_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
G1LIC9_BCL2-01          --ataagctgtcgcagaggg------g--------------------cta
A0A452R110_BCL2-01      --------------------------------------------------
A0A452R110_BCL2-02      --------------------------------------------------
A0A8C0NC28_BCL2-03      --acaagctgtcgcagaggg------g--------------------cta
A0A8I3MLT5_BCL2-02      --acaagctgtcgcagaggg------g--------------------cta
A0A8C0NC28_BCL2-02      --acaagctgtcgcagaggg------g--------------------cta
Q75SV7_BCL2-01          --acaagctgtcgcagaggg------g--------------------cta
A0A8C0KWE3_BCL2-01      --acaagctgtcgcagaggg------g--------------------cta
A0A8C0NC28_BCL2-01      --acaagctgtcgcagaggg------g--------------------cta
A0A8I3MLT5_BCL2-01      --acaagctgtcgcagaggg------g--------------------cta
A0A8C6AXM8_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8C9CJ69_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8B8V3A7_BCL2-02      --ataagctgtcgcagaggg------g--------------------cta
A0A8B8V3A7_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8B8V3A7_BCL2-03      --ataagctgtcgcagaggg------g--------------------cta
A0A8C3WCN0_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8D0QLD9_BCL2-03      --ataagctgtcgcagaggg------g--------------------cta
A0A4X1TRR9_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A8D0QLD9_BCL2-01      --ataagctgtcgcagaggg------g--------------------cta
A0A4X1TRR9_BCL2-03      --ataagctgtcgcagaggg------g--------------------cta
                                                                          

A3KNH9_BCL2-01          tgtgtggaaatgtcag------------tcctctgctgaggaagatgaca
Q564A4_BCL2-01          tgtgtggaaatgtcag------------tcctctgctgaggaagatgaca
X4ZGI8_BCL2-01          tgagtggaaatttcaa------------tcttccggggaggatgatgaca
A0A673HVU7_BCL2-01      tgtgtggaaatctcaa------------tcttctggggaggatgatgaca
A0A4W4F7Z4_BCL2-01      catgtgggaattccattcg---------cgtgagacggaccctgaccctg
B9ZYL7_BCL2-01          tgcatgggaagaggga-------------------------aggcagcag
A0A8C5MT36_BCL2-03      tgaatgggaagatggg-------------------------aggcagcag
A0A8C5MT36_BCL2-01      tgaatgggaagatggg-------------------------aggcagcag
A0A8C5MT36_BCL2-02      tgaatgggaagatggg-------------------------aggcagcag
A0A8C5MT36_BCL2-04      tgaatgggaagatggg-------------------------aggcagcag
A0A7M4G2E0_BCL2-01      caagaggtattttgaa-----------------------atttgttgaaa
A0A7M4G2E0_BCL2-02      caagaggtattttgaa-----------------------atttgttgaaa
A0A673Z0A3_BCL2-01      tgtatgggaatttaatcca------------------gaaaacgattccc
A0A8C7CHJ0_BCL2-01      tgtatgggaattttatcca------------------gaaaacgattccc
A0A8C7Q7B4_BCL2-01      tgtatgggaattttatcca------------------gaaaacgattccc
A0A0U3DHY6_BCL2-01      tgtatgggaatttcaagca------------------gaaaacgattctc
A0A4W5NW18_BCL2-01      tgtatggaaatttcaagca------------------gaaaacgattatc
A0A674B8T7_BCL2-01      tgtatggaaatttcaagca------------------gaaaacgattctc
A0A8C7RG50_BCL2-01      tgtatggaaatttcaagga------------------gaaaacgattctc
A0A8C8GL24_BCL2-01      tgtatggaaatttcaagga------------------gaaaacgattctc
A0A6Q2YIU6_BCL2-01      tgcatgggatttcgaagat---------gca---gaggaggaagatggtg
A0A4W5KV00_BCL2-01      tgcgtgggatttcgaggat---------gctgaggaggaggaaggtgctg
A0A8C7G8X1_BCL2-01      tgcgtgggatttcgaggat---------gccgaggaggaggaaggtgctg
A0A674B0E5_BCL2-01      tgcgtgggatttcgaggat---------gccgaggaggaggaaggtgccg
A0A8C8JWJ1_BCL2-02      tgcgtgggatttcgagaat---------gcc------gaggaagatgctg
A0A8C7N3I9_BCL2-01      tgcgtgggatttcgagaat---------gcc------gaggaagatgctg
A0A8C8JWJ1_BCL2-01      tgcgtgggatttcgagaat---------gcc------gaggaagatgctg
A0A8C5C4C3_BCL2-01      tatgtgggaattcgaggac---------gctgtggaggaagaagaagtgg
A0A3B4A3G8_BCL2-01      cgcgtggggttttcacgaggac------gcagaggatgaaggagacgtgg
A0A3Q3B0R2_BCL2-01      cgcgtggggctccgaccgcccccgccgcgtccgagac------gatgctg
A0A8C7ZK61_BCL2-01      cgtgtgtgggctgaacggcggcca----gcccgaga--------atgctg
A0A3P8WUE9_BCL2-01      cgtgtgggagcacgacgag---------gaccgagatgg---agacgctg
A0A665U7Y7_BCL2-01      tgcgtggggatttgatgac---------gtccggaatga---agatgctg
A0A672HHE5_BCL2-01      cgcgtggagcttggacgct---------gcgcgggatga---ggacgcgg
A0A3Q3G1D7_BCL2-01      cgagtggggattcgaggat---------gagcaggatga---agatgctg
A0A8C2X310_BCL2-06      cgtgtttggatttgacgac---------gtccgagatga---agatgccg
A0A3Q3MEY1_BCL2-01      cgtgtggggatttcataac---------gtccaggatga---agatgctg
A0A2U9BJ09_BCL2-01      cgtgtgggggtttgatgat---------gtccgagatga---agatgccg
A0A8C9ZFJ5_BCL2-09      cgtgtttggatttgatgat---------gtccgggatga---agatgctg
A0A7N6A4C8_BCL2-01      cgcgtgggggtttcatgat---------gcccaagacga---agatgctg
A0A3Q0S5Z7_BCL2-01      cgcgtggggatttgacggt---------gtccaggatga---agatgctg
A0A668TEB6_BCL2-05      cgtgtggggatttcgcgtt---------gtccaagaaga---agatgctg
A0A3P8QVM8_BCL2-01      cgtgtggggatttcgcgtt---------gtccaagaaga---agatgctg
A0A3P9DIG5_BCL2-01      cgtgtggggatttcgcgtt---------gtccaagaaga---agatgctg
A0A3Q2UYW8_BCL2-01      cgtgtggggatttcgcgtt---------gtccaagaaga---agatgctg
A0A3B4G3K4_BCL2-01      cgtgtggggatttcgcgtt---------gtccaagaaga---agatgctg
A0A4W6DDI0_BCL2-01      cgtgtggcggtgtgacaac---------gtccgggatga---agatgctg
A0A1X9JZA1_BCL2-01      cgagtgggggtttgacgct---------gtccggaatgc---agatgccg
A0A3B4TX71_BCL2-01      cgtgtggggatttgatgat---------gtccgagatga---agatgctg
A0A3B4YAG2_BCL2-01      cgtgtggggatttgatgat---------gtccgagatga---agatgctg
A0A3B5BBQ0_BCL2-01      cgcgtggggctttgatgat---------gtccgggatga---agatgctg
A0A3Q1B8C3_BCL2-01      cgtgtgggggtttgatgat---------gtccgggatga---agatgctg
A0A3P8S9L3_BCL2-01      cgtgtgggggtttgatgat---------gtccgggatga---agatgctg
A0A3Q1FLK7_BCL2-01      cgtgtgggggtttgatgat---------gtccgggatga---agatgctg
A0A673LV42_BCL2-01      cgtgtgggaagtgaac--g---------gac---------acgatgacag
A0A8C1IQE4_BCL2-01      cgtgtgggaa----------------------------------------
A0A672T179_BCL2-01      cgtgtgggaagtgaac--g---------gac---------acgatgacag
A0A3B3TCS4_BCL2-01      tgtgtgggaattcca---------------------------------gg
A0A8C9T5U7_BCL2-01      tgtgtgggaattccgc---------------------------gccgccg
W5N4F7_BCL2-01          cgtgtgggaatcccgc---------------------------------g
H9GPE7_BCL2-01          tgactgggttgccagt--g---------gag--------acagaggaaac
A0A8D2Q1J0_BCL2-01      ttaatgataagcaggt--t---------gtacagtccatttctgtggatg
A0A8D2Q1J0_BCL2-03      ttaatgataagcaggt--t---------gtacagtccatttctgtggatg
A0A668TEB6_BCL2-01      tcaatgacaagcaggt--g---------gtgctctgcatctcagttgatg
A0A668TEB6_BCL2-04      ------------aggt--g---------gtgctctgcatctcagttgatg
A0A668TEB6_BCL2-02      tcaatgacaagcaggt--g---------gtgctctgcatctcagttgatg
A0A668TEB6_BCL2-03      tcaatgacaagcaggt--g---------gtgctctgcatctcagttgatg
A0A3Q3MEY1_BCL2-02      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-04      tt---------caggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-05      ttaatgacaagcaggt--a---------tgggttt--atttgagtaga--
A0A3Q3MEY1_BCL2-07      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-09      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-03      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A3Q3MEY1_BCL2-06      ttaatgacaagcaggt--g---------gtgctctgcatatcggtggatg
A0A7N6A4C8_BCL2-02      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A7N6A4C8_BCL2-04      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A7N6A4C8_BCL2-07      ------------aggt--g---------gtgctttgcatatcagtggatg
A0A7N6A4C8_BCL2-05      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A7N6A4C8_BCL2-03      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A7N6A4C8_BCL2-06      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A8C2X310_BCL2-01      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A8C2X310_BCL2-02      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A8C2X310_BCL2-04      tcaatgacaaacaggt--g---------gtgctttgcatatcagtggatg
A0A8C2X310_BCL2-05      ------------------a---------ttgctt---aaataattcagtg
A0A8C2X310_BCL2-03      tcaatgacaaacaggtata---------ttgctt---aaataattcagtg
A0A8C9ZFJ5_BCL2-01      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-05      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-06      ---------------t--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-02      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-03      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-04      tcaatgac------------------------------------------
A0A8C9ZFJ5_BCL2-07      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A8C9ZFJ5_BCL2-08      tcaatgacaaacaggt--g---------gtgctctgcatatcagtggatg
A0A674GNG3_BCL2-02      ttaatgacaagcaggt--t---------gta-------------------
A0A674GNG3_BCL2-04      ttaatgacaagcaggt--t---------gta-------------------
A0A8C5IH35_BCL2-01      ttaatgacaagcaggt--t---------gta-------------------
A0A8C5IH35_BCL2-02      ttaatgacaagcaggt--t---------gta-------------------
A0A670IB81_BCL2-01      tgactgggttgccagt--g---------aag--------acagagaagac
A0A8D0BPX3_BCL2-01      tgattgggttgccagc--g---------gag--------atggagaaaac
A0A8D2Q1J0_BCL2-02      tgactgggtggctggt--g---------gag--------acccagaaaac
A0A8C5S4J3_BCL2-01      tgactgggttgccagt--g---------gag--------acagagaaaat
A0A670ZV01_BCL2-01      tgactgggttgccagt--g---------gag--------acagagaaaac
A0A8D0L5Z6_BCL2-01      tgactgggcttccagc--a---------gag--------atggag-----
A0A7M4EPU7_BCL2-01      cgactgggctgcccac--c---------aag--------acagagcatgg
A0A7M4G2E0_BCL2-03      cgactgggctgcccac--c---------aag--------acagagcacgg
A0A8C8SWU7_BCL2-01      tgattgggctgccagt--g---------aaa--------acatagcacca
K7F5Y3_BCL2-02          tgattgggctgccaat--g---------aaa--------acagaggacca
K7F5Y3_BCL2-01          tgattgggctgccaat--g---------aaa--------acagaggacca
K7F5Y3_BCL2-03          tgattgggctgccaat--g---------aaa--------acagaggacca
A0A452I9V7_BCL2-01      tgattgggctgccaat--g---------aaa--------acagaggacca
A0A8C3SV21_BCL2-01      tgattgggctgccagt--g---------aaa--------acagaggacca
A0A8C3ITE1_BCL2-01      cgattgggctgccaat--g---------aaa--------acagaggacca
A0A674IMR0_BCL2-01      tgattgggctgccaat--g---------aaa--------acagaggacca
A0A8C0G2Q6_BCL2-01      tgattgggctgccaat--g---------aaa--------acagaggacca
A0A8C4VT25_BCL2-01      tgattgggctgccaat--g---------aaa--------acagaggacca
A0A7N4PQN7_BCL2-01      cgagtgggatgctgga--a---------atc--------tgaggacacca
F6YNL8_BCL2-01          cgagtgggatgctgga--g---------atc--------tgagggcacca
A0A4X2L5Q0_BCL2-01      cgagtgggatgctgga--a---------atc--------tgagggcacca
A0A8C2U1A2_BCL2-01      tgactgggctgccggt--g---------agg--------acaggccgcct
A0A8C9L7I6_BCL2-01      cgattgggccgccggc--g---------agg--------acaggccgccc
G1MZW1_BCL2-01          cgactgggccgccggc--g---------agg--------acaggccaccc
A0A8C3LBC4_BCL2-01      cgactgggccgccggc--g---------agg--------acaggccaccc
A0A669PDH6_BCL2-01      cgactgggccgccggc--g---------agg--------acaggccaccc
A0A8C9MG30_BCL2-01      cgactggcctgccagc--g---------agg--------acagggcatcc
A0A663MPN9_BCL2-01      ctaccttcctgccatc--a---------gaa--------gcag-------
A0A8C6ZF48_BCL2-01      cgactgggcggccagc--g---------gcg--------accgcgcgccg
A0A8B9PRT7_BCL2-01      cgactgggctgccagc--g---------gcg--------accgggcgcca
A0A8B9PRT7_BCL2-02      cgactgggctgccagc--g---------gcg--------accgggcgcca
A0A8C0UAC7_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8B9UYC3_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A8B9E2U6_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A8B9C4H4_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A8C3CIW8_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A493T1X3_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A8B9SFH3_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcgccc
A0A8D2P664_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A674GNG3_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcatcc
A0A674GNG3_BCL2-03      cgactgggctgccggc--g---------agg--------acagggcatcc
A0A8C5TLV4_BCL2-01      cgactgggctgccagc--g---------agg--------acagggcaccc
A0A672TR23_BCL2-01      cgactgggctgccggg--g---------agg--------acagggcaccc
A0A8C3JHE5_BCL2-01      cgactgggctgccggt--g---------agg--------acccggcacct
A0A8C0BN28_BCL2-01      cgactgggctgccgcc--g---------agg--------acagggcaccc
A0A8B9RWH9_BCL2-01      cgactgggctgccgcc--g---------agg--------acagggcaccc
A0A663FHR0_BCL2-01      cgactgggctgccgcc--g---------agg--------acagggcaccc
A0A8C8ANG9_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8C0IE77_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8D0G0L7_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8C4U538_BCL2-01      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8C4U538_BCL2-02      cgactgggctgccggc--g---------agg--------acagggcaccc
A0A8C3TNF2_BCL2-01      cgactgggctgccggt--g---------agg--------acagggcaccc
A0A8C3QX54_BCL2-01      cgactgggctgccggt--g---------agg--------acagggcaccc
A0A803VR88_BCL2-01      cgactgggctgccggc--g---------agc--------acagggcaccc
A0A803VR88_BCL2-02      cgactgggctgccggc--g---------agc--------acagggcaccc
A0A8C5IH35_BCL2-05      cgactggcctgccagc--g---------agg--------acagggcatcc
A0A8C5IH35_BCL2-04      cgactggcctgccagc--g---------agg--------acagggcatcc
A0A8C5IH35_BCL2-03      cgactggcctgccagc--g---------agg--------acagggcatcc
A0A8D2N8C6_BCL2-01      cgactggcctgccagc--g---------agg--------acagggcatcc
A0A8D0QLD9_BCL2-07      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A4X1TRR9_BCL2-06      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A8D0QLD9_BCL2-05      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A4X1TRR9_BCL2-05      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A8D0QLD9_BCL2-04      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A4X1TRR9_BCL2-07      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A8D0QLD9_BCL2-06      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A4X1TRR9_BCL2-04      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A4X1TRR9_BCL2-02      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A8D0QLD9_BCL2-02      ttaatgataaacaggt--g---------gtgctttgtatatcagttgatg
A0A8C6RID6_BCL2-01      cgaatgggatgctgga--g---------atg----------cggacgccg
A0A8C6RID6_BCL2-02      cgaatgggatgctgga--g---------atg----------cggacgccg
Q6R755_BCL2-01          cgagtgggatgtggga--g---------atg----------tggacgccg
Q923R6_BCL2-01          cgagtgggatgtggga--g---------atg----------tggacgccg
A0A8C8U7I9_BCL2-01      cgagtgggatgcggga--g---------atg----------ccgacgccg
Q6NTH7_BCL2-01          cgagtgggatgctgga--g---------atg----------cggacgcgg
A0A8C6H5J8_BCL2-01      cgagtgggatgctgga--g---------atg----------cggacgcgg
Q7TSN8_BCL2-01          cgagtgggatgctgga--g---------atg----------cggacgcgg
A0A8I6AJ02_BCL2-01      cgagtgggatactgga--g---------atg----------aagactccg
P49950_BCL2-01          cgagtgggatactgga--g---------atg----------aagactccg
A0A4W2DSR6_BCL2-02      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A4W2DSR6_BCL2-02      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A8C6CUJ2_BCL2-01      cgagtgggacgccggg--g---------acg----------cgggcgccg
A0A4W2DSR6_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A4W2DSR6_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
F6R2C4_BCL2-01          cgagtgggatgccgga--g---------acg----------cgggcgccg
O02718_BCL2-01          cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A076FU27_BCL2-01      cgagtgggatgccaga--g---------ccg----------cgggcgccg
A0A076FZV9_BCL2-01      cgagtgggatgccgga--g---------ccg----------cgggcgccg
A0A452EV13_BCL2-01      cgagtgggatgccgga--g---------ccg----------cgggcgccg
A0A8C5JYS0_BCL2-01      cgcgtgggatgctggc--g---------acg----------tgggctcgg
G3SLZ1_BCL2-01          cgaatgggaggctggc--g---------aag----------ctagcgccg
G3SLZ1_BCL2-02          cgaatgggaggctggc--g---------aag----------ct-------
H0W1T3_BCL2-01          cgagtgggatgccgga--g---------acg----------ggagcgc--
A0A5F9CRQ4_BCL2-01      cgagtgggacgctggg--g---------acg----------cgggc----
A0A5F9CRQ4_BCL2-02      cgagtgggacgctggg--g---------acg----------cgggc----
M3YYK3_BCL2-01          -------aagaccagt--g---------a------------tgaaactcg
A0A8D2AUF5_BCL2-01      cgagtgggatgctgga--g---------acg----------cgggcgctg
I3MVK9_BCL2-01          cgagtgggatgctgga--g---------acg----------tgggcgctg
A0A8C5YTS1_BCL2-01      cgagtgggatgctgga--g---------acg----------tgggcgctg
A0A8D2IIB8_BCL2-01      cgagtgggatgctgga--g---------acg----------tgggcgctg
A0A250YD83_BCL2-01      cgagtgggatgccgga--g---------acg----------tgggcgccg
A0A452T603_BCL2-01      cga-----------------------------------------------
A0A8C2VKS3_BCL2-01      cgagtgggatgccgga--g---------agg----------agagcgccg
A0A8C9HUK6_BCL2-02      cgagtgggatgccggg--g---------atg----------tgggcgccg
A0A2K5EB04_BCL2-01      cgagtgggatgccgga--g---------atg----------tgggcgccg
A0A2K6UEL3_BCL2-01      cgagtgggatgccgga--g---------atg----------tgggcgccg
A0A2R8MY14_BCL2-01      cgagtgggatgccgga--g---------atg----------tgggcgccg
A0A2K6R2I5_BCL2-02      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A2K5HK49_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggagccg
A0A7I2V3S7_BCL2-04      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-10      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-05      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-08      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7N9CNB8_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A8D2EFR4_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A2K5XRD4_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A2K5NZS5_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A0D9S017_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgccg
A0A5F7ZZ15_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A2K6CIX3_BCL2-01      cgagtgggatgcgggg--g---------atg----------tgggcgcgg
A0A096MPU7_BCL2-01      cgagtgggatgcgggg--g---------at-------------ggcgcgg
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A2K6KHG1_BCL2-01      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A2K6R2I5_BCL2-01      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A2J8W3J1_BCL2-01      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A8C9HUK6_BCL2-01      cgagtgggatgccggg--g---------atg----------tgggcgccg
A0A2I3GZF9_BCL2-01      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-06      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-07      cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A2R9APW6_BCL2-01      cgagtgggatgcggga--g---------atg----------tgggcgccg
G3QES9_BCL2-01          cgagtgggatgcggga--g---------atg----------tgggcgccg
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          cgagtgggatgctgga--g---------acg----------tgggcgttg
A0A8B7H1C6_BCL2-01      cgagtgggatgctgga--g---------aag----------cgagcgctg
A0A8C9AC52_BCL2-01      tgagtgggatgccgga--g---------acg----------caggcgctg
A0A2K6G3I7_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgctg
A0A3Q2HRY3_BCL2-02      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A8C4L1K6_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A3Q2HRY3_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A673VDM8_BCL2-01      cgagtgggacgccgga--g---------acg----------cgggcgccg
A0A5F5Y6Y3_BCL2-02      cgagtgggatgccggg--g---------acg----------cgggcgccg
A0A8C9J3W6_BCL2-01      cgagtgggatgccggg--g---------acg----------cgagnnnnn
Q8I008_BCL2-01          cgagtgggatgccggg--g---------acg----------cgggcgccg
A0A667GHH0_BCL2-01      cgagtgggatgccggg--g---------acg----------cgggcgccg
A0A5F5Y6Y3_BCL2-01      cgagtgggatgccggg--g---------acg----------cgggcgccg
A0A8C8XJU8_BCL2-01      cgagtgggatgccggg--g---------acg----------cgggcgccg
A0A8C7B9K2_BCL2-01      cgagtgggatgccggc--g---------acg----------cgggcgccg
G1LIC9_BCL2-01          cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A452R110_BCL2-01      --------atgccgga--g---------acg----------cgggcgccg
A0A452R110_BCL2-02      --------atgccgga--g---------acg----------cgggcgccg
A0A8C0NC28_BCL2-03      cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8I3MLT5_BCL2-02      cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8C0NC28_BCL2-02      cgagtgggacgcggga--g---------agg----------cgggcgccg
Q75SV7_BCL2-01          cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8C0KWE3_BCL2-01      cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8C0NC28_BCL2-01      cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8I3MLT5_BCL2-01      cgagtgggacgcggga--g---------agg----------cgggcgccg
A0A8C6AXM8_BCL2-01      cgagtgggatgctgga--g---------acg----------cgggcgcca
A0A8C9CJ69_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgcca
A0A8B8V3A7_BCL2-02      cgagtgggatgccgga--g---------acg----------caggcaccg
A0A8B8V3A7_BCL2-01      cgagtgggatgccgga--g---------acg----------caggcaccg
A0A8B8V3A7_BCL2-03      cgagtgggatgccgga--g---------acg----------caggcaccg
A0A8C3WCN0_BCL2-01      cgagtgggatgctgga--g---------acg----------cgggcgccg
A0A8D0QLD9_BCL2-03      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A4X1TRR9_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A8D0QLD9_BCL2-01      cgagtgggatgccgga--g---------acg----------cgggcgccg
A0A4X1TRR9_BCL2-03      cgagtgggatgccgga--g---------acg----------cgggcgccg
                                                                          

A3KNH9_BCL2-01          ccttcaataaa---------------------------------------
Q564A4_BCL2-01          ccttcaataaa---------------------------------------
X4ZGI8_BCL2-01          ctatcaatacg---------------------------------------
A0A673HVU7_BCL2-01      ccgccaataaa---------------------------------------
A0A4W4F7Z4_BCL2-01      cctctaatggctttgacgctcc----------------------------
B9ZYL7_BCL2-01          gtctctgctgagca------ccctcaagcttctgctgctattagtaatta
A0A8C5MT36_BCL2-03      gtttctgttgatct------tcaggatgcttctgctgctaataataatca
A0A8C5MT36_BCL2-01      gtttctgttgatct------tcaggatgcttctgctgctaataataatca
A0A8C5MT36_BCL2-02      gtttctgttgatct------tcaggatgcttctgctgctaataataatca
A0A8C5MT36_BCL2-04      gtttctgttgatct------tcaggatgcttctgctgctaataataatca
A0A7M4G2E0_BCL2-01      ttacagtcagcatt------------------------------------
A0A7M4G2E0_BCL2-02      ttacagtcagcatt------------------------------------
A0A673Z0A3_BCL2-01      caaataatggctttg-----------------------------------
A0A8C7CHJ0_BCL2-01      caaataatggttttg-----------------------------------
A0A8C7Q7B4_BCL2-01      caaataatggttttg-----------------------------------
A0A0U3DHY6_BCL2-01      caaataatttatttg-----------------------------------
A0A4W5NW18_BCL2-01      caaataatggctttg-----------------------------------
A0A674B8T7_BCL2-01      caaataatggctttg-----------------------------------
A0A8C7RG50_BCL2-01      caaataatggctttg-----------------------------------
A0A8C8GL24_BCL2-01      caaataatggctttg-----------------------------------
A0A6Q2YIU6_BCL2-01      ctaataatgggtcg------------------------------------
A0A4W5KV00_BCL2-01      ctaataatgagttg------------------------------------
A0A8C7G8X1_BCL2-01      ctaataatgggtcg------------------------------------
A0A674B0E5_BCL2-01      ctaataatgggtcg------------------------------------
A0A8C8JWJ1_BCL2-02      ataataatgggtcg------------------------------------
A0A8C7N3I9_BCL2-01      ataataatgggtcg------------------------------------
A0A8C8JWJ1_BCL2-01      ataataatgggtcg------------------------------------
A0A8C5C4C3_BCL2-01      ggaataataggtcg------------------------------------
A0A3B4A3G8_BCL2-01      ccaataacggttcg------------------------------------
A0A3Q3B0R2_BCL2-01      ccaacaacggctcg------------------------------------
A0A8C7ZK61_BCL2-01      ccaataacggctcg------------------------------------
A0A3P8WUE9_BCL2-01      ctaataatggctca------------------------------------
A0A665U7Y7_BCL2-01      ctactaatggctca------------------------------------
A0A672HHE5_BCL2-01      ataataacgggtcc------------------------------------
A0A3Q3G1D7_BCL2-01      ctaataacgggtca------------------------------------
A0A8C2X310_BCL2-06      ccgatgacggctta------------------------------------
A0A3Q3MEY1_BCL2-01      ctaataatggctct------------------------------------
A0A2U9BJ09_BCL2-01      ctgataacgggtcg------------------------------------
A0A8C9ZFJ5_BCL2-09      ctaataatgggtca------------------------------------
A0A7N6A4C8_BCL2-01      ctaataatgggtct------------------------------------
A0A3Q0S5Z7_BCL2-01      ctaataacgggtca------------------------------------
A0A668TEB6_BCL2-05      ctaataacggatcg------------------------------------
A0A3P8QVM8_BCL2-01      ctaataacggatcg------------------------------------
A0A3P9DIG5_BCL2-01      ctaataacggatcg------------------------------------
A0A3Q2UYW8_BCL2-01      ctaataacggatcg------------------------------------
A0A3B4G3K4_BCL2-01      ctaataacggatcg------------------------------------
A0A4W6DDI0_BCL2-01      ctaataacgggtcg------------------------------------
A0A1X9JZA1_BCL2-01      gtaataatgggtca------------------------------------
A0A3B4TX71_BCL2-01      ctaataatggctca------------------------------------
A0A3B4YAG2_BCL2-01      ctaataatggctca------------------------------------
A0A3B5BBQ0_BCL2-01      ctaataacgggtca------------------------------------
A0A3Q1B8C3_BCL2-01      ctaataacgggtca------------------------------------
A0A3P8S9L3_BCL2-01      ctaataacgggtca------------------------------------
A0A3Q1FLK7_BCL2-01      ctaataacgggtca------------------------------------
A0A673LV42_BCL2-01      cgtctcgaatggactgatgatg----------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      tgtctcgaatggactgatgatg----------------------------
A0A3B3TCS4_BCL2-01      cggccggagacaccgattctcc----------------------------
A0A8C9T5U7_BCL2-01      ccgccgccgacgccgatccctc----------------------------
W5N4F7_BCL2-01          tgtccggcgagaccgatccccc----------------------------
H9GPE7_BCL2-01          cttgctgctgctgctgctgctg----------------------------
A0A8D2Q1J0_BCL2-01      tttccaaggatggt----acaa----------------------------
A0A8D2Q1J0_BCL2-03      tttccaaggatggt----acaa----------------------------
A0A668TEB6_BCL2-01      tttccagtgattac------------------------------------
A0A668TEB6_BCL2-04      tttccagtgattac------------------------------------
A0A668TEB6_BCL2-02      tttccagtgattac------------------------------------
A0A668TEB6_BCL2-03      tttccagtgattac------------------------------------
A0A3Q3MEY1_BCL2-02      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-10      ----------ttat------------------------------------
A0A3Q3MEY1_BCL2-08      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-04      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-05      -----agtgacttt------------------------------------
A0A3Q3MEY1_BCL2-07      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-09      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-03      tttccagtgattat------------------------------------
A0A3Q3MEY1_BCL2-06      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-02      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-04      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-07      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-05      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-03      tttccagtgattat------------------------------------
A0A7N6A4C8_BCL2-06      tttccagtgattat------------------------------------
A0A8C2X310_BCL2-01      tttccagtgaatat------------------------------------
A0A8C2X310_BCL2-02      tttccagtgaatat------------------------------------
A0A8C2X310_BCL2-04      tttccagtgaatat------------------------------------
A0A8C2X310_BCL2-05      t------------t------------------------------------
A0A8C2X310_BCL2-03      t------------t------------------------------------
A0A8C9ZFJ5_BCL2-01      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-05      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-06      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-02      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-03      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      tttccagtgattat------------------------------------
A0A8C9ZFJ5_BCL2-08      tttccagtgattat------------------------------------
A0A674GNG3_BCL2-02      ------------ctctgtattt----------------------------
A0A674GNG3_BCL2-04      ------------ctctgtattt----------------------------
A0A8C5IH35_BCL2-01      ------------ctctgtattt----------------------------
A0A8C5IH35_BCL2-02      ------------ctctgtattt----------------------------
A0A670IB81_BCL2-01      cttccttctcctcctcttcctccagatcctc-------------------
A0A8D0BPX3_BCL2-01      gtttctgatactgctgctgct---gcttctg-------------------
A0A8D2Q1J0_BCL2-02      cttcctg---ctcctgctcct---gctcctg-------------------
A0A8C5S4J3_BCL2-01      ------------------------gtttctc-------------------
A0A670ZV01_BCL2-01      ------------------------gtttctc-------------------
A0A8D0L5Z6_BCL2-01      -------caagtgtcccttctg----------------------------
A0A7M4EPU7_BCL2-01      tgtcctctgagtctctctcctgctgctgctgttg----------------
A0A7M4G2E0_BCL2-03      ggtcctccgagtcattctcctgctgctgctgttg----------------
A0A8C8SWU7_BCL2-01      gtttctccaactctttctcctcctcttcctgctg----------------
K7F5Y3_BCL2-02          gtttcttcaagtctctctcctc----------------------------
K7F5Y3_BCL2-01          gtttcttcaagtctctctcctc----------------------------
K7F5Y3_BCL2-03          gtttcttcaagtctctctcctc----------------------------
A0A452I9V7_BCL2-01      gtttcaccaaatctctctcccc---------cta----------------
A0A8C3SV21_BCL2-01      gtttctccaaatctctctcctc---------cta----------------
A0A8C3ITE1_BCL2-01      gtttctccaaatctctctcccc---------cta----------------
A0A674IMR0_BCL2-01      gtttctccaaatctctctcccc---------cta----------------
A0A8C0G2Q6_BCL2-01      gtttctccaaatctctctcccc---------ctc----------------
A0A8C4VT25_BCL2-01      gtttcaccaaatctctctcccc---------cta----------------
A0A7N4PQN7_BCL2-01      gcctctccaagtcttcctcctgttgttgcttctgccc-------------
F6YNL8_BCL2-01          gcctctccaagtcttcctcctgttgttgcttctgccc-------------
A0A4X2L5Q0_BCL2-01      gcctctccaagccttccttctgttgttgcttctgccc-------------
A0A8C2U1A2_BCL2-01      gtgcccccggccctg---gctcctgctgctgctcctgccgcggt------
A0A8C9L7I6_BCL2-01      gtgcccccggccctg---gctcccgctgctgctcccgccgcggt------
G1MZW1_BCL2-01          gtgcccccggccctg---gctcccactgctgctcccgct-----------
A0A8C3LBC4_BCL2-01      gtacccccggccctg---gctcccactgctgctcccactgcggt------
A0A669PDH6_BCL2-01      gtacccccggccctg---gctcccactgctgctcccactgcggt------
A0A8C9MG30_BCL2-01      ctgcctccaggtctctctgctc------ctgctgctgctgcggt------
A0A663MPN9_BCL2-01      ----ccccacagctcaccgcac----------------------------
A0A8C6ZF48_BCL2-01      gcctccccggcgctctcccctcctgctgctgctgctgctgctgc------
A0A8B9PRT7_BCL2-01      gcgtctccagggctctctcctc------ctgctgctgctgctct------
A0A8B9PRT7_BCL2-02      gcgtctccagggctctctcctc------ctgctgctgctgctct------
A0A8C0UAC7_BCL2-01      ctgtctccaggtctctctgctc------ctgc------------------
A0A8B9UYC3_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A8B9E2U6_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A8B9C4H4_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A8C3CIW8_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A493T1X3_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A8B9SFH3_BCL2-01      gcgcctacggctctc---gctc------ctgctgctgctgcggt------
A0A8D2P664_BCL2-01      ctgcctccagntctctctgttc----------------------------
A0A674GNG3_BCL2-01      ctgcctccagatcactccgctt------ctgctgctgctgcgat------
A0A674GNG3_BCL2-03      ctgcctccagatcactccgctt------ctgctgctgctgcgat------
A0A8C5TLV4_BCL2-01      ctgcctccaggtctctctgctc------ctgctgctgctgcggt------
A0A672TR23_BCL2-01      ctgcctccaggtctctctcctc---ctgctgctgctgctgc---------
A0A8C3JHE5_BCL2-01      ctgccaccaggtctctctcctc---ctgctgctgctgct-----------
A0A8C0BN28_BCL2-01      ctgcctccaggtctctctcctcctgctgctgctgctgctgcggttgccgc
A0A8B9RWH9_BCL2-01      ctgcctccgggtctctctcctcctgctgctgctgctgctgcggt------
A0A663FHR0_BCL2-01      ctgcctccgggtctctctcctcctcctgctgctgctgctgcggt------
A0A8C8ANG9_BCL2-01      ctgcctccgggtctctctcctc---ctgctgctgctgctgcggt------
A0A8C0IE77_BCL2-01      ctgcctccgggtctctctcctc---ctgctgctgctgctgcggt------
A0A8D0G0L7_BCL2-01      ctgcctccgggtctctctcctc---ctgctgctgctgctgcggt------
A0A8C4U538_BCL2-01      ctgcctccaggtctctctcctc---ctgctgctgctgctgcggt------
A0A8C4U538_BCL2-02      ctgcctccaggtctctctcctc---ctgctgctgctgctgcggt------
A0A8C3TNF2_BCL2-01      ctgcctccaggtctctctgctc------ctgctgctgctgcggt------
A0A8C3QX54_BCL2-01      ctgcctccaggtctctctgttc------ctgc------------------
A0A803VR88_BCL2-01      ctgcctccaggtctctctgctc------ctgctgctgctgcggt------
A0A803VR88_BCL2-02      ctgcctccaggtctctctgctc------ctgctgctgctgcggt------
A0A8C5IH35_BCL2-05      ctgtctccaggtctctctgctc---ctgctgctgctgctgcggt------
A0A8C5IH35_BCL2-04      ctgtctccaggtctctctgctc---ctgctgctgctgctgcggt------
A0A8C5IH35_BCL2-03      ctgtctccaggtctctctgctc---ctgctgctgctgctgcggt------
A0A8D2N8C6_BCL2-01      ctgtctccaggtctctctgctc---ctgctgctgctgctgcggt------
A0A8D0QLD9_BCL2-07      tgtctc--aagact----atag----------------------------
A0A4X1TRR9_BCL2-06      tgtctc--aagact----atag----------------------------
A0A8D0QLD9_BCL2-05      tgtctc--aagact----atag----------------------------
A0A4X1TRR9_BCL2-05      tgtctc--aagact----atag----------------------------
A0A8D0QLD9_BCL2-04      tgtctc--aagact----atag----------------------------
A0A4X1TRR9_BCL2-07      tgtctc--aagact----atag----------------------------
A0A8D0QLD9_BCL2-06      tgtctc--aagact----atag----------------------------
A0A4X1TRR9_BCL2-04      tgtctc--aagact----atag----------------------------
A0A4X1TRR9_BCL2-02      tgtctc--aagact----atag----------------------------
A0A8D0QLD9_BCL2-02      tgtctc--aagact----atag----------------------------
A0A8C6RID6_BCL2-01      cgcccctgggggcc----accc----------------------------
A0A8C6RID6_BCL2-02      cgcccctgggggcc----accc----------------------------
Q6R755_BCL2-01          cgcccctgggcgcc----gccc----------------------------
Q923R6_BCL2-01          cgcccctgggcgcc----gccc----------------------------
A0A8C8U7I9_BCL2-01      cgcccctgggggcc----gccc----------------------------
Q6NTH7_BCL2-01          cgcccctgggggct----gccc----------------------------
A0A8C6H5J8_BCL2-01      cgcccctgggggct----gccc----------------------------
Q7TSN8_BCL2-01          cgcccctgggggct----gccc----------------------------
A0A8I6AJ02_BCL2-01      cgcccctgagggct----gccc----------------------------
P49950_BCL2-01          cgcccctgagggct----gccc----------------------------
A0A4W2DSR6_BCL2-02      cgccccccggggcc----gctc----------------------------
A0A4W2DSR6_BCL2-02      cgccccccggggcc----gctc----------------------------
A0A8C6CUJ2_BCL2-01      cgccccccggggcc----gccc----------------------------
A0A4W2DSR6_BCL2-01      cgccccccggggcc----gctc----------------------------
A0A4W2DSR6_BCL2-01      cgccccccggggcc----gctc----------------------------
F6R2C4_BCL2-01          cgccccccggggcc----gctc----------------------------
O02718_BCL2-01          cgccccccggggcc----gctc----------------------------
A0A076FU27_BCL2-01      cgccccccggggcc----gccc----------------------------
A0A076FZV9_BCL2-01      cgccccccggggcc----gctc----------------------------
A0A452EV13_BCL2-01      cgccccccggggcc----gccc----------------------------
A0A8C5JYS0_BCL2-01      cgaccccgggagcc----accc----------------------------
G3SLZ1_BCL2-01          cgccccccggggcc----gctc----------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      -----------gcc----gcct----------------------------
A0A5F9CRQ4_BCL2-02      -----------gcc----gcct----------------------------
M3YYK3_BCL2-01          tgtacttacccacc----gccc----------------------------
A0A8D2AUF5_BCL2-01      cgcccccaggggcc----gccc----------------------------
I3MVK9_BCL2-01          cgtccccaggagcc----gccc----------------------------
A0A8C5YTS1_BCL2-01      cgtccccaggagcc----gccc----------------------------
A0A8D2IIB8_BCL2-01      cgtccccaggagcc----gccc----------------------------
A0A250YD83_BCL2-01      cgcccccggaggcc----accc----------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      cgccccccggggcc----gcgc----------------------------
A0A8C9HUK6_BCL2-02      cgacccctggggcc----gccc----------------------------
A0A2K5EB04_BCL2-01      cacccccaggggcc----gccc----------------------------
A0A2K6UEL3_BCL2-01      cgcccccaggcgcc----gccc----------------------------
A0A2R8MY14_BCL2-01      cgcccccaggggcc----gccc----------------------------
A0A2K6R2I5_BCL2-02      cgacccctggggcc----gccc----------------------------
A0A2K5HK49_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-04      cgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-10      cgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-05      cgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-08      cgcccccgggggcc----gccc----------------------------
A0A7N9CNB8_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A8D2EFR4_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A2K5XRD4_BCL2-01      cgacccctggggtc----gccc----------------------------
A0A2K5NZS5_BCL2-01      cgacccctggggtc----gccc----------------------------
A0A0D9S017_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A5F7ZZ15_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A2K6CIX3_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A096MPU7_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          cgcccccgggggcc----gccc----------------------------
A0A2K6KHG1_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A2K6R2I5_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A2J8W3J1_BCL2-01      cgcccccgggggcc----gcca----------------------------
A0A8C9HUK6_BCL2-01      cgacccctggggcc----gccc----------------------------
A0A2I3GZF9_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-06      cgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-07      cgcccccgggggcc----gccc----------------------------
A0A2R9APW6_BCL2-01      cgccc---------------------------------------------
G3QES9_BCL2-01          tgcccccgggggcc----gccc----------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          caccccccggggcc----gcca----------------------------
A0A8B7H1C6_BCL2-01      cgcccccgggggcc----gtcc----------------------------
A0A8C9AC52_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A2K6G3I7_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A3Q2HRY3_BCL2-02      cgcccctgggggcc----accc----------------------------
A0A8C4L1K6_BCL2-01      cgcccctgggggcc----accc----------------------------
A0A3Q2HRY3_BCL2-01      cgcccctgggggcc----accc----------------------------
A0A673VDM8_BCL2-01      cgcccccgggggtc----gccc----------------------------
A0A5F5Y6Y3_BCL2-02      cgcccccgggggcc----gccc----------------------------
A0A8C9J3W6_BCL2-01      nnnnnnnnnnnnnn----n-------------------------------
Q8I008_BCL2-01          cgcccccgggggcc----gccc----------------------------
A0A667GHH0_BCL2-01      cgccc---ggggcc----gccc----------------------------
A0A5F5Y6Y3_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A8C8XJU8_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A8C7B9K2_BCL2-01      cgcccccgggggcc----gccc----------------------------
G1LIC9_BCL2-01          ctcccccgggggcc----gccc----------------------------
A0A452R110_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A452R110_BCL2-02      cgcccccgggggcc----gccc----------------------------
A0A8C0NC28_BCL2-03      cgcccccgggggcc----gccc----------------------------
A0A8I3MLT5_BCL2-02      cgcccccgggggcc----gccc----------------------------
A0A8C0NC28_BCL2-02      cgcccccgggggcc----gccc----------------------------
Q75SV7_BCL2-01          cgcccccgggggcc----gccc----------------------------
A0A8C0KWE3_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A8C0NC28_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A8I3MLT5_BCL2-01      cgcccccgggggcc----gccc----------------------------
A0A8C6AXM8_BCL2-01      cgtccccgggggcc----gccc----------------------------
A0A8C9CJ69_BCL2-01      cgtccccgggggcc----gccc----------------------------
A0A8B8V3A7_BCL2-02      cgtccccgggggcc----gccc----------------------------
A0A8B8V3A7_BCL2-01      cgtccccgggggcc----gccc----------------------------
A0A8B8V3A7_BCL2-03      cgtccccgggggcc----gccc----------------------------
A0A8C3WCN0_BCL2-01      cgtccccgggggcc----gctc----------------------------
A0A8D0QLD9_BCL2-03      cgtccccgggggcc----gctc----------------------------
A0A4X1TRR9_BCL2-01      cgtccccgggggcc----gctc----------------------------
A0A8D0QLD9_BCL2-01      cgtccccgggggcc----gctc----------------------------
A0A4X1TRR9_BCL2-03      cgtccccgggggcc----gctc----------------------------
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      --------------------------------------------------
B9ZYL7_BCL2-01          ttctgatgatggagaaatgcctgctgcttccgc-----------------
A0A8C5MT36_BCL2-03      ttctgatggtgacgaagtgtccgcttcacctgg-----------------
A0A8C5MT36_BCL2-01      ttctgatggtgacgaagtgtccgcttcacctgg-----------------
A0A8C5MT36_BCL2-02      ttctgatggtgacgaagtgtccgcttcacctgg-----------------
A0A8C5MT36_BCL2-04      ttctgatggtgacgaagtgtccgcttcacctgg-----------------
A0A7M4G2E0_BCL2-01      -----------------------ctgatgctgatttgtgtt---------
A0A7M4G2E0_BCL2-02      -----------------------ctgatgctgatttgtgtt---------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7Q7B4_BCL2-01      --------------------------------------------------
A0A0U3DHY6_BCL2-01      --------------------------------------------------
A0A4W5NW18_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
A0A8C7RG50_BCL2-01      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A4W5KV00_BCL2-01      --------------------------------------------------
A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C5C4C3_BCL2-01      --------------------------------------------------
A0A3B4A3G8_BCL2-01      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      --------------------------------------------------
A0A8C7ZK61_BCL2-01      --------------------------------------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A665U7Y7_BCL2-01      --------------------------------------------------
A0A672HHE5_BCL2-01      --------------------------------------------------
A0A3Q3G1D7_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A3Q3MEY1_BCL2-01      --------------------------------------------------
A0A2U9BJ09_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A7N6A4C8_BCL2-01      --------------------------------------------------
A0A3Q0S5Z7_BCL2-01      --------------------------------------------------
A0A668TEB6_BCL2-05      --------------------------------------------------
A0A3P8QVM8_BCL2-01      --------------------------------------------------
A0A3P9DIG5_BCL2-01      --------------------------------------------------
A0A3Q2UYW8_BCL2-01      --------------------------------------------------
A0A3B4G3K4_BCL2-01      --------------------------------------------------
A0A4W6DDI0_BCL2-01      --------------------------------------------------
A0A1X9JZA1_BCL2-01      --------------------------------------------------
A0A3B4TX71_BCL2-01      --------------------------------------------------
A0A3B4YAG2_BCL2-01      --------------------------------------------------
A0A3B5BBQ0_BCL2-01      --------------------------------------------------
A0A3Q1B8C3_BCL2-01      --------------------------------------------------
A0A3P8S9L3_BCL2-01      --------------------------------------------------
A0A3Q1FLK7_BCL2-01      --------------------------------------------------
A0A673LV42_BCL2-01      -----------------------gagaggcgg------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      -----------------------gggaggcag------------------
A0A3B3TCS4_BCL2-01      -----------------------caataatgg------------------
A0A8C9T5U7_BCL2-01      -----------------------caataacgg------------------
W5N4F7_BCL2-01          -----------------------caataacgg------------------
H9GPE7_BCL2-01          -----------------------ctgctgcta------------------
A0A8D2Q1J0_BCL2-01      -----------------------atgtggcaa------------------
A0A8D2Q1J0_BCL2-03      -----------------------atgtggcaa------------------
A0A668TEB6_BCL2-01      -----------------------agtcaagtg------------------
A0A668TEB6_BCL2-04      -----------------------agtcaagtg------------------
A0A668TEB6_BCL2-02      -----------------------agtcaagtg------------------
A0A668TEB6_BCL2-03      -----------------------agtcaagtg------------------
A0A3Q3MEY1_BCL2-02      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-10      -----------------------agccaggtg------------------
A0A3Q3MEY1_BCL2-08      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-04      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-05      -----------------------tttgctgt-------------------
A0A3Q3MEY1_BCL2-07      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-09      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-03      -----------------------aatcaggtg------------------
A0A3Q3MEY1_BCL2-06      -----------------------aatcaggtg------------------
A0A7N6A4C8_BCL2-02      -----------------------agtcaggtg------------------
A0A7N6A4C8_BCL2-04      -----------------------agtcaggtg------------------
A0A7N6A4C8_BCL2-07      -----------------------agtcaggtg------------------
A0A7N6A4C8_BCL2-05      -----------------------agtcaggtg------------------
A0A7N6A4C8_BCL2-03      -----------------------agtcaggtg------------------
A0A7N6A4C8_BCL2-06      -----------------------agtcaggtg------------------
A0A8C2X310_BCL2-01      -----------------------agccaggtg------------------
A0A8C2X310_BCL2-02      -----------------------agccaggtg------------------
A0A8C2X310_BCL2-04      -----------------------agccaggtg------------------
A0A8C2X310_BCL2-05      -----------------------gacctactg------------------
A0A8C2X310_BCL2-03      -----------------------gacctactg------------------
A0A8C9ZFJ5_BCL2-01      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-05      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-06      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-02      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-03      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      -----------------------agccaggtg------------------
A0A8C9ZFJ5_BCL2-08      -----------------------agccaggtg------------------
A0A674GNG3_BCL2-02      -----------------------ctgttgatgtctcgaaagactacgaac
A0A674GNG3_BCL2-04      -----------------------ctgttgatgtctcgaaagactacgaac
A0A8C5IH35_BCL2-01      -----------------------ctgttgatgtgtctaaagactatgaac
A0A8C5IH35_BCL2-02      -----------------------ctgttgatgtgtctaaagactatgaac
A0A670IB81_BCL2-01      -----------------------ctgctgcag------------------
A0A8D0BPX3_BCL2-01      -----------------------ctgctactg------------------
A0A8D2Q1J0_BCL2-02      -----------------------ctcctgctg------------------
A0A8C5S4J3_BCL2-01      -----------------------ctgctgttg------------------
A0A670ZV01_BCL2-01      -----------------------ctgctgttg------------------
A0A8D0L5Z6_BCL2-01      -----------------------ctgctacgg------------------
A0A7M4EPU7_BCL2-01      -----------------------ctgctgctg------------------
A0A7M4G2E0_BCL2-03      -----------------------ctgctgctg------------------
A0A8C8SWU7_BCL2-01      -----------------------ctgctgctg------------------
K7F5Y3_BCL2-02          -----------------------ctgctgctg------------------
K7F5Y3_BCL2-01          -----------------------ctgctgctg------------------
K7F5Y3_BCL2-03          -----------------------ctgctg---------------------
A0A452I9V7_BCL2-01      -----------------------ctgttactg------------------
A0A8C3SV21_BCL2-01      -----------------------ctgctgctg------------------
A0A8C3ITE1_BCL2-01      -----------------------ctgttgctg------------------
A0A674IMR0_BCL2-01      -----------------------ctgttgctg------------------
A0A8C0G2Q6_BCL2-01      -----------------------ctgctactg------------------
A0A8C4VT25_BCL2-01      -----------------------ctgctactg------------------
A0A7N4PQN7_BCL2-01      -----------------------ctgctgttg------------------
F6YNL8_BCL2-01          -----------------------ctgctgttg------------------
A0A4X2L5Q0_BCL2-01      -----------------------ctgctgttg------------------
A0A8C2U1A2_BCL2-01      ---------------------ggctgctgctg------------------
A0A8C9L7I6_BCL2-01      ---------------------ggctgctgctg------------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      ---------------------ggctgctgctg------------------
A0A669PDH6_BCL2-01      ---------------------ggctgctgctg------------------
A0A8C9MG30_BCL2-01      ------------------tgctgctgctgctg------------------
A0A663MPN9_BCL2-01      ------------------------ttttccaa------------------
A0A8C6ZF48_BCL2-01      ---------------tgctcctgctgctgctg------------------
A0A8B9PRT7_BCL2-01      ---------------------tgctgctgctg------------------
A0A8B9PRT7_BCL2-02      ---------------------tgctgctgctg------------------
A0A8C0UAC7_BCL2-01      ---------------------tgctgctgctg------------------
A0A8B9UYC3_BCL2-01      ---------------------tgctgctgctg------------------
A0A8B9E2U6_BCL2-01      ---------------------tgctgctgctg------------------
A0A8B9C4H4_BCL2-01      ---------------------tgctgctgctg------------------
A0A8C3CIW8_BCL2-01      ---------------------tgctgctgctg------------------
A0A493T1X3_BCL2-01      ---------------------tgctgctgctg------------------
A0A8B9SFH3_BCL2-01      ---------------------tgctgctgctg------------------
A0A8D2P664_BCL2-01      --------------------ctgctgctgctg------------------
A0A674GNG3_BCL2-01      ------tgctgctgctgcgattgctgctgctg------------------
A0A674GNG3_BCL2-03      ------tgctgctgctgcgattgctgctgctg------------------
A0A8C5TLV4_BCL2-01      ------------------tgctgctgctgctg------------------
A0A672TR23_BCL2-01      ---------tgctgcggttgctgctgctgctg------------------
A0A8C3JHE5_BCL2-01      ----------------gctgctgctgctgctg------------------
A0A8C0BN28_BCL2-01      tgctgctgctgctgctgctgctgctgctgctg------------------
A0A8B9RWH9_BCL2-01      tgctgctgctgctgctgctgctgctgctgctg------------------
A0A663FHR0_BCL2-01      ------tgctgctgctgctgctgctgctgctg------------------
A0A8C8ANG9_BCL2-01      ---------cgctgctgctgctgctgctgctg------------------
A0A8C0IE77_BCL2-01      ---------cgctgctgctgctgctgctgctg------------------
A0A8D0G0L7_BCL2-01      ---------c------gctgctgctgctgctg------------------
A0A8C4U538_BCL2-01      ------------tgctgctgctgctgctgctg------------------
A0A8C4U538_BCL2-02      ------------tgctgctgctgctgctgctg------------------
A0A8C3TNF2_BCL2-01      ------------------tgctgctgctgctg------------------
A0A8C3QX54_BCL2-01      ------------------tgctgctgctgctg------------------
A0A803VR88_BCL2-01      ------------------tgctgctgctgctg------------------
A0A803VR88_BCL2-02      ------------------tgctgctgctgctg------------------
A0A8C5IH35_BCL2-05      ---------------------tgctgctgctg------------------
A0A8C5IH35_BCL2-04      ---------------------tgctgctgctg------------------
A0A8C5IH35_BCL2-03      ---------------------tgctgctgctg------------------
A0A8D2N8C6_BCL2-01      ---------------------tgctgctgctg------------------
A0A8D0QLD9_BCL2-07      -----------------------ccaagtaga------------------
A0A4X1TRR9_BCL2-06      -----------------------ccaagtaga------------------
A0A8D0QLD9_BCL2-05      -----------------------ccaagtaga------------------
A0A4X1TRR9_BCL2-05      -----------------------ccaagtaga------------------
A0A8D0QLD9_BCL2-04      -----------------------ccaagtaga------------------
A0A4X1TRR9_BCL2-07      -----------------------ccaagtaga------------------
A0A8D0QLD9_BCL2-06      -----------------------ccaagtaga------------------
A0A4X1TRR9_BCL2-04      -----------------------ccaagtaga------------------
A0A4X1TRR9_BCL2-02      -----------------------ccaagtaga------------------
A0A8D0QLD9_BCL2-02      -----------------------ccaagtaga------------------
A0A8C6RID6_BCL2-01      -----------------------ccgccccgg------------------
A0A8C6RID6_BCL2-02      -----------------------ccgccccgg------------------
Q6R755_BCL2-01          -----------------------ccacccctg------------------
Q923R6_BCL2-01          -----------------------ccacccctg------------------
A0A8C8U7I9_BCL2-01      -----------------------ccacccctg------------------
Q6NTH7_BCL2-01          -----------------------ccacccctg------------------
A0A8C6H5J8_BCL2-01      -----------------------ccacccctg------------------
Q7TSN8_BCL2-01          -----------------------ccacccctg------------------
A0A8I6AJ02_BCL2-01      -----------------------ccacccctg------------------
P49950_BCL2-01          -----------------------ccacccctg------------------
A0A4W2DSR6_BCL2-02      -----------------------ccgcgccgg------------------
A0A4W2DSR6_BCL2-02      -----------------------ccgcgccgg------------------
A0A8C6CUJ2_BCL2-01      -----------------------ccgcgccgg------------------
A0A4W2DSR6_BCL2-01      -----------------------ccgcgccgg------------------
A0A4W2DSR6_BCL2-01      -----------------------ccgcgccgg------------------
F6R2C4_BCL2-01          -----------------------ccgcgccgg------------------
O02718_BCL2-01          -----------------------ccgcgccgg------------------
A0A076FU27_BCL2-01      -----------------------ccgcgccgg------------------
A0A076FZV9_BCL2-01      -----------------------ccgcgccgg------------------
A0A452EV13_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C5JYS0_BCL2-01      -----------------------ccgcgccgg------------------
G3SLZ1_BCL2-01          -----------------------ccgcgccgg------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          --------------------------------------------------
A0A5F9CRQ4_BCL2-01      -----------------------ccgcgccgg------------------
A0A5F9CRQ4_BCL2-02      -----------------------ccgcgccgg------------------
M3YYK3_BCL2-01          -----------------------cccccccac------------------
A0A8D2AUF5_BCL2-01      -----------------------ccgtgccgg------------------
I3MVK9_BCL2-01          -----------------------ccgggccgg------------------
A0A8C5YTS1_BCL2-01      -----------------------ccgggccgg------------------
A0A8D2IIB8_BCL2-01      -----------------------ccgggccgg------------------
A0A250YD83_BCL2-01      -----------------------cagcgccgg------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      -----------------------ccacgccgg------------------
A0A8C9HUK6_BCL2-02      -----------------------ccgcaccgg------------------
A0A2K5EB04_BCL2-01      -----------------------ccgcgccgg------------------
A0A2K6UEL3_BCL2-01      -----------------------ccgcgccgg------------------
A0A2R8MY14_BCL2-01      -----------------------ccgcggagg------------------
A0A2K6R2I5_BCL2-02      -----------------------ccgcaccgg------------------
A0A2K5HK49_BCL2-01      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-04      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-10      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-05      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-08      -----------------------ccgcaccgg------------------
A0A7N9CNB8_BCL2-01      -----------------------ccgcaccgg------------------
A0A8D2EFR4_BCL2-01      -----------------------ccgcaccgg------------------
A0A2K5XRD4_BCL2-01      -----------------------ccgcaccgg------------------
A0A2K5NZS5_BCL2-01      -----------------------ccgcaccgg------------------
A0A0D9S017_BCL2-01      -----------------------ccgcaccgg------------------
A0A5F7ZZ15_BCL2-01      -----------------------ccgcaccgg------------------
A0A2K6CIX3_BCL2-01      -----------------------ccgcaccgg------------------
A0A096MPU7_BCL2-01      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -----------------------ccgcaccgg------------------
A0A2K6KHG1_BCL2-01      -----------------------ccgcaccgg------------------
A0A2K6R2I5_BCL2-01      -----------------------ccgcaccgg------------------
A0A2J8W3J1_BCL2-01      -----------------------ccgcacccg------------------
A0A8C9HUK6_BCL2-01      -----------------------ccgcaccgg------------------
A0A2I3GZF9_BCL2-01      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-06      -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-07      -----------------------ccgcaccgg------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          -----------------------ccgcaccgg------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -----------------------ctgcgccgg------------------
A0A8B7H1C6_BCL2-01      -----------------------ccgcacctg------------------
A0A8C9AC52_BCL2-01      -----------------------ccgcgccgg------------------
A0A2K6G3I7_BCL2-01      -----------------------ccacgccgg------------------
A0A3Q2HRY3_BCL2-02      -----------------------ccgtgccgg------------------
A0A8C4L1K6_BCL2-01      -----------------------ccgtgccgg------------------
A0A3Q2HRY3_BCL2-01      -----------------------ccgtgccgg------------------
A0A673VDM8_BCL2-01      -----------------------ccgcgccgg------------------
A0A5F5Y6Y3_BCL2-02      -----------------------ccgcgccgg------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          -----------------------ccgcgccgg------------------
A0A667GHH0_BCL2-01      -----------------------ccgcgccgg------------------
A0A5F5Y6Y3_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C8XJU8_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C7B9K2_BCL2-01      -----------------------ccgcgccgg------------------
G1LIC9_BCL2-01          -----------------------ccgcgccgg------------------
A0A452R110_BCL2-01      -----------------------ccgcgccgg------------------
A0A452R110_BCL2-02      -----------------------ccgcgccgg------------------
A0A8C0NC28_BCL2-03      -----------------------ccgcgccgg------------------
A0A8I3MLT5_BCL2-02      -----------------------ccgcgccgg------------------
A0A8C0NC28_BCL2-02      -----------------------ccgcgccgg------------------
Q75SV7_BCL2-01          -----------------------ccgcgccgg------------------
A0A8C0KWE3_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C0NC28_BCL2-01      -----------------------ccgcgccgg------------------
A0A8I3MLT5_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C6AXM8_BCL2-01      -----------------------ccgcgccgg------------------
A0A8C9CJ69_BCL2-01      -----------------------ccgcgccgg------------------
A0A8B8V3A7_BCL2-02      -----------------------ccgcgccag------------------
A0A8B8V3A7_BCL2-01      -----------------------ccgcgccag------------------
A0A8B8V3A7_BCL2-03      -----------------------ccgcgccag------------------
A0A8C3WCN0_BCL2-01      -----------------------ccgcaccgg------------------
A0A8D0QLD9_BCL2-03      -----------------------ccgcaccgg------------------
A0A4X1TRR9_BCL2-01      -----------------------ccgcaccgg------------------
A0A8D0QLD9_BCL2-01      -----------------------ccgcaccgg------------------
A0A4X1TRR9_BCL2-03      -----------------------ccgcaccgg------------------
                                                                          

A3KNH9_BCL2-01          -------gcagtggaggaatcctctccaaa--------------ctctga
Q564A4_BCL2-01          -------gcagtggaggaatcctctccaaa--------------ctctga
X4ZGI8_BCL2-01          -------ggagtggaggactcctctccgag--------------ctctga
A0A673HVU7_BCL2-01      -------ggaatcgagggttcctctctaaa--------------ctctgg
A0A4W4F7Z4_BCL2-01      -------gga---------------gcggcgatgtcaagcaagcacaga-
B9ZYL7_BCL2-01          -------aga---------ttcacgtggaccacctca------gtcttca
A0A8C5MT36_BCL2-03      -------aga---------tccacttggaccacgtcacgacacacctctg
A0A8C5MT36_BCL2-01      -------aga---------tccacttggaccacgtcacgacacacctctg
A0A8C5MT36_BCL2-02      -------aga---------tccacttggaccacgtcacgacacacctctg
A0A8C5MT36_BCL2-04      -------aga---------tccacttggaccacgtcacgacacacctctg
A0A7M4G2E0_BCL2-01      -------gca---------gctgcccagacagcca---------tttcag
A0A7M4G2E0_BCL2-02      -------gca---------gctgcccagacagcca---------tttcag
A0A673Z0A3_BCL2-01      -------ggg---------agccctctccc--------------cctaac
A0A8C7CHJ0_BCL2-01      -------ggg---------agccctctccc--------------cctaac
A0A8C7Q7B4_BCL2-01      -------ggg---------agccctctccc--------------cctaac
A0A0U3DHY6_BCL2-01      -------ggg---------acccctctaca--------------cccaac
A0A4W5NW18_BCL2-01      -------ggg---------acccctctgca--------------ccgaac
A0A674B8T7_BCL2-01      -------ggg---------acccctctaca--------------cccaac
A0A8C7RG50_BCL2-01      -------ggg---------acccctctaca--------------cccaac
A0A8C8GL24_BCL2-01      -------ggg---------acccctctaca--------------cccaac
A0A6Q2YIU6_BCL2-01      -------atg---------atttctcctcc--------------gccggg
A0A4W5KV00_BCL2-01      -------atg---------atttctcctcg--------------cccggg
A0A8C7G8X1_BCL2-01      -------atg---------atttctcctcg--------------gccggg
A0A674B0E5_BCL2-01      -------atg---------atttctcctcg--------------gctggg
A0A8C8JWJ1_BCL2-02      -------atg---------atttctcctcc--------------gcctgg
A0A8C7N3I9_BCL2-01      -------atg---------atttctcctcc--------------gcctgg
A0A8C8JWJ1_BCL2-01      -------atg---------atttctcctcc--------------gcctgg
A0A8C5C4C3_BCL2-01      -------atc---------atcgctcctcc--------------accgac
A0A3B4A3G8_BCL2-01      -------ata---------gttgcatcttc--------------tccggt
A0A3Q3B0R2_BCL2-01      -------gtg---------gcgagccagtc--------------cccgac
A0A8C7ZK61_BCL2-01      -------gtt---------ggggaccattc--------------cccgac
A0A3P8WUE9_BCL2-01      -------ata---------gtttcccgtcc--------------accgac
A0A665U7Y7_BCL2-01      -------ata---------gttgccccatc--------------cccgac
A0A672HHE5_BCL2-01      -------cta---------gttgaccccga--------------gccgac
A0A3Q3G1D7_BCL2-01      -------tta---------gttgcccctcc--------------gccgac
A0A8C2X310_BCL2-06      -------ata---------gttgtcccgcc--------------gccgac
A0A3Q3MEY1_BCL2-01      -------gta---------gttgcccctcc--------------gccgac
A0A2U9BJ09_BCL2-01      -------ata---------gttgcccctcc--------------accgac
A0A8C9ZFJ5_BCL2-09      -------ata---------gttgtccctcc--------------accgag
A0A7N6A4C8_BCL2-01      -------gca---------gttccccctcc--------------accgac
A0A3Q0S5Z7_BCL2-01      -------ata---------aatgaccctcc--------------accgac
A0A668TEB6_BCL2-05      -------ata---------actgaccctcc--------------accgac
A0A3P8QVM8_BCL2-01      -------ata---------actgaccctcc--------------accgac
A0A3P9DIG5_BCL2-01      -------ata---------actgaccctcc--------------accgac
A0A3Q2UYW8_BCL2-01      -------ata---------actgaccctcc--------------accgac
A0A3B4G3K4_BCL2-01      -------ata---------actgaccctcc--------------accgac
A0A4W6DDI0_BCL2-01      -------ata---------gtttcccctcc--------------gccgac
A0A1X9JZA1_BCL2-01      -------ata---------gttgcccctcc--------------accgag
A0A3B4TX71_BCL2-01      -------ata---------gttgcccctcc--------------accgac
A0A3B4YAG2_BCL2-01      -------ata---------gttgcccctcc--------------accgac
A0A3B5BBQ0_BCL2-01      -------gta---------gttgaccctcc--------------gccgac
A0A3Q1B8C3_BCL2-01      -------gta---------gtggaccctcc--------------gccgac
A0A3P8S9L3_BCL2-01      -------gta---------gtggaccctcc--------------gccgac
A0A3Q1FLK7_BCL2-01      -------gta---------gttgaccctcc--------------gccgac
A0A673LV42_BCL2-01      -------gag----------------------------------------
A0A8C1IQE4_BCL2-01      -------gag----------------------------------------
A0A672T179_BCL2-01      -------gag----------------------------------------
A0A3B3TCS4_BCL2-01      -atcggtgga-------------ctcc-----------------------
A0A8C9T5U7_BCL2-01      -attaacgga-------------ctccggc-----tcg------cccggc
W5N4F7_BCL2-01          -attggtggg----------cccctccgcc---------tcgggtccggg
H9GPE7_BCL2-01          --------------------ctcctagtgc--------------tccaac
A0A8D2Q1J0_BCL2-01      -------ggg-----------ttctaaaacaggctcaagagaagttgggt
A0A8D2Q1J0_BCL2-03      -------ggg-----------ttctaaaacaggctcaagagaagttgggt
A0A668TEB6_BCL2-01      -------gaaaa-------cgtgataaaacaggctcaagaaaagctaggt
A0A668TEB6_BCL2-04      -------gaaaa-------cgtgataaaacaggctcaagaaaagctaggt
A0A668TEB6_BCL2-02      -------gaaaa-------cgtgataaaacaggctcaagaaaagctaggt
A0A668TEB6_BCL2-03      -------gaaaa-------cgtgataaaacaggctcaagaaaagctaggt
A0A3Q3MEY1_BCL2-02      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-10      -------aaaa-------------------acgctcaagaaaagctggga
A0A3Q3MEY1_BCL2-08      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-04      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-05      -------------------tgtg------caggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-07      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-09      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-03      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A3Q3MEY1_BCL2-06      -------gaaag-------tgtgataaaacaggctcaagaaaagctggga
A0A7N6A4C8_BCL2-02      -------gaaag-------tgtgataaaacaggctcaagagaagctggga
A0A7N6A4C8_BCL2-04      -------gaaag-------tgtgataaaaca-------------------
A0A7N6A4C8_BCL2-07      -------gaaag-------tgtgataaaacaggctcaagagaagctggga
A0A7N6A4C8_BCL2-05      -------gaaag-------tgtgataaaacaggctcaagagaagctggga
A0A7N6A4C8_BCL2-03      -------gaaag-------tgtgataaaacaggctcaagagaagctggga
A0A7N6A4C8_BCL2-06      -------gaaag-------tgtgataaaacaggctcaagagaagctggga
A0A8C2X310_BCL2-01      -------gaaag-------tgtgataaagcaggctcaggagaagctgggg
A0A8C2X310_BCL2-02      -------gaaag-------tgtgataaagcaggctcaggagaagctgggg
A0A8C2X310_BCL2-04      -------gaaag-------tgtgataaagcaggctcaggagaagctgggg
A0A8C2X310_BCL2-05      -------gagtggctttttttctgttgcgcaggctcaggagaagctgggg
A0A8C2X310_BCL2-03      -------gagtggctttttttctgttgcgcaggctcaggagaagctgggg
A0A8C9ZFJ5_BCL2-01      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-05      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-06      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-02      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-03      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-04      --------------------------aaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-07      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A8C9ZFJ5_BCL2-08      -------gaaag-------tgtgataaaacaggctcaagagaagctgggt
A0A674GNG3_BCL2-02      aggtggagaa---------tgttctcaaacaggctcaggagaagttgggg
A0A674GNG3_BCL2-04      aggtggagaa---------tgttctcaaacaggctcaggagaagttgggg
A0A8C5IH35_BCL2-01      aagtggaaaa---------tgttctaaaacaggctcaggagaagttgggg
A0A8C5IH35_BCL2-02      aagtggaaaa---------tgttctaaaacaggctcaggagaagttgggg
A0A670IB81_BCL2-01      -------aga---------ccttccctaac-----ctt------gctagg
A0A8D0BPX3_BCL2-01      -------aga---------ccttccatacc-----ctt------actggt
A0A8D2Q1J0_BCL2-02      -------gga---------gcatccctgcc-----ctt------gctggg
A0A8C5S4J3_BCL2-01      -------gga---------cctttcctgcc-----ctt------ggagga
A0A670ZV01_BCL2-01      -------gga---------cctttcctgcc-----ctt------ggagga
A0A8D0L5Z6_BCL2-01      -------gca---------cttcctctgac-----cat------ggtggg
A0A7M4EPU7_BCL2-01      -------gga---------cttcctctgac-----aat------actggg
A0A7M4G2E0_BCL2-03      -------gga---------cttcctctgac-----cat------gctggg
A0A8C8SWU7_BCL2-01      -------gaa---------cctcatctgac-----cct------gctggg
K7F5Y3_BCL2-02          -------gga---------ccccatctgac-----cat------gctggg
K7F5Y3_BCL2-01          -------gga---------ccccatctgac-----cat------gctggg
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      -------gga---------cctcatctgac-----cat------gctggg
A0A8C3SV21_BCL2-01      -------gga---------cctcatctgac-----cct------gctggg
A0A8C3ITE1_BCL2-01      -------gga---------cctcatctgac-----cat------gctggg
A0A674IMR0_BCL2-01      -------gga---------cctcatctgac-----cat------gctggg
A0A8C0G2Q6_BCL2-01      -------gga---------cctcatctgac-----cat------gctggg
A0A8C4VT25_BCL2-01      -------gga---------cctcatctgac-----cat------gctggg
A0A7N4PQN7_BCL2-01      -------gaa---------tcttctctaac-----cag------ccaaga
F6YNL8_BCL2-01          -------gaa---------tcttctctacc-----cag------ccacga
A0A4X2L5Q0_BCL2-01      -------ggg---------tcttctctacc-----cag------ccaaga
A0A8C2U1A2_BCL2-01      -------gag---------cctcctcccac-----cac------------
A0A8C9L7I6_BCL2-01      -------gag---------cctcctcccat-----cac------------
G1MZW1_BCL2-01          --------------------------------------------------
A0A8C3LBC4_BCL2-01      -------gag---------cctcctcccac-----cac------------
A0A669PDH6_BCL2-01      -------gag---------cctcctcccac-----cac------------
A0A8C9MG30_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A663MPN9_BCL2-01      -------gtc---------tctcccacaga-----cac------gatgcg
A0A8C6ZF48_BCL2-01      -------gga---------ctccctctgat-----cac------actggg
A0A8B9PRT7_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8B9PRT7_BCL2-02      -------gga---------cttcctctgat-----cac------actggg
A0A8C0UAC7_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8B9UYC3_BCL2-01      -------gga---------ctccctcccgc-----caccgccccgccggg
A0A8B9E2U6_BCL2-01      -------gga---------ctccctcccgc-----caccgccctgccggg
A0A8B9C4H4_BCL2-01      -------gga---------ctccctcccgc-----caccgccctgccggg
A0A8C3CIW8_BCL2-01      -------gga---------ctccctcccgc-----caccgccccgccggg
A0A493T1X3_BCL2-01      -------gga---------ctccctcccgc-----caccgccccgccggg
A0A8B9SFH3_BCL2-01      -------gga---------ctccctcccgc-----caccgccccgccggg
A0A8D2P664_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A674GNG3_BCL2-01      -------gga---------ct---tctgat-----cac------actggg
A0A674GNG3_BCL2-03      -------gga---------ct---tctgat-----cac------actggg
A0A8C5TLV4_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A672TR23_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C3JHE5_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C0BN28_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8B9RWH9_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A663FHR0_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C8ANG9_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C0IE77_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8D0G0L7_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C4U538_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C4U538_BCL2-02      -------gga---------cttcctctgat-----cac------actggg
A0A8C3TNF2_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A8C3QX54_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A803VR88_BCL2-01      -------gga---------cttcctctgat-----cac------actggg
A0A803VR88_BCL2-02      -------gga---------cttcctctgat-----cac------actggg
A0A8C5IH35_BCL2-05      -------gga---------cttcctctgat-----cac------actggg
A0A8C5IH35_BCL2-04      -------gga---------cttcctctgat-----cac------actggg
A0A8C5IH35_BCL2-03      -------gga---------cttcctctgat-----cac------actggg
A0A8D2N8C6_BCL2-01      -------gga---------ctntcttt--t-----cct------tatgga
A0A8D0QLD9_BCL2-07      -------gaa---------tgtcataaaac-----aag------cacagg
A0A4X1TRR9_BCL2-06      -------gaa---------tgtcataaaac-----aag------cacagg
A0A8D0QLD9_BCL2-05      -------gaa---------tgtcataaaac-----aag------cacagg
A0A4X1TRR9_BCL2-05      -------gaa---------tgtcataaaac-----aag------cacagg
A0A8D0QLD9_BCL2-04      -------gaa---------tgtcataaaac-----aag------cacagg
A0A4X1TRR9_BCL2-07      -------gaa---------tgtcataaaac-----aag------cacagg
A0A8D0QLD9_BCL2-06      -------gaa---------tgtcataaaac-----aag------cacagg
A0A4X1TRR9_BCL2-04      -------gaa---------tgtcataaaac-----aag------cacagg
A0A4X1TRR9_BCL2-02      -------gaa---------tgtcataaaac-----aag------cacagg
A0A8D0QLD9_BCL2-02      -------gaa---------tgtcataaaac-----aag------cacagg
A0A8C6RID6_BCL2-01      -------gca---------tcttttcttcc-----ttg------cctggg
A0A8C6RID6_BCL2-02      -------gca---------tcttttcttcc-----ttg------cctggg
Q6R755_BCL2-01          -------gca---------tcttctccttc-----cag------cctgag
Q923R6_BCL2-01          -------gca---------tcttctccttc-----cag------cctgag
A0A8C8U7I9_BCL2-01      -------gca---------tcttctccttc-----cag------ccccag
Q6NTH7_BCL2-01          -------gca---------tcttctccttc-----cag------cctgag
A0A8C6H5J8_BCL2-01      -------gca---------tcttctccttc-----cag------cctgag
Q7TSN8_BCL2-01          -------gca---------tcttctccttc-----cag------cctgag
A0A8I6AJ02_BCL2-01      -------gca---------tcttctccttc-----cag------cctgag
P49950_BCL2-01          -------gca---------tcttctccttc-----cag------cctgag
A0A4W2DSR6_BCL2-02      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A4W2DSR6_BCL2-02      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A8C6CUJ2_BCL2-01      -------gca---------ccctgtccgcc-----gcg------ccgggc
A0A4W2DSR6_BCL2-01      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A4W2DSR6_BCL2-01      -------gca---------tcctgtcctcc-----cag------ccgggc
F6R2C4_BCL2-01          -------gca---------tcctgtcctcc-----cag------ccgggc
O02718_BCL2-01          -------gca---------tcctgtcctcc-----cag------ccgggc
A0A076FU27_BCL2-01      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A076FZV9_BCL2-01      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A452EV13_BCL2-01      -------gca---------tcctgtcctcc-----cag------ccgggc
A0A8C5JYS0_BCL2-01      -------gca---------tcttctcctcc-----cag------cctggg
G3SLZ1_BCL2-01          -------gcg---------tcctctcttct-----ccg------cccg--
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          -------------------------------------a------ctgggt
A0A5F9CRQ4_BCL2-01      -------gcg---------tcttctcctcc-----cag------cccg--
A0A5F9CRQ4_BCL2-02      -------gcg---------tcttctcctcc-----cag------cccg--
M3YYK3_BCL2-01          -------ccc---------ccctctcccgc-----cac------cgc---
A0A8D2AUF5_BCL2-01      -------gca---------tcttctcttcc-----cag------cccggc
I3MVK9_BCL2-01          -------gca---------tcttctcttcc-----caa------ccgggg
A0A8C5YTS1_BCL2-01      -------gca---------tcttctcttcc-----caa------ccggg-
A0A8D2IIB8_BCL2-01      -------gca---------tcttctcttcc-----caa------ccgggg
A0A250YD83_BCL2-01      -------gca---------tcttctccttc-----cag------cccggg
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      -------gca---------tcttctccttc-----cag------cccggg
A0A8C9HUK6_BCL2-02      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K5EB04_BCL2-01      -------gca---------tcttctcctcc-----cag------cctgga
A0A2K6UEL3_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2R8MY14_BCL2-01      -------gca---------tcttctcttcc-----cag------cccggg
A0A2K6R2I5_BCL2-02      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K5HK49_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-04      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-10      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-05      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-08      -------gca---------tcttctcctcc-----cag------cccggg
A0A7N9CNB8_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8D2EFR4_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K5XRD4_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K5NZS5_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A0D9S017_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A5F7ZZ15_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K6CIX3_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A096MPU7_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -------gca---------tcttctcctcc-----cag------cccggg
A0A2K6KHG1_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2K6R2I5_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2J8W3J1_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8C9HUK6_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A2I3GZF9_BCL2-01      -------gca---------tcttctcctcc-----cag------ccgggg
A0A7I2V3S7_BCL2-06      -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-07      -------gca---------tcttctcctcc-----cag------cccggg
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          -------gca---------tcttctcctcc-----cag------cccggg
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -------gcg---------tcttctcctcc-----cag------cccggg
A0A8B7H1C6_BCL2-01      -------gca---------tcttctcttcc-----cag------cccggg
A0A8C9AC52_BCL2-01      -------gta---------tcttctcttcc-----cag------cccggg
A0A2K6G3I7_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A3Q2HRY3_BCL2-02      -------gca---------tcttctcctcc-----cag------cccggg
A0A8C4L1K6_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A3Q2HRY3_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A673VDM8_BCL2-01      -------gca---------tctcctcctcc-----cag------cccggg
A0A5F5Y6Y3_BCL2-02      -------gca---------tcttctcctcc-----cag------cccggg
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          -------gca---------tcttctcctcc-----cag------cccggg
A0A667GHH0_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A5F5Y6Y3_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8C8XJU8_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8C7B9K2_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
G1LIC9_BCL2-01          -------gca---------tcttctcctcc-----cag------cccggg
A0A452R110_BCL2-01      -------gca---------tcttctcctcc-----cag------cctggg
A0A452R110_BCL2-02      -------gca---------tcttctcctcc-----cag------cctggg
A0A8C0NC28_BCL2-03      -------gca---------tctccgcctcg-----cag------cccggc
A0A8I3MLT5_BCL2-02      -------gca---------tctccgcctcg-----cag------cccggc
A0A8C0NC28_BCL2-02      -------gca---------tctccgcctcg-----cag------cccggc
Q75SV7_BCL2-01          -------gca---------tcttctcctcg-----cag------cccggc
A0A8C0KWE3_BCL2-01      -------gca---------tctccgcctcg-----cag------cccggc
A0A8C0NC28_BCL2-01      -------gca---------tctccgcctcg-----cag------cccggc
A0A8I3MLT5_BCL2-01      -------gca---------tctccgcctcg-----cag------cccggc
A0A8C6AXM8_BCL2-01      -------gca---------tcttctcctcc-----cag------cctggg
A0A8C9CJ69_BCL2-01      -------gca---------tcttctcctcc-----cag------cctggg
A0A8B8V3A7_BCL2-02      -------gca---------tcttctcctcc-----cag------cctggg
A0A8B8V3A7_BCL2-01      -------gca---------tcttctcctcc-----cag------cctggg
A0A8B8V3A7_BCL2-03      -------gca---------tcttctcctcc-----cag------cctggg
A0A8C3WCN0_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8D0QLD9_BCL2-03      -------gca---------tcttctcctcc-----cag------cccggg
A0A4X1TRR9_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A8D0QLD9_BCL2-01      -------gca---------tcttctcctcc-----cag------cccggg
A0A4X1TRR9_BCL2-03      -------gca---------tcttctcctcc-----cag------cccggg
                                                                          

A3KNH9_BCL2-01          c--aggaggcttcaggctccctcagccg----------------------
Q564A4_BCL2-01          c--aggaggcttcaggctccctcagccg----------------------
X4ZGI8_BCL2-01          c--aggaggctccaggctccctcagccg----------------------
A0A673HVU7_BCL2-01      c--aggaggcttcaggctccctcagccg----------------------
A0A4W4F7Z4_BCL2-01      --cgaggaagagaccgttcaccgagc------------------------
B9ZYL7_BCL2-01          ctcgcatctgctgcttcctcagatgaggaaaccccaagtaata-------
A0A8C5MT36_BCL2-03      aatgctgctgcttctacgtcaaataatgcatcccaaaataatg-------
A0A8C5MT36_BCL2-01      aatgctgctgcttctacgtcaaataatgcatcccaaaataatg-------
A0A8C5MT36_BCL2-02      aatgctgctgcttctacgtcaaataatgcatcccaaaataatg-------
A0A8C5MT36_BCL2-04      aatgctgctgcttctacgtcaaataatgcatcccaaaataatg-------
A0A7M4G2E0_BCL2-01      gctacacctccatcggcggcttgggaatgggctccttcagcctggatacc
A0A7M4G2E0_BCL2-02      gctacacctccatcggcggcttgggaatgggctccttcagcctggatacc
A0A673Z0A3_BCL2-01      tcccctgaagtttttgcacggag---------------------------
A0A8C7CHJ0_BCL2-01      tcccctgaagtttttgcacggag---------------------------
A0A8C7Q7B4_BCL2-01      tcccccgaagtttttgcacggag---------------------------
A0A0U3DHY6_BCL2-01      acccccgaagtttttgcacggag---------------------------
A0A4W5NW18_BCL2-01      acccgcgaagtttttgcacggag---------------------------
A0A674B8T7_BCL2-01      tcccccgaagtttttgcacggag---------------------------
A0A8C7RG50_BCL2-01      tcccccgaagtttttgcacggag---------------------------
A0A8C8GL24_BCL2-01      tcccccgaagtttttgcacggag---------------------------
A0A6Q2YIU6_BCL2-01      tttggt---acggcggattcatggggcc------------------agta
A0A4W5KV00_BCL2-01      tttggc---acggcggtgccacggggcc------------------aata
A0A8C7G8X1_BCL2-01      tttggc---acggcggtgccacggggcc------------------aata
A0A674B0E5_BCL2-01      tttggc---acggcggtgccacggggcc------------------aata
A0A8C8JWJ1_BCL2-02      tttgnc---acggcggtgccacggggcc------------------aata
A0A8C7N3I9_BCL2-01      tttggc---acggcggtgccacggagcc------------------aata
A0A8C8JWJ1_BCL2-01      tttgnc---acggcggtgccacggggcc------------------aata
A0A8C5C4C3_BCL2-01      tttggt---gaaacgatgtcgaggagaagtgggggacgacaacgacgcca
A0A3B4A3G8_BCL2-01      tctggtgaaccgtcggtgccgcgc--------------------------
A0A3Q3B0R2_BCL2-01      cctggt---ccggaggtgccgcggcgcacgaggagccccaggaggagcag
A0A8C7ZK61_BCL2-01      tccggt---ccgccgccgctgcgac---------------------gcag
A0A3P8WUE9_BCL2-01      tctggt---tcaccggtgccgtgg---t------------------gcca
A0A665U7Y7_BCL2-01      tttggt---ccgccggttccgcga---a------------------gcca
A0A672HHE5_BCL2-01      tctggt---ccgccggtgccgggaggcg------------------gccg
A0A3Q3G1D7_BCL2-01      tttggt---tcgccggtgccgtga---a------------------gcga
A0A8C2X310_BCL2-06      tctggt---ccgccggtgccgtga---a------------------tccg
A0A3Q3MEY1_BCL2-01      tgtggt---ccgccggtgccgtga---c------------------gcga
A0A2U9BJ09_BCL2-01      tctggt---gcgccggtgccatgg---a------------------gcca
A0A8C9ZFJ5_BCL2-09      tttggt---tcgccggtgccgtga---a------------------ggca
A0A7N6A4C8_BCL2-01      tttggt---ccggcggtgccgtga---a------------------gcca
A0A3Q0S5Z7_BCL2-01      tttggt---ccgccggtgccgaga---a------------------ccca
A0A668TEB6_BCL2-05      tttggt---tcaccggtgccgaga---a------------------gcca
A0A3P8QVM8_BCL2-01      tttggt---ccaccggtgccgaga---a------------------gcca
A0A3P9DIG5_BCL2-01      tttggt---ccaccggtgccgaga---a------------------gcca
A0A3Q2UYW8_BCL2-01      tttggt---ccaccggtgccgaga---a------------------gcca
A0A3B4G3K4_BCL2-01      tttggt---ccaccggtgccgaga---a------------------gcca
A0A4W6DDI0_BCL2-01      tttggt---acaccggtgccgcga---a------------------gcca
A0A1X9JZA1_BCL2-01      tttggt---ccgccggtgccgtgg---a------------------gcca
A0A3B4TX71_BCL2-01      tttggt---ccgccggtgccgtga---a------------------gcca
A0A3B4YAG2_BCL2-01      tttggt---ccgccggtgccgtga---a------------------gcca
A0A3B5BBQ0_BCL2-01      tttggt---gcgccggtgccatga---a------------------gcca
A0A3Q1B8C3_BCL2-01      tttggt---ccgtcggtgccatga---a------------------gcca
A0A3P8S9L3_BCL2-01      tttggt---ccgtcggtgccatga---a------------------gcca
A0A3Q1FLK7_BCL2-01      tttggt---ccgtcggtgccatga---a------------------gcca
A0A673LV42_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A672T179_BCL2-01      --------------------------------------------------
A0A3B3TCS4_BCL2-01      ---------cctcccggctctcaagttttggc--------------acgc
A0A8C9T5U7_BCL2-01      ttgcccgggtcgcccggctcccaggtggtggc--------------acgg
W5N4F7_BCL2-01          gctgcaggcgcggcggct--ccaggc------------------------
H9GPE7_BCL2-01          tgtgtcagcatctctttccccagagc------------------------
A0A8D2Q1J0_BCL2-01      ccagttgacatgctcataaattgtgctggaac--------------atca
A0A8D2Q1J0_BCL2-03      ccagttgacatgctcataaattgtgctggaac--------------atca
A0A668TEB6_BCL2-01      cctgttgatatgcttgtgaactgcgctggaac--------------ttca
A0A668TEB6_BCL2-04      cctgttgatatgcttgtgaactgcgctggaac--------------ttca
A0A668TEB6_BCL2-02      cctgttgatatgcttgtgaactgcgctggaac--------------ttca
A0A668TEB6_BCL2-03      cctgttgatatgcttgtgaactgcgctggaac--------------ttca
A0A3Q3MEY1_BCL2-02      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-10      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-08      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-04      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-05      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-07      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-09      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-03      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A3Q3MEY1_BCL2-06      cctgttgatatgcttgtgaactgtgctggaac--------------atct
A0A7N6A4C8_BCL2-02      cctgttgatatgcttgtgaactgtgctggaac--------------atca
A0A7N6A4C8_BCL2-04      -----------------gcactttactccaga--------------ttcc
A0A7N6A4C8_BCL2-07      cctgttgatatgcttgtgaactgtgctggaac--------------atca
A0A7N6A4C8_BCL2-05      cctgttgatatgcttgtgaactgtgctggaac--------------atca
A0A7N6A4C8_BCL2-03      cctgttgatatgcttgtgaactgtgctggaac--------------atca
A0A7N6A4C8_BCL2-06      cctgttgatatgcttgtgaactgtgctggaac--------------atca
A0A8C2X310_BCL2-01      cctgttgatatgttggtgaactgtgctggggt--------------atcc
A0A8C2X310_BCL2-02      cctgttgatatgttggtgaactgtgctggggt--------------atcc
A0A8C2X310_BCL2-04      cctgttgatatgttggtgaactgtgctggggt--------------atcc
A0A8C2X310_BCL2-05      cctgttgatatgttggtgaactgtgctggggt--------------atcc
A0A8C2X310_BCL2-03      cctgttgatatgttggtgaactgtgctggggt--------------atcc
A0A8C9ZFJ5_BCL2-01      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-05      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-06      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-02      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-03      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-04      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-07      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A8C9ZFJ5_BCL2-08      ccggttgatatgttagtgaactgtgctggatt--------------agcc
A0A674GNG3_BCL2-02      ccagttgacatgcttgtaaactgtgcaggaac--------------atca
A0A674GNG3_BCL2-04      ccagttgacatgcttgtaaactgtgcaggaac--------------atca
A0A8C5IH35_BCL2-01      ccagttgatatgctcgtgaactgtgcaggaac--------------atca
A0A8C5IH35_BCL2-02      ccagttgatatgctcgtgaactgtgcaggaac--------------atca
A0A670IB81_BCL2-01      c----tggcatctcatccttccgagc------------------------
A0A8D0BPX3_BCL2-01      c----tggtgtctctgccttctgagc------------------------
A0A8D2Q1J0_BCL2-02      c----tggcatccctgccttctgagc------------------------
A0A8C5S4J3_BCL2-01      c----tggtgcctctgcct-------------------------------
A0A670ZV01_BCL2-01      c----tggtgcctctgcct-------------------------------
A0A8D0L5Z6_BCL2-01      c----tggtgtctttgccccctgagc------------------------
A0A7M4EPU7_BCL2-01      c----tggtgtctctgcatcgtgagc------------------------
A0A7M4G2E0_BCL2-03      c----cggtgtctctgcatcctgagc------------------------
A0A8C8SWU7_BCL2-01      c----tggggtctttgcctgctgaac------------------------
K7F5Y3_BCL2-02          c----tggtgtctttgccgcctgaac------------------------
K7F5Y3_BCL2-01          c----tggtgtctttgccgcctgaac------------------------
K7F5Y3_BCL2-03          --------------------------------------------------
A0A452I9V7_BCL2-01      c----tgatgtctctgcctcctgagc------------------------
A0A8C3SV21_BCL2-01      c----tggtgtctctgcctcctgagc------------------------
A0A8C3ITE1_BCL2-01      c----tggtgtctctgcctcctgagc------------------------
A0A674IMR0_BCL2-01      c----tggtgtctctgcctcctgagc------------------------
A0A8C0G2Q6_BCL2-01      c----tggtctctttgcctcctgagc------------------------
A0A8C4VT25_BCL2-01      c----tgatgtctctgcctcctgagc------------------------
A0A7N4PQN7_BCL2-01      c----atacacctctgcctgctgcac------------------------
F6YNL8_BCL2-01          a----acacaccattgcctgctg---------------------------
A0A4X2L5Q0_BCL2-01      c----atacacctctgcctgctgaac------------------------
A0A8C2U1A2_BCL2-01      ----------------cgccccgagc------------------------
A0A8C9L7I6_BCL2-01      ----------------cgccccgagc------------------------
G1MZW1_BCL2-01          -------------------------c------------------------
A0A8C3LBC4_BCL2-01      ----------------cgccccgagc------------------------
A0A669PDH6_BCL2-01      ----------------cgccccgagc------------------------
A0A8C9MG30_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A663MPN9_BCL2-01      ctccagcatttatcctcgctgcgagc------------------------
A0A8C6ZF48_BCL2-01      c----cggtgtctcggcaccccgagc------------------------
A0A8B9PRT7_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8B9PRT7_BCL2-02      c----tggtgtctccgcaccccgagc------------------------
A0A8C0UAC7_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8B9UYC3_BCL2-01      c----tgctgtccccgcaccctgagc------------------------
A0A8B9E2U6_BCL2-01      c----tgctgtccccgcaccccgagc------------------------
A0A8B9C4H4_BCL2-01      c----tgctgtccccgcaccccgagc------------------------
A0A8C3CIW8_BCL2-01      c----tgctgtccccgcaccccgagc------------------------
A0A493T1X3_BCL2-01      c----tgctgtccccgcaccccgagc------------------------
A0A8B9SFH3_BCL2-01      c----tgctgtccccgcaccccgagc------------------------
A0A8D2P664_BCL2-01      c----cggtgtctccgcaccccgagc------------------------
A0A674GNG3_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A674GNG3_BCL2-03      c----tggtgtctccgcaccccgagc------------------------
A0A8C5TLV4_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A672TR23_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C3JHE5_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C0BN28_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8B9RWH9_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A663FHR0_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C8ANG9_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C0IE77_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8D0G0L7_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C4U538_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C4U538_BCL2-02      c----tggtgtctccgcaccccgagc------------------------
A0A8C3TNF2_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A8C3QX54_BCL2-01      c----tggtgtctccgcaccccgagc------------------------
A0A803VR88_BCL2-01      c----cggtgtctccgcaccccgagc------------------------
A0A803VR88_BCL2-02      c----cggtgtctccgcaccccgagc------------------------
A0A8C5IH35_BCL2-05      c----cggtgtctccgcaccccgagc------------------------
A0A8C5IH35_BCL2-04      c----cggtgtctccgcaccccgagc------------------------
A0A8C5IH35_BCL2-03      c----cggtgtctccgcaccccgagc------------------------
A0A8D2N8C6_BCL2-01      cgaagcggggtcccgg----------------------------------
A0A8D0QLD9_BCL2-07      a----gaaactgggcccagtggacat------------------------
A0A4X1TRR9_BCL2-06      a----gaaactgggcccagtggacat------------------------
A0A8D0QLD9_BCL2-05      a----gaaactgggcccagtggacat------------------------
A0A4X1TRR9_BCL2-05      a----gaaactgggcccagtggacat------------------------
A0A8D0QLD9_BCL2-04      a----gaaactgggcccagtggacat------------------------
A0A4X1TRR9_BCL2-07      a----gaaactgggcccagtggacat------------------------
A0A8D0QLD9_BCL2-06      a----gaaactgggcccagtggacat------------------------
A0A4X1TRR9_BCL2-04      a----gaaactgggcccagtggacat------------------------
A0A4X1TRR9_BCL2-02      a----gaaactgggcccagtggacat------------------------
A0A8D0QLD9_BCL2-02      a----gaaactgggcccagtggacat------------------------
A0A8C6RID6_BCL2-01      a----gcaacccaaccgccgctgtgc------------------------
A0A8C6RID6_BCL2-02      a----gcaacccaaccgccgctgtgc------------------------
Q6R755_BCL2-01          a----gcaacccaacgcccgctgtgc------------------------
Q923R6_BCL2-01          a----gcaacccaacgcccgctgtgc------------------------
A0A8C8U7I9_BCL2-01      a----gcaacccaacgcccgctgtgc------------------------
Q6NTH7_BCL2-01          a----gcaacccaatgcccgctgtgc------------------------
A0A8C6H5J8_BCL2-01      a----gcaacccaatgcccgctgtgc------------------------
Q7TSN8_BCL2-01          a----gcaacccaatgcccgctgtgc------------------------
A0A8I6AJ02_BCL2-01      a----gcaaccggacgcccgctgtgc------------------------
P49950_BCL2-01          a----gcaaccgaacgcccgctgtgc------------------------
A0A4W2DSR6_BCL2-02      c----gcacacccgcgcc--------------------------------
A0A4W2DSR6_BCL2-02      c----gcacacccgcgcc--------------------------------
A0A8C6CUJ2_BCL2-01      c----gcgcgcccgcgcc--------------------------------
A0A4W2DSR6_BCL2-01      c----gcacacccgcgcc--------------------------------
A0A4W2DSR6_BCL2-01      c----gcacacccgcgcc--------------------------------
F6R2C4_BCL2-01          c----gcacacccgcgcc--------------------------------
O02718_BCL2-01          c----gcacacccgcccc--------------------------------
A0A076FU27_BCL2-01      c----gcacacccgcgcc--------------------------------
A0A076FZV9_BCL2-01      c----gcacacccgcgcc--------------------------------
A0A452EV13_BCL2-01      c----gcgcgcccgcgcc--------------------------------
A0A8C5JYS0_BCL2-01      a----acgacaccacatcggccgtgc------------------------
G3SLZ1_BCL2-01          --------------------cggcgc------------------------
G3SLZ1_BCL2-02          --------------------------------------------------
H0W1T3_BCL2-01          c----gcaactccccgcttggtgtgc------------------------
A0A5F9CRQ4_BCL2-01      --------------cgcccgctgcgc------------------------
A0A5F9CRQ4_BCL2-02      --------------cgcccgctgcgc------------------------
M3YYK3_BCL2-01          --------------------------------------------------
A0A8D2AUF5_BCL2-01      c----gcaaccccccgcccgctgcgc------------------------
I3MVK9_BCL2-01          a----gccatac--------------------------------------
A0A8C5YTS1_BCL2-01      --------------------------------------------------
A0A8D2IIB8_BCL2-01      a----gccatcccccgcccgctgcgc------------------------
A0A250YD83_BCL2-01      a----gcaaccccctgcccgctgcgc------------------------
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      c----gcaactccccggccgctgcgc------------------------
A0A8C9HUK6_BCL2-02      c----acacgccccatcccgccgcgt------------------------
A0A2K5EB04_BCL2-01      c----acacgcccggtcccgccgcgc------------------------
A0A2K6UEL3_BCL2-01      c----acacgcccggtcccgctgcgc------------------------
A0A2R8MY14_BCL2-01      c----acacgcccggtcccgccgcgc------------------------
A0A2K6R2I5_BCL2-02      c----acacgccccatcccgccgcgt------------------------
A0A2K5HK49_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A7I2V3S7_BCL2-04      c----acacgccccatccagccgcat------------------------
A0A7I2V3S7_BCL2-10      c----acacgccccatccagccgcat------------------------
A0A7I2V3S7_BCL2-05      c----acacgccccatccagccgcat------------------------
A0A7I2V3S7_BCL2-08      c----acacgccccatccagccgcat------------------------
A0A7N9CNB8_BCL2-01      c----ac---ccccatcccgccgcgt------------------------
A0A8D2EFR4_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2K5XRD4_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2K5NZS5_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A0D9S017_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A5F7ZZ15_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2K6CIX3_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A096MPU7_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A7I2V3S7_BCL2-03      ------------------------at------------------------
A9QXG9_BCL2-01          c----acacgccccatccagccgcat------------------------
A0A2K6KHG1_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2K6R2I5_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2J8W3J1_BCL2-01      c----acacgcctcatccagccgcat------------------------
A0A8C9HUK6_BCL2-01      c----acacgccccatcccgccgcgt------------------------
A0A2I3GZF9_BCL2-01      c----acacgccccatccagctgcat------------------------
A0A7I2V3S7_BCL2-06      c----acacgccccatccagccgcat------------------------
A0A7I2V3S7_BCL2-07      c----acacgccccatccagccgcat------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          c----acacgccccatccagccgcat------------------------
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          c----gcacccctactcccgctgcgc------------------------
A0A8B7H1C6_BCL2-01      g----gcaccccccctcccgctgcgc------------------------
A0A8C9AC52_BCL2-01      c----gcacccccgctcccgctgcgc------------------------
A0A2K6G3I7_BCL2-01      c----gcaacccccctcccgctgcgc------------------------
A0A3Q2HRY3_BCL2-02      c----gcacccccgcgcc--------------------------------
A0A8C4L1K6_BCL2-01      c----gcacccccgcgcc--------------------------------
A0A3Q2HRY3_BCL2-01      c----gcacccccgcgcc--------------------------------
A0A673VDM8_BCL2-01      c----gcacccccctccc--------------------------------
A0A5F5Y6Y3_BCL2-02      c----gcacccctgcgcc--------------------------------
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          c----gcacccctgcgcc--------------------------------
A0A667GHH0_BCL2-01      c----gcacccctgcgcc--------------------------------
A0A5F5Y6Y3_BCL2-01      c----gcacccctgcgcc--------------------------------
A0A8C8XJU8_BCL2-01      c----gcacccctgcgcc--------------------------------
A0A8C7B9K2_BCL2-01      c----gcacccccgcgcc--------------------------------
G1LIC9_BCL2-01          c----gcacccccgcgcc--------------------------------
A0A452R110_BCL2-01      c----tcacccccgcgcc--------------------------------
A0A452R110_BCL2-02      c----tcacccccgcgcc--------------------------------
A0A8C0NC28_BCL2-03      c----gcgcccccgcgcc--------------------------------
A0A8I3MLT5_BCL2-02      c----gcgcccccgcgcc--------------------------------
A0A8C0NC28_BCL2-02      c----gcgcccccgcgcc--------------------------------
Q75SV7_BCL2-01          c----gcgcccccgcgcc--------------------------------
A0A8C0KWE3_BCL2-01      c----gcgcccccgcgcc--------------------------------
A0A8C0NC28_BCL2-01      c----gcgcccccgcgcc--------------------------------
A0A8I3MLT5_BCL2-01      c----gcgcccccgcgcc--------------------------------
A0A8C6AXM8_BCL2-01      a----gcaccccagcgcc--------------------------------
A0A8C9CJ69_BCL2-01      a----gcaccccagcgcc--------------------------------
A0A8B8V3A7_BCL2-02      c----gcaccccagcgcc--------------------------------
A0A8B8V3A7_BCL2-01      c----gcaccccagcgcc--------------------------------
A0A8B8V3A7_BCL2-03      c----gcaccccagcgcc--------------------------------
A0A8C3WCN0_BCL2-01      c----gaacccccgcgcc--------------------------------
A0A8D0QLD9_BCL2-03      c----gaacccccgctcc--------------------------------
A0A4X1TRR9_BCL2-01      c----gaacccccgctcc--------------------------------
A0A8D0QLD9_BCL2-01      c----gaacccccgctcc--------------------------------
A0A4X1TRR9_BCL2-03      c----gaacccccgctcc--------------------------------
                                                                          

A3KNH9_BCL2-01          ---------------------------------gcggagggaacaa----
Q564A4_BCL2-01          ---------------------------------gcggagggaacaa----
X4ZGI8_BCL2-01          ---------------------------------gagggggaaacaa----
A0A673HVU7_BCL2-01      ---------------------------------gaggggggaacaa----
A0A4W4F7Z4_BCL2-01      ---------------------------------cccacgcgcgccc----
B9ZYL7_BCL2-01          -ctccaataacctttgtgggcaatgcacctgctgttcccaggaggtctgc
A0A8C5MT36_BCL2-03      -cccccaccgctcttttagacaatgcacctgctgctcagaggagctctgc
A0A8C5MT36_BCL2-01      -cccccaccgctcttttagacaatgcacctgctgctcagaggagctctgc
A0A8C5MT36_BCL2-02      -cccccaccgctcttttagacaatgcacctgctgctcagaggagctctgc
A0A8C5MT36_BCL2-04      -cccccaccgctcttttagacaatgcacctgctgctcagaggagctctgc
A0A7M4G2E0_BCL2-01      gcttacagcccatttgaaggatatgaactgaaggaggtgagagacc---t
A0A7M4G2E0_BCL2-02      gcttacagcccatttgaaggatatgaactgaaggaggtgagagacc---t
A0A673Z0A3_BCL2-01      -gtcccagccctcc-------------------gctgaaggtgtggacac
A0A8C7CHJ0_BCL2-01      -gtcccaaccctcc-------------------gccgaaggcgtggacac
A0A8C7Q7B4_BCL2-01      -gtcccaaccctcc-------------------gccgaaggcgtggacac
A0A0U3DHY6_BCL2-01      -gtcccagcccacc-------------------gccgcggtcgaggacac
A0A4W5NW18_BCL2-01      -gtcccagcccacc-------------------gccgcgggcgaggacac
A0A674B8T7_BCL2-01      -gtcccagcccacc-------------------gccgcgggcgaggacac
A0A8C7RG50_BCL2-01      -gtcccagcccact-------------------gccgcgggagaggacac
A0A8C8GL24_BCL2-01      -gtcccagcccact-------------------gccgcgggagaggacac
A0A6Q2YIU6_BCL2-01      aagccggaca---------------------------gggcagcgt---t
A0A4W5KV00_BCL2-01      acgccggacc---------------------------gggcagcgt---t
A0A8C7G8X1_BCL2-01      acggcggacc---------------------------gggcagcgt---c
A0A674B0E5_BCL2-01      acgccggccc---------------------------gggcagcgt---c
A0A8C8JWJ1_BCL2-02      acgccagacc---------------------------gggcagcgt---c
A0A8C7N3I9_BCL2-01      acgccagacc---------------------------gggcagcgt---c
A0A8C8JWJ1_BCL2-01      acgccagacc---------------------------gggcagcgt---c
A0A8C5C4C3_BCL2-01      acaccgggcc---------------------------ggagagcat---c
A0A3B4A3G8_BCL2-01      ---------------------------------------agagcgg---c
A0A3Q3B0R2_BCL2-01      gaacggcgccccctg------------------acgcggagagcga---c
A0A8C7ZK61_BCL2-01      gaacgggg---cctg------------------acgaggagagcag---c
A0A3P8WUE9_BCL2-01      gcaccgggcc---tg------------------ggaacgacggcat---c
A0A665U7Y7_BCL2-01      gcagcgggcc---cg------------------acaaccagagcgc---g
A0A672HHE5_BCL2-01      gagccgggcc---cg------------------acagcgaggacgacagc
A0A3Q3G1D7_BCL2-01      gctccgggcc---tg------------------accgtgagagcat---c
A0A8C2X310_BCL2-06      gcaccgggcc---cg------------------acatcgagagcgt---c
A0A3Q3MEY1_BCL2-01      gcaccgggcc---cg------------------acagcgagagcat---c
A0A2U9BJ09_BCL2-01      gcaccgggcc---cg------------------acgacgagagcca---c
A0A8C9ZFJ5_BCL2-09      gcactgggcc---tg------------------acagcgagagcat---c
A0A7N6A4C8_BCL2-01      gcaccgggcc---tg------------------acagcgacagcat---c
A0A3Q0S5Z7_BCL2-01      gcaacgggcc---tg------------------acggcgagagcaa---c
A0A668TEB6_BCL2-05      gcaccgggcc---tg------------------acggcgagagcaa---c
A0A3P8QVM8_BCL2-01      gcaccgggcc---tg------------------acggcgagagcaa---c
A0A3P9DIG5_BCL2-01      gcaccgggcc---tg------------------acggcgagagcaa---c
A0A3Q2UYW8_BCL2-01      gcaccgggcc---tg------------------acggcgagagcaa---c
A0A3B4G3K4_BCL2-01      gcaccgggcc---tg------------------acggcgagagcaa---c
A0A4W6DDI0_BCL2-01      g---cgggcccgacg------------------acaacgagagcgt---c
A0A1X9JZA1_BCL2-01      gcaccgggcc---cg------------------acagcgagagcat---c
A0A3B4TX71_BCL2-01      acaccgggcc---tg------------------acaacgacagctc---a
A0A3B4YAG2_BCL2-01      acaccgggcc---tg------------------acaacgacagctc---a
A0A3B5BBQ0_BCL2-01      gcaccgggcc---cg------------------acaacgagagcga---c
A0A3Q1B8C3_BCL2-01      gcaccgggcc---cg------------------acaacgagagcga---c
A0A3P8S9L3_BCL2-01      gcaccgggcc---cg------------------acaacgagagcga---c
A0A3Q1FLK7_BCL2-01      gcaccgggcc---cg------------------acaacgagagcga---c
A0A673LV42_BCL2-01      ---------------------------------gacggcggcatct---c
A0A8C1IQE4_BCL2-01      ---------------------------------gaccgcggcg-------
A0A672T179_BCL2-01      ---------------------------------gaccgcggcg-------
A0A3B3TCS4_BCL2-01      cggtcccaagcagct------------------gccgccggcggag---a
A0A8C9T5U7_BCL2-01      aggtcgcaggctgcc---------------ggggccgcggacgcag---a
W5N4F7_BCL2-01          -tgccggggccgagc------------------gcggagctgtccc---g
H9GPE7_BCL2-01          -ttctcaattctgat------------------cctgtgagtacca---a
A0A8D2Q1J0_BCL2-01      gttaatgcaaaattt---------gaagatcttgacatcagtaagt---t
A0A8D2Q1J0_BCL2-03      gttaatgcaaaattt---------gaagatcttgacatcagtaagt---t
A0A668TEB6_BCL2-01      gtttctgggaagttt------------------gaggaagtggagg---t
A0A668TEB6_BCL2-04      gtttctgggaagttt------------------gaggaagtggagg---t
A0A668TEB6_BCL2-02      gtttctgggaagttt------------------gaggaagtggagg---t
A0A668TEB6_BCL2-03      gtttctgggaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-02      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-10      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-08      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-04      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-05      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-07      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-09      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-03      gtttctggaaagttt------------------gaggaagtggagg---t
A0A3Q3MEY1_BCL2-06      gtttctggaaagttt------------------gaggaagtggagg---t
A0A7N6A4C8_BCL2-02      atgtctggaaagttt------------------gaggaggtggagg---t
A0A7N6A4C8_BCL2-04      actattgcaaaat-------------------------------gt---t
A0A7N6A4C8_BCL2-07      atgtctggaaagttt------------------gaggaggtggagg---t
A0A7N6A4C8_BCL2-05      atgtctggaaagttt------------------gaggaggtggagg---t
A0A7N6A4C8_BCL2-03      atgtctggaaagttt------------------gaggaggtggagg---t
A0A7N6A4C8_BCL2-06      atgtctggaaagttt------------------gaggaggtggagg---t
A0A8C2X310_BCL2-01      atttctggaaagttt------------------gatgaaatggaag---t
A0A8C2X310_BCL2-02      atttctggaaagttt------------------gatgaaatggaag---t
A0A8C2X310_BCL2-04      atttctggaaagttt------------------gatgaaatggaag---t
A0A8C2X310_BCL2-05      atttctggaaagttt------------------gatgaaatggaag---t
A0A8C2X310_BCL2-03      atttctggaaagttt------------------gatgaaatggaag---t
A0A8C9ZFJ5_BCL2-01      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-05      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-06      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-02      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-03      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-04      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-07      atttctggaaagttt------------------gaggacgtggaag---t
A0A8C9ZFJ5_BCL2-08      atttctggaaagttt------------------gaggacgtggaag---t
A0A674GNG3_BCL2-02      gttacaggaaaattt------------------gaggatattgaag---t
A0A674GNG3_BCL2-04      gttacaggaaaattt------------------gaggatattgaag---t
A0A8C5IH35_BCL2-01      gttacaggcaaattt------------------gaggatattgaag---t
A0A8C5IH35_BCL2-02      gttacaggcaaattt------------------gaggatattgaag---t
A0A670IB81_BCL2-01      -tgc------------------------------ctgtaagtaacg---t
A0A8D0BPX3_BCL2-01      -tgcctggctctg------------------------------------t
A0A8D2Q1J0_BCL2-02      -tgcctgactctgct------------------gctgtgaggaatg---t
A0A8C5S4J3_BCL2-01      ---------tctgct------------------gctgttagtaact---t
A0A670ZV01_BCL2-01      ---------tctgct------------------gctgttagtaact---t
A0A8D0L5Z6_BCL2-01      -ctcctggctcagct------------------gctgctaataatg---t
A0A7M4EPU7_BCL2-01      -ctgctggctcagct------------------gctgctagtaatg---t
A0A7M4G2E0_BCL2-03      -ctgctggctcagct------------------gctgctagtaatg---t
A0A8C8SWU7_BCL2-01      -cccctggctcagct------------------gctgctagtaatg---t
K7F5Y3_BCL2-02          -cccctggttcggct------------------gctgctagtaatg---t
K7F5Y3_BCL2-01          -cccctggttcggct------------------gctgctagtaatg---t
K7F5Y3_BCL2-03          ----ctggttcggct------------------gctgctagtaatg---t
A0A452I9V7_BCL2-01      -cccctggctcggct------------------gctgctagtaacg---t
A0A8C3SV21_BCL2-01      -cccctggctcagct------------------gctgctagtaatg---t
A0A8C3ITE1_BCL2-01      -cccctggctcggct------------------gctgctagtaacg---t
A0A674IMR0_BCL2-01      -cccctggctcggct------------------gctgctagtaacg---t
A0A8C0G2Q6_BCL2-01      -cccctggctcggct------------------gctgctagtaacg---t
A0A8C4VT25_BCL2-01      -cccctggctcggct------------------gctgctagtaacg---t
A0A7N4PQN7_BCL2-01      -cccaggacttggccacttctactactgctgctgctagaaactcac---c
F6YNL8_BCL2-01          --------------------------------------------------
A0A4X2L5Q0_BCL2-01      -cccaggacttggccacttctacgactgctgctgctagaaactcac---c
A0A8C2U1A2_BCL2-01      -cccccggctcggct------------------gctgctagtgagg---t
A0A8C9L7I6_BCL2-01      -cccccggctcggct------------------gctgctagtgagg---t
G1MZW1_BCL2-01          -cccccggctcggct------------------gctgctagtgagg---t
A0A8C3LBC4_BCL2-01      -cccccggctcggct------------------gctgctagtgagg---t
A0A669PDH6_BCL2-01      -cccccggctcggct------------------gctgctagtgagg---t
A0A8C9MG30_BCL2-01      -cccctggctcggcc------------------gctgctagccacg---c
A0A663MPN9_BCL2-01      -tgcccg---caggc------------------cctgcc-----------
A0A8C6ZF48_BCL2-01      -cccccggctcggct------------------gctgctagtaacg----
A0A8B9PRT7_BCL2-01      -cccccggctcggct------------------gctgctagtaacg---c
A0A8B9PRT7_BCL2-02      -cccccggctcggct------------------gctgctagtaacg---c
A0A8C0UAC7_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A8B9UYC3_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A8B9E2U6_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A8B9C4H4_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A8C3CIW8_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A493T1X3_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A8B9SFH3_BCL2-01      -cccccggctcggct------------------gctgctagcgagg---c
A0A8D2P664_BCL2-01      -cccccggctcggct------------------gctgctagccagg---t
A0A674GNG3_BCL2-01      -cccccggctcggct------------------actgctagccaca---c
A0A674GNG3_BCL2-03      -cccccggctcggct------------------actgctagccaca---c
A0A8C5TLV4_BCL2-01      -cccccggctcggct------------------gctgctagccaca---c
A0A672TR23_BCL2-01      -cccccggctcggct------------------gctgctagccatg---c
A0A8C3JHE5_BCL2-01      -cccccggctcggct------------------gctgctagccacg---t
A0A8C0BN28_BCL2-01      -cccccggctcgg-------------------------------------
A0A8B9RWH9_BCL2-01      -cccccggctcggcc------------------gctgctagccacg---c
A0A663FHR0_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A8C8ANG9_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A8C0IE77_BCL2-01      -cccccggctcggct------------------gctgctagccac-----
A0A8D0G0L7_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A8C4U538_BCL2-01      -cccccggctcggct------------------gctgctagccacg---t
A0A8C4U538_BCL2-02      -cccccggctcggct------------------gctgctagccacg---t
A0A8C3TNF2_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A8C3QX54_BCL2-01      -cccccggctcggct------------------gctgctagccacg---c
A0A803VR88_BCL2-01      -cccccggctcggct------------------gctgctagccccg---c
A0A803VR88_BCL2-02      -cccccggctcggct------------------gctgctagccccg---c
A0A8C5IH35_BCL2-05      -cccccggctcggct------------------gctgctagccacg---c
A0A8C5IH35_BCL2-04      -cccccggctcggct------------------gctgctagccacg---c
A0A8C5IH35_BCL2-03      -cccccggctcggct------------------gctgctagccacg---c
A0A8D2N8C6_BCL2-01      -----------ggct------------------gccg-gggccgag----
A0A8D0QLD9_BCL2-07      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A4X1TRR9_BCL2-06      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A8D0QLD9_BCL2-05      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A4X1TRR9_BCL2-05      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A8D0QLD9_BCL2-04      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A4X1TRR9_BCL2-07      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A8D0QLD9_BCL2-06      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A4X1TRR9_BCL2-04      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A4X1TRR9_BCL2-02      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A8D0QLD9_BCL2-02      -gcttgtaaactg-t------------------gcaggaatgtcac---t
A0A8C6RID6_BCL2-01      -accaggacccagcc------------------gccaggacctcgc---c
A0A8C6RID6_BCL2-02      -accaggacccagcc------------------gccaggacctcgc---c
Q6R755_BCL2-01          -accgggacatggct------------------gccaggacatcgc---c
Q923R6_BCL2-01          -accgggacatggct------------------gccaggacatcgc---c
A0A8C8U7I9_BCL2-01      -accgggacacggct------------------gccaggacgtcac---c
Q6NTH7_BCL2-01          -accgggacatggct------------------gccaggacgtctc---c
A0A8C6H5J8_BCL2-01      -accgggacatggct------------------gccaggacgtcta---c
Q7TSN8_BCL2-01          -accgggacatggct------------------gccaggacgtctc---c
A0A8I6AJ02_BCL2-01      -accgagacacggct------------------gccaggacgtcgc---c
P49950_BCL2-01          -accgagacacggct------------------gccaggacgtcgc---c
A0A4W2DSR6_BCL2-02      --------------c------------------tccaggacctccc---c
A0A4W2DSR6_BCL2-02      --------------c------------------tccaggacctccc---c
A0A8C6CUJ2_BCL2-01      --------------c------------------gccaggacctccc---c
A0A4W2DSR6_BCL2-01      --------------c------------------tccaggacctccc---c
A0A4W2DSR6_BCL2-01      --------------c------------------tccaggacctccc---c
F6R2C4_BCL2-01          --------------c------------------tccaggacctccc---c
O02718_BCL2-01          --------------c------------------tccaggacctccc---c
A0A076FU27_BCL2-01      --------------c------------------tccaggacctccc---c
A0A076FZV9_BCL2-01      --------------c------------------tccaggacctccc---c
A0A452EV13_BCL2-01      --------------c------------------tccaggacctccc---c
A0A8C5JYS0_BCL2-01      -cccgggatccagca------------------gccaggacctcgc---c
G3SLZ1_BCL2-01          -cccggggcccggac------------------accaggacctcgc---c
G3SLZ1_BCL2-02          ------------gac------------------accaggacctcgc---c
H0W1T3_BCL2-01          -cccgggacccggcc------------------gccaggacctcgc---c
A0A5F9CRQ4_BCL2-01      -cccgggacccggcc------------------gccaggacctcgc---c
A0A5F9CRQ4_BCL2-02      -cccgggacccggcc------------------gccaggacctcgc---c
M3YYK3_BCL2-01          --------------c------------------gcccgcagctcac---c
A0A8D2AUF5_BCL2-01      -cccaggacccagca------------------gccaggacctcac---c
I3MVK9_BCL2-01          --------cccggcc------------------gccaggacctcgc---c
A0A8C5YTS1_BCL2-01      --nnnnnnnccggcc------------------gccaggacctcgc---c
A0A8D2IIB8_BCL2-01      -cccgggacccggcc------------------gccaggacctcgc---c
A0A250YD83_BCL2-01      -cccgggaccgggcc------------------gccaggaccacgt---c
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      -cccgggacccggcc------------------gccaggacctcgc---c
A0A8C9HUK6_BCL2-02      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K5EB04_BCL2-01      -cccgggacccggtc------------------tccaggacctcgc---c
A0A2K6UEL3_BCL2-01      -cccgggaccctgtc------------------gccaggaccnnnn---n
A0A2R8MY14_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K6R2I5_BCL2-02      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K5HK49_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-04      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-10      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-05      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-08      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7N9CNB8_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A8D2EFR4_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K5XRD4_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K5NZS5_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A0D9S017_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A5F7ZZ15_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K6CIX3_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A096MPU7_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-03      -cccag--------------------------------------------
A9QXG9_BCL2-01          -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K6KHG1_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2K6R2I5_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2J8W3J1_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A8C9HUK6_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2I3GZF9_BCL2-01      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-06      -cccgggacccggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-07      -cccgggacccggtc------------------gccaggacctcgc---c
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          -cccgggaccgggtc------------------gccaggacctcgc---c
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -cccgggacccggcc------------------gccaggacctcgc----
A0A8B7H1C6_BCL2-01      -ctcgggacccggcc------------------gccaggacctcgc----
A0A8C9AC52_BCL2-01      -ctcgggacccggcc------------------gccaggacctcgc----
A0A2K6G3I7_BCL2-01      -ctcgggacccggcc------------------gccaggacctcgc----
A0A3Q2HRY3_BCL2-02      --------------c------------------gccaggacctccc---c
A0A8C4L1K6_BCL2-01      --------------c------------------gccaggacctccc---c
A0A3Q2HRY3_BCL2-01      --------------c------------------gccaggacctccc---c
A0A673VDM8_BCL2-01      --------------c------------------gccgcnnnnnnnn---n
A0A5F5Y6Y3_BCL2-02      --------------c------------------gccaggacctccc---c
A0A8C9J3W6_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------c------------------gccaggacctccc---c
A0A667GHH0_BCL2-01      --------------c------------------gccaggacctccc---c
A0A5F5Y6Y3_BCL2-01      --------------c------------------gccaggacctccc---c
A0A8C8XJU8_BCL2-01      --------------c------------------gccaggacctccc---c
A0A8C7B9K2_BCL2-01      --------------c------------------gccaggacctcgc---c
G1LIC9_BCL2-01          --------------c------------------gccaggacctcgc---c
A0A452R110_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A452R110_BCL2-02      --------------c------------------gccaggacctcgc---c
A0A8C0NC28_BCL2-03      --------------c------------------gccaggacctcgc---c
A0A8I3MLT5_BCL2-02      --------------c------------------gccaggacctcgc---c
A0A8C0NC28_BCL2-02      --------------c------------------gccaggacctcgc---c
Q75SV7_BCL2-01          --------------c------------------gccaggacctcgc---c
A0A8C0KWE3_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A8C0NC28_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A8I3MLT5_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A8C6AXM8_BCL2-01      --------------a------------------tccaggacctccc---c
A0A8C9CJ69_BCL2-01      --------------a------------------tccaggacctccc---c
A0A8B8V3A7_BCL2-02      --------------a------------------tccaggacctccc---c
A0A8B8V3A7_BCL2-01      --------------a------------------tccaggacctccc---c
A0A8B8V3A7_BCL2-03      --------------a------------------tccaggacctccc---c
A0A8C3WCN0_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A8D0QLD9_BCL2-03      --------------c------------------gccaggacctcgc---c
A0A4X1TRR9_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A8D0QLD9_BCL2-01      --------------c------------------gccaggacctcgc---c
A0A4X1TRR9_BCL2-03      --------------c------------------gccaggacctcgc---c
                                                                          

A3KNH9_BCL2-01          --------------------------------------------------
Q564A4_BCL2-01          --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A673HVU7_BCL2-01      --------------------------------------------------
A0A4W4F7Z4_BCL2-01      ---------------------------------------------cttc-
B9ZYL7_BCL2-01          atctgctg------------tt--------------------tcaccctt
A0A8C5MT36_BCL2-03      ttctgctgcttctaccgtccct--------------------tcaccaca
A0A8C5MT36_BCL2-01      ttctgctgcttctaccgtccct--------------------tcaccaca
A0A8C5MT36_BCL2-02      ttctgctgcttctaccgtccct--------------------tcaccaca
A0A8C5MT36_BCL2-04      ttctgctgcttctaccgtccct--------------------tcaccaca
A0A7M4G2E0_BCL2-01      ggacatgcagttcagccagatga-------------------gagcccct
A0A7M4G2E0_BCL2-02      ggacatgcagttcagccagatga-------------------gagcccct
A0A673Z0A3_BCL2-01      tg---------------------------------------aatctcag-
A0A8C7CHJ0_BCL2-01      tg---------------------------------------actctccg-
A0A8C7Q7B4_BCL2-01      tg---------------------------------------actctccg-
A0A0U3DHY6_BCL2-01      cg---------------------------------------actctcct-
A0A4W5NW18_BCL2-01      cg---------------------------------------actctcct-
A0A674B8T7_BCL2-01      cg---------------------------------------accctcct-
A0A8C7RG50_BCL2-01      cg---------------------------------------actctcct-
A0A8C8GL24_BCL2-01      cg---------------------------------------actctcct-
A0A6Q2YIU6_BCL2-01      cc----------------------------------------ccatatt-
A0A4W5KV00_BCL2-01      cc----------------------------------------tcgtctt-
A0A8C7G8X1_BCL2-01      cc----------------------------------------tagtctt-
A0A674B0E5_BCL2-01      cc----------------------------------------tagtctt-
A0A8C8JWJ1_BCL2-02      cc----------------------------------------ccatctt-
A0A8C7N3I9_BCL2-01      cc----------------------------------------ccatctt-
A0A8C8JWJ1_BCL2-01      cc----------------------------------------ccatctt-
A0A8C5C4C3_BCL2-01      cc----------------------------------------ccgtctt-
A0A3B4A3G8_BCL2-01      tc----------------------------------------tgttc---
A0A3Q3B0R2_BCL2-01      cc----------------------------------------cgaccccg
A0A8C7ZK61_BCL2-01      cc----------------------------------------ccgcctca
A0A3P8WUE9_BCL2-01      cc----------------------------------------taacctc-
A0A665U7Y7_BCL2-01      cc----------------------------------------cgagcgg-
A0A672HHE5_BCL2-01      cc----------------------------------------ccgcctg-
A0A3Q3G1D7_BCL2-01      cc----------------------------------------ccacctc-
A0A8C2X310_BCL2-06      cc----------------------------------------ccacctc-
A0A3Q3MEY1_BCL2-01      cc----------------------------------------ccagctc-
A0A2U9BJ09_BCL2-01      cc----------------------------------------cgacctc-
A0A8C9ZFJ5_BCL2-09      cc----------------------------------------tcacctc-
A0A7N6A4C8_BCL2-01      cc----------------------------------------gcaacac-
A0A3Q0S5Z7_BCL2-01      ac----------------------------------------ccacctc-
A0A668TEB6_BCL2-05      ac----------------------------------------ccacctc-
A0A3P8QVM8_BCL2-01      ac----------------------------------------ccacctc-
A0A3P9DIG5_BCL2-01      ac----------------------------------------ccacctc-
A0A3Q2UYW8_BCL2-01      ac----------------------------------------ccacctc-
A0A3B4G3K4_BCL2-01      ac----------------------------------------ccacctc-
A0A4W6DDI0_BCL2-01      cc----------------------------------------caacctg-
A0A1X9JZA1_BCL2-01      cc----------------------------------------ccacctc-
A0A3B4TX71_BCL2-01      cc----------------------------------------taacctc-
A0A3B4YAG2_BCL2-01      cc----------------------------------------taacctc-
A0A3B5BBQ0_BCL2-01      cc----------------------------------------ccacctc-
A0A3Q1B8C3_BCL2-01      cc----------------------------------------ccacctc-
A0A3P8S9L3_BCL2-01      cc----------------------------------------ccacctc-
A0A3Q1FLK7_BCL2-01      cc----------------------------------------ccacctc-
A0A673LV42_BCL2-01      tcccagctcccgtcacgacccgtgcagggctcttcataaggtgctctcc-
A0A8C1IQE4_BCL2-01      --------------------------------------------gcacc-
A0A672T179_BCL2-01      --------------------------------------------gctcc-
A0A3B3TCS4_BCL2-01      ggacgcgtcgcctgt------------------------------ccgc-
A0A8C9T5U7_BCL2-01      ggacgcgcccctctc------------------------------ccgc-
W5N4F7_BCL2-01          gt-------------------------------------------cccc-
H9GPE7_BCL2-01          tg-------------------------------------------cccc-
A0A8D2Q1J0_BCL2-01      tg------------------------------------------------
A0A8D2Q1J0_BCL2-03      tg------------------------------------------------
A0A668TEB6_BCL2-01      ag--------------------------------------------atc-
A0A668TEB6_BCL2-04      ag--------------------------------------------atc-
A0A668TEB6_BCL2-02      ag--------------------------------------------atc-
A0A668TEB6_BCL2-03      ag--------------------------------------------atc-
A0A3Q3MEY1_BCL2-02      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-10      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-08      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-04      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-05      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-07      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-09      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-03      gg--------------------------------------------acc-
A0A3Q3MEY1_BCL2-06      gg--------------------------------------------acc-
A0A7N6A4C8_BCL2-02      gg--------------------------------------------att-
A0A7N6A4C8_BCL2-04      gg----------------------------------------ccttatt-
A0A7N6A4C8_BCL2-07      gg--------------------------------------------att-
A0A7N6A4C8_BCL2-05      gg--------------------------------------------att-
A0A7N6A4C8_BCL2-03      gg--------------------------------------------att-
A0A7N6A4C8_BCL2-06      gg--------------------------------------------att-
A0A8C2X310_BCL2-01      gg--------------------------------------------acc-
A0A8C2X310_BCL2-02      gg--------------------------------------------acc-
A0A8C2X310_BCL2-04      gg--------------------------------------------acc-
A0A8C2X310_BCL2-05      gg--------------------------------------------acc-
A0A8C2X310_BCL2-03      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-01      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-05      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-06      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-02      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-03      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-04      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-07      gg--------------------------------------------acc-
A0A8C9ZFJ5_BCL2-08      gg--------------------------------------------acc-
A0A674GNG3_BCL2-02      ga-------------------------------------------attc-
A0A674GNG3_BCL2-04      ga-------------------------------------------attc-
A0A8C5IH35_BCL2-01      ga-------------------------------------------attc-
A0A8C5IH35_BCL2-02      ga-------------------------------------------attc-
A0A670IB81_BCL2-01      cg-------------------------------------------cccc-
A0A8D0BPX3_BCL2-01      cg-------------------------------------------ctcc-
A0A8D2Q1J0_BCL2-02      tg-------------------------------------------cccc-
A0A8C5S4J3_BCL2-01      gg-------------------------------------------ctgc-
A0A670ZV01_BCL2-01      gg-------------------------------------------ctgc-
A0A8D0L5Z6_BCL2-01      gc-------------------------------------------cctc-
A0A7M4EPU7_BCL2-01      gc-------------------------------------------ctcc-
A0A7M4G2E0_BCL2-03      gc-------------------------------------------ctcc-
A0A8C8SWU7_BCL2-01      tc-------------------------------------------ctcc-
K7F5Y3_BCL2-02          gc-------------------------------------------ccct-
K7F5Y3_BCL2-01          gc-------------------------------------------ccct-
K7F5Y3_BCL2-03          gc-------------------------------------------ccct-
A0A452I9V7_BCL2-01      gc-------------------------------------------ccct-
A0A8C3SV21_BCL2-01      gc-------------------------------------------ccct-
A0A8C3ITE1_BCL2-01      ac-------------------------------------------ctct-
A0A674IMR0_BCL2-01      ac-------------------------------------------ccct-
A0A8C0G2Q6_BCL2-01      gc-------------------------------------------ccct-
A0A8C4VT25_BCL2-01      gc-------------------------------------------ccct-
A0A7N4PQN7_BCL2-01      tt-tgcctcctcctcctgctg------------ttgctgctgctactgt-
F6YNL8_BCL2-01          ---------------------------------------------ctgc-
A0A4X2L5Q0_BCL2-01      tt-tgcctcctcctcctgccg------------ttgctgctgctactgc-
A0A8C2U1A2_BCL2-01      gc-------------------------------------------cccc-
A0A8C9L7I6_BCL2-01      gc-------------------------------------------cccc-
G1MZW1_BCL2-01          gc-------------------------------------------cccc-
A0A8C3LBC4_BCL2-01      gc-------------------------------------------cccc-
A0A669PDH6_BCL2-01      gc-------------------------------------------cccc-
A0A8C9MG30_BCL2-01      gc-------------------------------------------cccc-
A0A663MPN9_BCL2-01      --------------------------------------------------
A0A8C6ZF48_BCL2-01      ------------------------------------------------a-
A0A8B9PRT7_BCL2-01      gg-------------------------------------------cccc-
A0A8B9PRT7_BCL2-02      gg-------------------------------------------cccc-
A0A8C0UAC7_BCL2-01      gc-------------------------------------------cccc-
A0A8B9UYC3_BCL2-01      gc-------------------------------------------cccc-
A0A8B9E2U6_BCL2-01      gc-------------------------------------------cccc-
A0A8B9C4H4_BCL2-01      gc-------------------------------------------cccc-
A0A8C3CIW8_BCL2-01      gc-------------------------------------------cccc-
A0A493T1X3_BCL2-01      gc-------------------------------------------cccc-
A0A8B9SFH3_BCL2-01      gc-------------------------------------------cccc-
A0A8D2P664_BCL2-01      gc-------------------------------------------cncc-
A0A674GNG3_BCL2-01      gc-------------------------------------------cccc-
A0A674GNG3_BCL2-03      gc-------------------------------------------cccc-
A0A8C5TLV4_BCL2-01      gc-------------------------------------------cccc-
A0A672TR23_BCL2-01      gc-------------------------------------------ccct-
A0A8C3JHE5_BCL2-01      gc-------------------------------------------cccc-
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      gc-------------------------------------------cccc-
A0A663FHR0_BCL2-01      gc-------------------------------------------cccc-
A0A8C8ANG9_BCL2-01      gc-------------------------------------------cccc-
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      gc-------------------------------------------cccc-
A0A8C4U538_BCL2-01      gc-------------------------------------------cccc-
A0A8C4U538_BCL2-02      gc-------------------------------------------cccc-
A0A8C3TNF2_BCL2-01      gc-------------------------------------------ccct-
A0A8C3QX54_BCL2-01      gc-------------------------------------------cccc-
A0A803VR88_BCL2-01      gc-------------------------------------------cccc-
A0A803VR88_BCL2-02      gc-------------------------------------------cccc-
A0A8C5IH35_BCL2-05      gc-------------------------------------------cccc-
A0A8C5IH35_BCL2-04      gc-------------------------------------------cccc-
A0A8C5IH35_BCL2-03      gc-------------------------------------------cccc-
A0A8D2N8C6_BCL2-01      ---------------------------------------------cccg-
A0A8D0QLD9_BCL2-07      tt----------------------------------------caggaaa-
A0A4X1TRR9_BCL2-06      tt----------------------------------------caggaaa-
A0A8D0QLD9_BCL2-05      tt----------------------------------------caggaaa-
A0A4X1TRR9_BCL2-05      tt----------------------------------------caggaaa-
A0A8D0QLD9_BCL2-04      tt----------------------------------------caggaaa-
A0A4X1TRR9_BCL2-07      tt----------------------------------------caggaaa-
A0A8D0QLD9_BCL2-06      tt----------------------------------------caggaaa-
A0A4X1TRR9_BCL2-04      tt----------------------------------------caggaaa-
A0A4X1TRR9_BCL2-02      tt----------------------------------------caggaaa-
A0A8D0QLD9_BCL2-02      tt----------------------------------------caggaaa-
A0A8C6RID6_BCL2-01      gc-cgcgcctcccg------------------------------gctgc-
A0A8C6RID6_BCL2-02      gc-cgcgcctcccg------------------------------gctgc-
Q6R755_BCL2-01          ac-taaggccca------------------------------tagtcgc-
Q923R6_BCL2-01          ac-taaggccca------------------------------tagtcgc-
A0A8C8U7I9_BCL2-01      ac-cacggccca------------------------------tagtcgc-
Q6NTH7_BCL2-01          tc-tcaggcccc------------------------------tcgttgc-
A0A8C6H5J8_BCL2-01      tc-tcaggcccc------------------------------tcgttgc-
Q7TSN8_BCL2-01          tc-tcaggcccc------------------------------tcgttgc-
A0A8I6AJ02_BCL2-01      tc-tacggcccc------------------------------ttgtcgc-
P49950_BCL2-01          tc-tacggcccc------------------------------ttgtcgc-
A0A4W2DSR6_BCL2-02      gc-cgccgcccccg------------------------------gccgc-
A0A4W2DSR6_BCL2-02      gc-cgccgcccccg------------------------------gccgc-
A0A8C6CUJ2_BCL2-01      gc-cgccg---ccg------------------------------gccgc-
A0A4W2DSR6_BCL2-01      gc-cgccgcccccg------------------------------gccgc-
A0A4W2DSR6_BCL2-01      gc-cgccgcccccg------------------------------gccgc-
F6R2C4_BCL2-01          gc-cgccgcccccg------------------------------gccgc-
O02718_BCL2-01          gc-cgccgcccccg------------------------------gccgc-
A0A076FU27_BCL2-01      gc-cgccgcccccg------------------------------gccgc-
A0A076FZV9_BCL2-01      gc-cgccgcccccg------------------------------gccgc-
A0A452EV13_BCL2-01      gc-cgccgcccccg------------------------------gccgc-
A0A8C5JYS0_BCL2-01      gc-cgccggccgcggccgccc-----------------------------
G3SLZ1_BCL2-01          gc-------tccaggctgacc---------------------------c-
G3SLZ1_BCL2-02          gc-------tccaggctgacc---------------------------c-
H0W1T3_BCL2-01          ac-cgccacccctggccggcc---------------------tcgccgt-
A0A5F9CRQ4_BCL2-01      gc-cgccgccgccg---------------------------------gc-
A0A5F9CRQ4_BCL2-02      gc-cgccgccgccg---------------------------------gc-
M3YYK3_BCL2-01          tc--------cccggccaccg------------ccctcgccgccgctgc-
A0A8D2AUF5_BCL2-01      ac-cgccacccccggatgccc---------------------ccgctgc-
I3MVK9_BCL2-01          ac-cgccacccccggctgccc---------------------ccgctgc-
A0A8C5YTS1_BCL2-01      --------cccccggc--ccc---------------------ccgctgc-
A0A8D2IIB8_BCL2-01      ac-cgccacccccggctgccc---------------------ccgctgc-
A0A250YD83_BCL2-01      gc-tgccgcccccggtcgccc---------------------ccgccgc-
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      gc-cgccgccgctggccggcc---------------------tcgccgc-
A0A8C9HUK6_BCL2-02      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2K5EB04_BCL2-01      gc-cgccgcccccggccgccc------------------ccgccgccgc-
A0A2K6UEL3_BCL2-01      nn-nnnnnnnnnnnnnnnnnn---------------------nnnnnnn-
A0A2R8MY14_BCL2-01      gc-cgccgcccccagccgccc------------------ccgccgccgc-
A0A2K6R2I5_BCL2-02      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2K5HK49_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A7I2V3S7_BCL2-04      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-10      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-05      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-08      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7N9CNB8_BCL2-01      gc-tgccgaccccggctgccc---------------ccgccgccgccgc-
A0A8D2EFR4_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2K5XRD4_BCL2-01      ac-tgccgaccccggctgccc---------------------ccgccgc-
A0A2K5NZS5_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A0D9S017_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A5F7ZZ15_BCL2-01      gc-tgccgaccccggctgccc---------------ccgccgccgccgc-
A0A2K6CIX3_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A096MPU7_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A2K6KHG1_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2K6R2I5_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2J8W3J1_BCL2-01      gc-tgccgaccccggctgccc---------------------ctggcgc-
A0A8C9HUK6_BCL2-01      gc-tgccgaccccggctgccc---------------------ccgccgc-
A0A2I3GZF9_BCL2-01      gc-tgccgaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-06      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-07      gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A2R9APW6_BCL2-01      --------------------------------------------------
G3QES9_BCL2-01          gc-tgcagaccccggctgccc---------------------ccggcgc-
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          ---------ccccggccgccc---------------ccgccgccgccgc-
A0A8B7H1C6_BCL2-01      ---------ccccggccgccc---------------------acgccgc-
A0A8C9AC52_BCL2-01      ---------ccccggccgccc---------------------ccgctgc-
A0A2K6G3I7_BCL2-01      ---------ccccg------c---------------------ccgccgc-
A0A3Q2HRY3_BCL2-02      gc-tgctacccccggccgccc---------------------ccgccgg-
A0A8C4L1K6_BCL2-01      gc-tgctacccccggccgccc---------------------ccgccgg-
A0A3Q2HRY3_BCL2-01      gc-tgctacccccggccgccc---------------------ccgccgg-
A0A673VDM8_BCL2-01      nn-nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngccgcccccgccgc-
A0A5F5Y6Y3_BCL2-02      gc-cgccgcccccggtcgcccccgcc------gccgccgccgccgccgc-
A0A8C9J3W6_BCL2-01      ---------------------------------nnnnnnnngccgccgc-
Q8I008_BCL2-01          gc-cgccgcccccggtcgccc------------ccgccgccgccgccgc-
A0A667GHH0_BCL2-01      gc-cgccgcccccggtcgccc---------------------ccgccgc-
A0A5F5Y6Y3_BCL2-01      gc-cgccgcccccggtcgcccccgcc------gccgccgccgccgccgc-
A0A8C8XJU8_BCL2-01      gc-cgccgcccccggtcgccc---cc------gccgccgccgccgccgc-
A0A8C7B9K2_BCL2-01      gc-ccccgccccccgccgccc---------------tcgccgccgctgc-
G1LIC9_BCL2-01          gc-caccgcccccggccgccc---------------ccgccgccgccgc-
A0A452R110_BCL2-01      gcttaccgcccccggccgccc------------ccgccgccgccgccgc-
A0A452R110_BCL2-02      gcttaccgcccccggccgccc------------ccgccgccgccgccgc-
A0A8C0NC28_BCL2-03      gc-ccccgccccccgccgcccccgctgccgccgccgccgccgccgccgc-
A0A8I3MLT5_BCL2-02      gc-ccccgccccccgccgcccccgct---------gccgccgccgccgc-
A0A8C0NC28_BCL2-02      gc-ccccgccccccgccgcccccgctgccgccgccgccgccgccgccgc-
Q75SV7_BCL2-01          gc-ccccgccccccgccgcccccgctgccgccgccgccgccgccgccga-
A0A8C0KWE3_BCL2-01      gc-ccccgccccccgccgcccccgcc------gccgccgccgccgccgc-
A0A8C0NC28_BCL2-01      gc-ccccgccccccgccgcccccgctgccgccgccgccgccgccgccgc-
A0A8I3MLT5_BCL2-01      gc-ccccgccccccgccgcccccgct---------gccgccgccgccgc-
A0A8C6AXM8_BCL2-01      gc-cgccgccccagaccgctc------------------ccgccgcccc-
A0A8C9CJ69_BCL2-01      gc-cgccgccccagaccgctc------------------ccgccgcccc-
A0A8B8V3A7_BCL2-02      gc-cgccgccccagaccgccc------------------ccgccgcccc-
A0A8B8V3A7_BCL2-01      gc-cgccgccccagaccgccc------------------ccgccgcccc-
A0A8B8V3A7_BCL2-03      gc-cgccgccccagaccgccc------------------ccgccgcccc-
A0A8C3WCN0_BCL2-01      gc-caccgcccccgaccgccc---------------------ccgccgc-
A0A8D0QLD9_BCL2-03      gc-cgccgaccccgaccgccc---ccgccgccaccgccgccgccgccgc-
A0A4X1TRR9_BCL2-01      gc-cgccgaccccgaccgccc---ccgccgccaccgccgccgccgccgc-
A0A8D0QLD9_BCL2-01      gc-cgccgaccccgaccgccc---ccgccgccaccgccgccgccgccgc-
A0A4X1TRR9_BCL2-03      gc-cgccgaccccgaccgccc---ccgccgccaccgccgccgccgccgc-
                                                                          

A3KNH9_BCL2-01          -----ctctga------------------------atgcctgatagc---
Q564A4_BCL2-01          -----ctctga------------------------atgcctgatagc---
X4ZGI8_BCL2-01          -----ctctga------------------------atgcctgatagcaaa
A0A673HVU7_BCL2-01      -----ctctga------------------------atgcctgatagctca
A0A4W4F7Z4_BCL2-01      -----------------------------------ccgacccgtatgctg
B9ZYL7_BCL2-01          agctgaattgaatgtcgaaccaagagatcttaatgttaatccagatgcca
A0A8C5MT36_BCL2-03      gggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaa
A0A8C5MT36_BCL2-01      gggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaa
A0A8C5MT36_BCL2-02      gggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaa
A0A8C5MT36_BCL2-04      gggtgtgttgaacgttacccaaggaaattctaatgttgattcgggcgcaa
A0A7M4G2E0_BCL2-01      tgtgtgtacgg------------------------gggcattgccttcag
A0A7M4G2E0_BCL2-02      tgtgtgtacgg------------------------gggcattgccttcag
A0A673Z0A3_BCL2-01      -----ctccca------------------------aacaggatcccgcaa
A0A8C7CHJ0_BCL2-01      -----ctccaa------------------------aacaggatcccgcaa
A0A8C7Q7B4_BCL2-01      -----ctccaa------------------------aacaggatcccgcaa
A0A0U3DHY6_BCL2-01      -----ttccaa------------------------aacaggagtccgcaa
A0A4W5NW18_BCL2-01      -----taccaa------------------------aacaggagtccgcaa
A0A674B8T7_BCL2-01      -----taccaa------------------------aacaggagtccgcaa
A0A8C7RG50_BCL2-01      -----taccaa------------------------aacaggagtccgcaa
A0A8C8GL24_BCL2-01      -----taccaa------------------------aacagcagtccgcaa
A0A6Q2YIU6_BCL2-01      -----tccaaa------------------------tggct---ctcccaa
A0A4W5KV00_BCL2-01      -----tccaaa------------------------tggct---ctcccaa
A0A8C7G8X1_BCL2-01      -----tccaaa------------------------tggct---ctcccaa
A0A674B0E5_BCL2-01      -----tccaaa------------------------tggct---ctcccaa
A0A8C8JWJ1_BCL2-02      -----tccaaa------------------------cggct---ctcccaa
A0A8C7N3I9_BCL2-01      -----tccaaa------------------------cggct---ctcccaa
A0A8C8JWJ1_BCL2-01      -----tccaaa------------------------cggct---ctcccaa
A0A8C5C4C3_BCL2-01      -----tccaag------------------------cggat-----cacgg
A0A3B4A3G8_BCL2-01      -------------------------------------------cgctccg
A0A3Q3B0R2_BCL2-01      tcctctgcggg------------------------cggat---ctccccg
A0A8C7ZK61_BCL2-01      t------caga------------------------gcgct---ctcccgg
A0A3P8WUE9_BCL2-01      -----tgcaaa------------------------cggcc---acctgcg
A0A665U7Y7_BCL2-01      -----tacgga------------------------cggcc---cccgcag
A0A672HHE5_BCL2-01      -----tgcagg------------------------cggcc---gcagcag
A0A3Q3G1D7_BCL2-01      -----tgcaaa------------------------cggcc---cccccag
A0A8C2X310_BCL2-06      -----tgcaaa------------------------cggct---cccgcag
A0A3Q3MEY1_BCL2-01      -----tgcaga------------------------gggct---ccctcag
A0A2U9BJ09_BCL2-01      -----tgtagg------------------------cggcc---gcctcag
A0A8C9ZFJ5_BCL2-09      -----tgcaaa------------------------cggct---cccccag
A0A7N6A4C8_BCL2-01      -----tgcaga------------------------cggct---ccctccg
A0A3Q0S5Z7_BCL2-01      -----tgcaga------------------------cggct---cccacag
A0A668TEB6_BCL2-05      -----tgcaga------------------------cggct---cccacag
A0A3P8QVM8_BCL2-01      -----tgcaga------------------------cggct---cccacag
A0A3P9DIG5_BCL2-01      -----tgcaga------------------------cggct---cccacag
A0A3Q2UYW8_BCL2-01      -----tgcaga------------------------cggct---cccacag
A0A3B4G3K4_BCL2-01      -----tgcaga------------------------cggct---cccacag
A0A4W6DDI0_BCL2-01      -----cgcagg------------------------cggctcaaccctcag
A0A1X9JZA1_BCL2-01      -----tgcaca------------------------cggct---cccccag
A0A3B4TX71_BCL2-01      -----tgcaga------------------------cggct---ctctcag
A0A3B4YAG2_BCL2-01      -----tgcaga------------------------cggct---ctctcag
A0A3B5BBQ0_BCL2-01      -----tgcaga------------------------cggct---cccccag
A0A3Q1B8C3_BCL2-01      -----tgcaga------------------------cggct---cccccag
A0A3P8S9L3_BCL2-01      -----tgcaga------------------------cggct---cccccag
A0A3Q1FLK7_BCL2-01      -----tgcaga------------------------cggct---cccccag
A0A673LV42_BCL2-01      -----cgtcac--------------------------gacccgtgcaggg
A0A8C1IQE4_BCL2-01      -----cgtcac--------------------------gacccgtgcagcg
A0A672T179_BCL2-01      -----cgtcac--------------------------gacccgtgcagcg
A0A3B3TCS4_BCL2-01      -----agccgg------------------------acgcccagatttgat
A0A8C9T5U7_BCL2-01      -----agccgc------------------------gcgccccactgcgac
W5N4F7_BCL2-01          -----cgccgg------------------------------acccccccg
H9GPE7_BCL2-01          -----caggga------------------------agaacct------ga
A0A8D2Q1J0_BCL2-01      -----------------------------------agcaactgatggcta
A0A8D2Q1J0_BCL2-03      -----------------------------------agcaactgatggcta
A0A668TEB6_BCL2-01      -----gtttta------------------------aaaaattgatggaag
A0A668TEB6_BCL2-04      -----gtttta------------------------aa-------------
A0A668TEB6_BCL2-02      -----gtttta------------------------aaaaattgatggaag
A0A668TEB6_BCL2-03      -----gtttta------------------------aaaaattgatggaag
A0A3Q3MEY1_BCL2-02      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-10      -----gtttta------------------------aa-------------
A0A3Q3MEY1_BCL2-08      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-04      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-05      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-07      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-09      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-03      -----gtttta------------------------aaaaactgatggaag
A0A3Q3MEY1_BCL2-06      -----gtttta------------------------aa-------------
A0A7N6A4C8_BCL2-02      -----gtttta------------------------aaaaactgatggaag
A0A7N6A4C8_BCL2-04      -----ttcacc------------------------agaaactgatggaag
A0A7N6A4C8_BCL2-07      -----gtttta------------------------aa-------------
A0A7N6A4C8_BCL2-05      -----gtttta------------------------aaaaactgatggaag
A0A7N6A4C8_BCL2-03      -----gtttta------------------------aaaaactgatggaag
A0A7N6A4C8_BCL2-06      -----gtttta------------------------aa-------------
A0A8C2X310_BCL2-01      -----gtttta------------------------aaaaactgatggaag
A0A8C2X310_BCL2-02      -----gtttta------------------------aaaaactgatggaag
A0A8C2X310_BCL2-04      -----gtttta------------------------aaaaactgatggaag
A0A8C2X310_BCL2-05      -----gtttta------------------------aa-------------
A0A8C2X310_BCL2-03      -----gtttta------------------------aaaaactgatggaag
A0A8C9ZFJ5_BCL2-01      -----gtttta------------------------agaaactgatggaag
A0A8C9ZFJ5_BCL2-05      -----gtttta------------------------agaaactgatggaag
A0A8C9ZFJ5_BCL2-06      -----gtttta---------------------------------------
A0A8C9ZFJ5_BCL2-02      -----gttttaagtcagaaaggaggttaaattcccagaaactgatggaag
A0A8C9ZFJ5_BCL2-03      -----gtttta------------------------agaaactgatggaag
A0A8C9ZFJ5_BCL2-04      -----gtttta------------------------agaaactgatggaag
A0A8C9ZFJ5_BCL2-07      -----gtttta------------------------agaaactgatggaag
A0A8C9ZFJ5_BCL2-08      -----gtttta------------------------agaaactgatggaag
A0A674GNG3_BCL2-02      -----ttttga------------------------aagattaatgg-cag
A0A674GNG3_BCL2-04      -----ttttga------------------------aagattaatgg-cag
A0A8C5IH35_BCL2-01      -----ttttga------------------------aagattaatgg-cag
A0A8C5IH35_BCL2-02      -----ttttga------------------------aagattaatgg-cag
A0A670IB81_BCL2-01      -----ggctgg------------------------cggaccg------ca
A0A8D0BPX3_BCL2-01      -----agtcga------------------------cgagtgg------cg
A0A8D2Q1J0_BCL2-02      -----tgctga------------------------cgaacta------ca
A0A8C5S4J3_BCL2-01      -----cactga------------------------aga---a------ca
A0A670ZV01_BCL2-01      -----cactga------------------------aga---a------ca
A0A8D0L5Z6_BCL2-01      -----tgatga------------------------tgcacta------aa
A0A7M4EPU7_BCL2-01      -----tggtaa------------------------tgacctg------gg
A0A7M4G2E0_BCL2-03      -----tggtaa------------------------tgagccg------gg
A0A8C8SWU7_BCL2-01      -----tggtga------------------------gggactg------ag
K7F5Y3_BCL2-02          -----tggtga------------------------tgggctg------cg
K7F5Y3_BCL2-01          -----tggtga------------------------tgggctg------cg
K7F5Y3_BCL2-03          -----tggtga------------------------tgggctg------cg
A0A452I9V7_BCL2-01      -----tggtga------------------------tgggctg------cg
A0A8C3SV21_BCL2-01      -----tggtga------------------------tgggctg------ca
A0A8C3ITE1_BCL2-01      -----tggtga------------------------tgggctg------cg
A0A674IMR0_BCL2-01      -----tggtga------------------------tgggctg------cg
A0A8C0G2Q6_BCL2-01      -----tggtga------------------------tgggctg------ca
A0A8C4VT25_BCL2-01      -----tggtga------------------------tgggctg------cg
A0A7N4PQN7_BCL2-01      -----tgctgc------------------------tggaccagctgtcag
F6YNL8_BCL2-01          -----tgctgc------------------------tggacctaccgtcag
A0A4X2L5Q0_BCL2-01      -----tgccgc------------------------tggacctgctgtcag
A0A8C2U1A2_BCL2-01      -----agctga------------------------ggggctg-----c-g
A0A8C9L7I6_BCL2-01      -----ggctga------------------------ggggctg-----c-g
G1MZW1_BCL2-01          -----agctga------------------------ggggctg-----c-g
A0A8C3LBC4_BCL2-01      -----agctga------------------------ggggctg-----a-g
A0A669PDH6_BCL2-01      -----ggctga------------------------ggggctg-----c-g
A0A8C9MG30_BCL2-01      -----agcaga------------------------ggggctg-----c-g
A0A663MPN9_BCL2-01      ------------------------------------gggctg-----cag
A0A8C6ZF48_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8B9PRT7_BCL2-01      -----gggtga------------------------cgggctg-----c-g
A0A8B9PRT7_BCL2-02      -----gggtga------------------------cgggctg-----c-g
A0A8C0UAC7_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8B9UYC3_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8B9E2U6_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8B9C4H4_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8C3CIW8_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A493T1X3_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8B9SFH3_BCL2-01      -----gggcga------------------------ggggctg-----c-g
A0A8D2P664_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A674GNG3_BCL2-01      -----agccga------------------------ggggctg-----c-g
A0A674GNG3_BCL2-03      -----agccga------------------------ggggctg-----c-g
A0A8C5TLV4_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A672TR23_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8C3JHE5_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      -----ggccga------------------------ggggctg-----c-c
A0A663FHR0_BCL2-01      -----ggccga------------------------ggggctg-----c-c
A0A8C8ANG9_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8C4U538_BCL2-01      -----ggctga------------------------ggggctg-----c-g
A0A8C4U538_BCL2-02      -----ggctga------------------------ggggctg-----c-g
A0A8C3TNF2_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A8C3QX54_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A803VR88_BCL2-01      -----ggccga------------------------ggggctg-----c-g
A0A803VR88_BCL2-02      -----ggccga------------------------ggggctg-----c-g
A0A8C5IH35_BCL2-05      -----ggccga------------------------ggggctg-----c-g
A0A8C5IH35_BCL2-04      -----ggccga------------------------ggggctg-----c-g
A0A8C5IH35_BCL2-03      -----ggccga------------------------ggggctg-----c-g
A0A8D2N8C6_BCL2-01      -----gggcga------------------------gcggcgg-----c--
A0A8D0QLD9_BCL2-07      -----atttga------------------------agatcttgaagttag
A0A4X1TRR9_BCL2-06      -----atttga------------------------agatcttgaagttag
A0A8D0QLD9_BCL2-05      -----atttga------------------------agatcttgaagttag
A0A4X1TRR9_BCL2-05      -----atttga------------------------agatcttgaagttag
A0A8D0QLD9_BCL2-04      -----atttga------------------------agatcttgaagttag
A0A4X1TRR9_BCL2-07      -----atttga------------------------agatcttgaagttag
A0A8D0QLD9_BCL2-06      -----atttga------------------------agatcttgaagttag
A0A4X1TRR9_BCL2-04      -----atttga------------------------agatcttgaagttag
A0A4X1TRR9_BCL2-02      -----atttga------------------------agatcttgaagttag
A0A8D0QLD9_BCL2-02      -----atttga------------------------agatcttgaagttag
A0A8C6RID6_BCL2-01      -----aatggc------------------------tgggcaggcgctcag
A0A8C6RID6_BCL2-02      -----aatggc------------------------tgggcaggcgctcag
Q6R755_BCL2-01          -----caccac------------------------tgggcctacccttag
Q923R6_BCL2-01          -----caccac------------------------tgggcctacccttag
A0A8C8U7I9_BCL2-01      -----caccgc------------------------tggacctgcgctcag
Q6NTH7_BCL2-01          -----caccgc------------------------tgggcctgcgctcag
A0A8C6H5J8_BCL2-01      -----caccgc------------------------tgggcctgcgctcag
Q7TSN8_BCL2-01          -----caccgc------------------------tgggcctgcgctcag
A0A8I6AJ02_BCL2-01      -----caccgc------------------------tgggcctgcgctcag
P49950_BCL2-01          -----caacgc------------------------tgggcctgcgctcag
A0A4W2DSR6_BCL2-02      -----cgccgc------------------------cgggcctgcgcccag
A0A4W2DSR6_BCL2-02      -----cgccgc------------------------cgggcctgcgcccag
A0A8C6CUJ2_BCL2-01      -----cgccgc------------------------cgggcccgcgcccag
A0A4W2DSR6_BCL2-01      -----cgccgc------------------------cgggcctgcgcccag
A0A4W2DSR6_BCL2-01      -----cgccgc------------------------cgggcctgcgcccag
F6R2C4_BCL2-01          -----cgccgc------------------------cgggcctgcgcccag
O02718_BCL2-01          -----cgccgc------------------------cgggcctgcgcccag
A0A076FU27_BCL2-01      -----cgccgc------------------------cgggcctgcgcccag
A0A076FZV9_BCL2-01      -----cgccgc------------------------cgggcctgcgcccag
A0A452EV13_BCL2-01      -----cgccgc------------------------cgggcctgcgcccag
A0A8C5JYS0_BCL2-01      -------ccgc------------------------cgggcctctgcctgg
G3SLZ1_BCL2-01          -----ggccgc------------------------gcagccggcgctcag
G3SLZ1_BCL2-02          -----ggccgc------------------------gcagccggcgctcag
H0W1T3_BCL2-01          -----cgccca------------------------ggggcctgcgctcag
A0A5F9CRQ4_BCL2-01      -----cgccgc------------------------ggggcccgcgctcag
A0A5F9CRQ4_BCL2-02      -----cgccgc------------------------ggggcccgcgctcag
M3YYK3_BCL2-01          -----cgccgc------------------------gggccctgcgctcag
A0A8D2AUF5_BCL2-01      -----cgccgc------------------------ggggcctgtgctcag
I3MVK9_BCL2-01          -----cgccgc------------------------ggggcccgtgctcag
A0A8C5YTS1_BCL2-01      -----cgccgc------------------------ggggcccgtgctcag
A0A8D2IIB8_BCL2-01      -----cgccgc------------------------ggggcccgtgctcag
A0A250YD83_BCL2-01      -----ccgcgc------------------------cgggcctgcgctcag
A0A452T603_BCL2-01      --------------------------------------------------
A0A8C2VKS3_BCL2-01      -----cgccgc------------------------gggacctgcgctcag
A0A8C9HUK6_BCL2-02      -----cgccgc------------------------ggggcctgcgctcag
A0A2K5EB04_BCL2-01      -----cgccac------------------------ggggcctgcgctcag
A0A2K6UEL3_BCL2-01      -----nnnnnn------------------------nnnnnnnnnnnncag
A0A2R8MY14_BCL2-01      -----cgccac------------------------ggggcctacgctcag
A0A2K6R2I5_BCL2-02      -----cgccgc------------------------ggggcctgcgctcag
A0A2K5HK49_BCL2-01      -----cgccgc------------------------ggggcctgcgcttag
A0A7I2V3S7_BCL2-04      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-10      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-05      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-08      -----cgccgc------------------------ggggcctgcgctcag
A0A7N9CNB8_BCL2-01      -----cgtcgc------------------------ggggcctgcgctcag
A0A8D2EFR4_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2K5XRD4_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2K5NZS5_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A0D9S017_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A5F7ZZ15_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2K6CIX3_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A096MPU7_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -----cgccgc------------------------ggggcctgcgctcag
A0A2K6KHG1_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2K6R2I5_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2J8W3J1_BCL2-01      -----cgccgt------------------------ggggcctgcgctcag
A0A8C9HUK6_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2I3GZF9_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-06      -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-07      -----cgccgc------------------------ggggcctgcgctcag
A0A2R9APW6_BCL2-01      ---------------------------------------------ctcag
G3QES9_BCL2-01          -----cgccgc------------------------ggggcctgcgctcag
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -----cgccgc------------------------ggagcctctgctcag
A0A8B7H1C6_BCL2-01      -----tgccgc------------------------ggggcctgcgctcag
A0A8C9AC52_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A2K6G3I7_BCL2-01      -----cgccgc------------------------ggggcctgcgcccag
A0A3Q2HRY3_BCL2-02      -----cgccgc------------------------gggacctgccctcag
A0A8C4L1K6_BCL2-01      -----cgccgc------------------------gggacctgccctcag
A0A3Q2HRY3_BCL2-01      -----cgccgc------------------------gggacctgccctcag
A0A673VDM8_BCL2-01      -----cgccgc------------------------gggccccgcgctcag
A0A5F5Y6Y3_BCL2-02      -----cgccgc------------------------gggccctgcgctcag
A0A8C9J3W6_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
Q8I008_BCL2-01          -----tgccgc------------------------gggccctgcgctcag
A0A667GHH0_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
A0A5F5Y6Y3_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
A0A8C8XJU8_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
A0A8C7B9K2_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
G1LIC9_BCL2-01          -----cgccgc------------------------gggccctgcgctcag
A0A452R110_BCL2-01      -----cgccgc------------------------gggccctgcgctcag
A0A452R110_BCL2-02      -----cgccgc------------------------gggccctgcgctcag
A0A8C0NC28_BCL2-03      -----cgccgc------------------------gggccccgcgcccag
A0A8I3MLT5_BCL2-02      -----cgccgc------------------------gggccccgcgcccag
A0A8C0NC28_BCL2-02      -----cgccgc------------------------gggccccgcgcccag
Q75SV7_BCL2-01          -----cgccgc------------------------gggccccgcgcccag
A0A8C0KWE3_BCL2-01      -----cgccgc------------------------gggccccgcgcccag
A0A8C0NC28_BCL2-01      -----cgccgc------------------------gggccccgcgcccag
A0A8I3MLT5_BCL2-01      -----cgccgc------------------------gggccccgcgcccag
A0A8C6AXM8_BCL2-01      -----cgccag------------------------ggggcctgcgctcag
A0A8C9CJ69_BCL2-01      -----cgccag------------------------ggggcctgcgctcag
A0A8B8V3A7_BCL2-02      -----cgccgg------------------------ggggcctgcgctcag
A0A8B8V3A7_BCL2-01      -----cgccgg------------------------ggggcctgcgctcag
A0A8B8V3A7_BCL2-03      -----cgccgg------------------------ggggcctgcgctcag
A0A8C3WCN0_BCL2-01      -----cgccgc------------------------ggggcctgcgctcag
A0A8D0QLD9_BCL2-03      -----cgccgc------------------------ggggcctgtactcag
A0A4X1TRR9_BCL2-01      -----cgccgc------------------------ggggcctgtactcag
A0A8D0QLD9_BCL2-01      -----cgccgc------------------------ggggcctgtactcag
A0A4X1TRR9_BCL2-03      -----cgccgc------------------------ggggcctgtactcag
                                                                          

A3KNH9_BCL2-01          ccg----------------------------------------------g
Q564A4_BCL2-01          ccg----------------------------------------------g
X4ZGI8_BCL2-01          ccg----------------------------------------------g
A0A673HVU7_BCL2-01      ccg----------------------------------------------g
A0A4W4F7Z4_BCL2-01      ctc-----------------------------------------------
B9ZYL7_BCL2-01          gtcgtgctgcagatggtgataataatgatgctgatggtggtgatgaagct
A0A8C5MT36_BCL2-03      atcaattagtggatggcga------------------tggagaggatgct
A0A8C5MT36_BCL2-01      atcaattagtggatggcga------------------tggagaggatgct
A0A8C5MT36_BCL2-02      atcaattagtggatggcga------------------tggagaggatgct
A0A8C5MT36_BCL2-04      atcaattagtggatggcga------------------tggagaggatgct
A0A7M4G2E0_BCL2-01      cct-----gacaatggctg------------------------------c
A0A7M4G2E0_BCL2-02      cct-----gacaatggctg------------------------------c
A0A673Z0A3_BCL2-01      ccg-----------------------------------------------
A0A8C7CHJ0_BCL2-01      ccg-----------------------------------------------
A0A8C7Q7B4_BCL2-01      cct-----------------------------------------------
A0A0U3DHY6_BCL2-01      ccg-----------------------------------------------
A0A4W5NW18_BCL2-01      cct-----------------------------------------------
A0A674B8T7_BCL2-01      cct-----------------------------------------------
A0A8C7RG50_BCL2-01      cct-----------------------------------------------
A0A8C8GL24_BCL2-01      cct-----------------------------------------------
A0A6Q2YIU6_BCL2-01      cca-----------------------------------------------
A0A4W5KV00_BCL2-01      ccg-----------------------------------------------
A0A8C7G8X1_BCL2-01      ccg-----------------------------------------------
A0A674B0E5_BCL2-01      ccg-----------------------------------------------
A0A8C8JWJ1_BCL2-02      acg-----------------------------------------------
A0A8C7N3I9_BCL2-01      acg-----------------------------------------------
A0A8C8JWJ1_BCL2-01      acg-----------------------------------------------
A0A8C5C4C3_BCL2-01      ccc----------------------------------------------g
A0A3B4A3G8_BCL2-01      tcc-----------------------------------------------
A0A3Q3B0R2_BCL2-01      cac-----------------------------------------------
A0A8C7ZK61_BCL2-01      gcg-----------------------------------------------
A0A3P8WUE9_BCL2-01      ccc-----------------------------------------------
A0A665U7Y7_BCL2-01      tcc-----------------------------------------------
A0A672HHE5_BCL2-01      tcc-----------------------------------------------
A0A3Q3G1D7_BCL2-01      tcc-----------------------------------------------
A0A8C2X310_BCL2-06      tcc-----------------------------------------------
A0A3Q3MEY1_BCL2-01      tcc-----------------------------------------------
A0A2U9BJ09_BCL2-01      tcc-----------------------------------------------
A0A8C9ZFJ5_BCL2-09      tcc-----------------------------------------------
A0A7N6A4C8_BCL2-01      tcc-----------------------------------------------
A0A3Q0S5Z7_BCL2-01      tcc-----------------------------------------------
A0A668TEB6_BCL2-05      tcc-----------------------------------------------
A0A3P8QVM8_BCL2-01      tcc-----------------------------------------------
A0A3P9DIG5_BCL2-01      tcc-----------------------------------------------
A0A3Q2UYW8_BCL2-01      tcc-----------------------------------------------
A0A3B4G3K4_BCL2-01      tcc-----------------------------------------------
A0A4W6DDI0_BCL2-01      ccc-----------------------------------------------
A0A1X9JZA1_BCL2-01      tcc-----------------------------------------------
A0A3B4TX71_BCL2-01      tcc-----------------------------------------------
A0A3B4YAG2_BCL2-01      tcc-----------------------------------------------
A0A3B5BBQ0_BCL2-01      tcc-----------------------------------------------
A0A3Q1B8C3_BCL2-01      tcc-----------------------------------------------
A0A3P8S9L3_BCL2-01      tcc-----------------------------------------------
A0A3Q1FLK7_BCL2-01      tcc-----------------------------------------------
A0A673LV42_BCL2-01      ctc-----------------------------------------------
A0A8C1IQE4_BCL2-01      cgc-----------------------------------------------
A0A672T179_BCL2-01      ctc-----------------------------------------------
A0A3B3TCS4_BCL2-01      cc------------------------------------------------
A0A8C9T5U7_BCL2-01      ccc----------------------------------------------c
W5N4F7_BCL2-01          cccg----------------------------------------------
H9GPE7_BCL2-01          ccc----------------------------------------------g
A0A8D2Q1J0_BCL2-01      tca-----------------------------------------------
A0A8D2Q1J0_BCL2-03      tca-----------------------------------------------
A0A668TEB6_BCL2-01      tga-----------------------------------------------
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tga-----------------------------------------------
A0A668TEB6_BCL2-03      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-02      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-04      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-05      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-07      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-09      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-03      tga-----------------------------------------------
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      tga-----------------------------------------------
A0A7N6A4C8_BCL2-04      tga-----------------------------------------------
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      tga-----------------------------------------------
A0A7N6A4C8_BCL2-03      tga-----------------------------------------------
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      tga-----------------------------------------------
A0A8C2X310_BCL2-02      tga-----------------------------------------------
A0A8C2X310_BCL2-04      tga-----------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      tga-----------------------------------------------
A0A8C9ZFJ5_BCL2-01      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-05      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-03      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-04      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-07      taa-----------------------------------------------
A0A8C9ZFJ5_BCL2-08      taa-----------------------------------------------
A0A674GNG3_BCL2-02      tca-----------------------------------------------
A0A674GNG3_BCL2-04      tca-----------------------------------------------
A0A8C5IH35_BCL2-01      tga-----------------------------------------------
A0A8C5IH35_BCL2-02      tga-----------------------------------------------
A0A670IB81_BCL2-01      ccc----------------------------------------------t
A0A8D0BPX3_BCL2-01      ccc----------------------------------------------t
A0A8D2Q1J0_BCL2-02      ccc----------------------------------------------a
A0A8C5S4J3_BCL2-01      tcc----------------------------------------------t
A0A670ZV01_BCL2-01      tcc----------------------------------------------t
A0A8D0L5Z6_BCL2-01      ccc----------------------------------------------a
A0A7M4EPU7_BCL2-01      ccc----------------------------------------------a
A0A7M4G2E0_BCL2-03      ccc----------------------------------------------a
A0A8C8SWU7_BCL2-01      ccc----------------------------------------------g
K7F5Y3_BCL2-02          ctc----------------------------------------------a
K7F5Y3_BCL2-01          ctc----------------------------------------------a
K7F5Y3_BCL2-03          ctc----------------------------------------------a
A0A452I9V7_BCL2-01      ccc----------------------------------------------a
A0A8C3SV21_BCL2-01      ccc----------------------------------------------a
A0A8C3ITE1_BCL2-01      ccc----------------------------------------------a
A0A674IMR0_BCL2-01      ccc----------------------------------------------a
A0A8C0G2Q6_BCL2-01      ccc----------------------------------------------a
A0A8C4VT25_BCL2-01      ccc----------------------------------------------a
A0A7N4PQN7_BCL2-01      tcc----------------------------------------------a
F6YNL8_BCL2-01          tcc----------------------------------------------a
A0A4X2L5Q0_BCL2-01      tcc----------------------------------------------a
A0A8C2U1A2_BCL2-01      ccc----------------------------------------------c
A0A8C9L7I6_BCL2-01      ccc----------------------------------------------c
G1MZW1_BCL2-01          ccc----------------------------------------------c
A0A8C3LBC4_BCL2-01      ccc----------------------------------------------c
A0A669PDH6_BCL2-01      ccc----------------------------------------------c
A0A8C9MG30_BCL2-01      ccc----------------------------------------------c
A0A663MPN9_BCL2-01      ccc----------------------------------------------c
A0A8C6ZF48_BCL2-01      ccc----------------------------------------------g
A0A8B9PRT7_BCL2-01      ccc----------------------------------------------g
A0A8B9PRT7_BCL2-02      ccc----------------------------------------------g
A0A8C0UAC7_BCL2-01      ccc----------------------------------------------c
A0A8B9UYC3_BCL2-01      ccc----------------------------------------------c
A0A8B9E2U6_BCL2-01      ccc----------------------------------------------c
A0A8B9C4H4_BCL2-01      ccc----------------------------------------------c
A0A8C3CIW8_BCL2-01      ccc----------------------------------------------c
A0A493T1X3_BCL2-01      ccc----------------------------------------------c
A0A8B9SFH3_BCL2-01      ccc----------------------------------------------c
A0A8D2P664_BCL2-01      ccc----------------------------------------------c
A0A674GNG3_BCL2-01      ccc----------------------------------------------t
A0A674GNG3_BCL2-03      ccc----------------------------------------------t
A0A8C5TLV4_BCL2-01      ccc----------------------------------------------c
A0A672TR23_BCL2-01      ccc----------------------------------------------t
A0A8C3JHE5_BCL2-01      ccc----------------------------------------------c
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      ccc----------------------------------------------c
A0A663FHR0_BCL2-01      ccc----------------------------------------------c
A0A8C8ANG9_BCL2-01      ccc----------------------------------------------c
A0A8C0IE77_BCL2-01      --------------------------------------------------
A0A8D0G0L7_BCL2-01      ccc----------------------------------------------c
A0A8C4U538_BCL2-01      ccc----------------------------------------------c
A0A8C4U538_BCL2-02      ccc----------------------------------------------c
A0A8C3TNF2_BCL2-01      ccc----------------------------------------------c
A0A8C3QX54_BCL2-01      ccc----------------------------------------------c
A0A803VR88_BCL2-01      ccc----------------------------------------------c
A0A803VR88_BCL2-02      ccc----------------------------------------------c
A0A8C5IH35_BCL2-05      ccc----------------------------------------------c
A0A8C5IH35_BCL2-04      ccc----------------------------------------------c
A0A8C5IH35_BCL2-03      ccc----------------------------------------------c
A0A8D2N8C6_BCL2-01      --------------------------------------------------
A0A8D0QLD9_BCL2-07      tacttttgagaggctcatg------------------------------a
A0A4X1TRR9_BCL2-06      tacttttgagaggctcatg------------------------------a
A0A8D0QLD9_BCL2-05      tacttttgagaggctcatg------------------------------a
A0A4X1TRR9_BCL2-05      tacttttgagaggctcatg------------------------------a
A0A8D0QLD9_BCL2-04      tacttttgagaggctcatg------------------------------a
A0A4X1TRR9_BCL2-07      tactttt-------------------------------------------
A0A8D0QLD9_BCL2-06      tactttt-------------------------------------------
A0A4X1TRR9_BCL2-04      tacttttgagaggctcatg------------------------------a
A0A4X1TRR9_BCL2-02      tacttttgagaggctcatg------------------------------a
A0A8D0QLD9_BCL2-02      tacttttgagaggctcatg------------------------------a
A0A8C6RID6_BCL2-01      ccc----------------------------------------------g
A0A8C6RID6_BCL2-02      ccc----------------------------------------------g
Q6R755_BCL2-01          ccc----------------------------------------------c
Q923R6_BCL2-01          ccc----------------------------------------------c
A0A8C8U7I9_BCL2-01      ccc----------------------------------------------g
Q6NTH7_BCL2-01          ccc----------------------------------------------t
A0A8C6H5J8_BCL2-01      ccc----------------------------------------------t
Q7TSN8_BCL2-01          ccc----------------------------------------------t
A0A8I6AJ02_BCL2-01      ccc----------------------------------------------t
P49950_BCL2-01          ccc----------------------------------------------t
A0A4W2DSR6_BCL2-02      ccc----------------------------------------------g
A0A4W2DSR6_BCL2-02      ccc----------------------------------------------g
A0A8C6CUJ2_BCL2-01      ccc----------------------------------------------g
A0A4W2DSR6_BCL2-01      ccc----------------------------------------------g
A0A4W2DSR6_BCL2-01      ccc----------------------------------------------g
F6R2C4_BCL2-01          ccc----------------------------------------------g
O02718_BCL2-01          ccc----------------------------------------------g
A0A076FU27_BCL2-01      ccc----------------------------------------------g
A0A076FZV9_BCL2-01      ccc----------------------------------------------g
A0A452EV13_BCL2-01      ccc----------------------------------------------g
A0A8C5JYS0_BCL2-01      ccc----------------------------------------------g
G3SLZ1_BCL2-01          ccc----------------------------------------------g
G3SLZ1_BCL2-02          ccc----------------------------------------------g
H0W1T3_BCL2-01          ccc----------------------------------------------g
A0A5F9CRQ4_BCL2-01      ccc----------------------------------------------g
A0A5F9CRQ4_BCL2-02      ccc----------------------------------------------g
M3YYK3_BCL2-01          ccc----------------------------------------------c
A0A8D2AUF5_BCL2-01      ccc----------------------------------------------g
I3MVK9_BCL2-01          ccc----------------------------------------------g
A0A8C5YTS1_BCL2-01      ccc----------------------------------------------g
A0A8D2IIB8_BCL2-01      ccc----------------------------------------------g
A0A250YD83_BCL2-01      ccc----------------------------------------------a
A0A452T603_BCL2-01      ccc----------------------------------------------c
A0A8C2VKS3_BCL2-01      ccc----------------------------------------------g
A0A8C9HUK6_BCL2-02      ccc----------------------------------------------g
A0A2K5EB04_BCL2-01      ccc----------------------------------------------g
A0A2K6UEL3_BCL2-01      ccc----------------------------------------------a
A0A2R8MY14_BCL2-01      ccc----------------------------------------------g
A0A2K6R2I5_BCL2-02      ccc----------------------------------------------g
A0A2K5HK49_BCL2-01      ccc----------------------------------------------a
A0A7I2V3S7_BCL2-04      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-10      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-05      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-08      ccc----------------------------------------------g
A0A7N9CNB8_BCL2-01      ccc----------------------------------------------g
A0A8D2EFR4_BCL2-01      ccc----------------------------------------------g
A0A2K5XRD4_BCL2-01      ccc----------------------------------------------g
A0A2K5NZS5_BCL2-01      ccc----------------------------------------------g
A0A0D9S017_BCL2-01      ccc----------------------------------------------g
A0A5F7ZZ15_BCL2-01      ccc----------------------------------------------g
A0A2K6CIX3_BCL2-01      ccc----------------------------------------------g
A0A096MPU7_BCL2-01      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-03      -------------------------------------------------g
A9QXG9_BCL2-01          ccc----------------------------------------------g
A0A2K6KHG1_BCL2-01      ccc----------------------------------------------g
A0A2K6R2I5_BCL2-01      ccc----------------------------------------------g
A0A2J8W3J1_BCL2-01      ccc----------------------------------------------g
A0A8C9HUK6_BCL2-01      ccc----------------------------------------------g
A0A2I3GZF9_BCL2-01      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-06      ccc----------------------------------------------g
A0A7I2V3S7_BCL2-07      ccc----------------------------------------------g
A0A2R9APW6_BCL2-01      ccc----------------------------------------------g
G3QES9_BCL2-01          ccc----------------------------------------------g
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          ccc----------------------------------------------g
A0A8B7H1C6_BCL2-01      ccc----------------------------------------------a
A0A8C9AC52_BCL2-01      ccc----------------------------------------------g
A0A2K6G3I7_BCL2-01      ccc----------------------------------------------g
A0A3Q2HRY3_BCL2-02      ccc----------------------------------------------t
A0A8C4L1K6_BCL2-01      ccc----------------------------------------------t
A0A3Q2HRY3_BCL2-01      ccc----------------------------------------------t
A0A673VDM8_BCL2-01      ccc----------------------------------------------c
A0A5F5Y6Y3_BCL2-02      ccc----------------------------------------------c
A0A8C9J3W6_BCL2-01      ccc----------------------------------------------t
Q8I008_BCL2-01          ccc----------------------------------------------c
A0A667GHH0_BCL2-01      ccc----------------------------------------------c
A0A5F5Y6Y3_BCL2-01      ccc----------------------------------------------c
A0A8C8XJU8_BCL2-01      ccc----------------------------------------------c
A0A8C7B9K2_BCL2-01      ccc----------------------------------------------g
G1LIC9_BCL2-01          ccc----------------------------------------------c
A0A452R110_BCL2-01      ccc----------------------------------------------c
A0A452R110_BCL2-02      ccc----------------------------------------------c
A0A8C0NC28_BCL2-03      ccc----------------------------------------------c
A0A8I3MLT5_BCL2-02      ccc----------------------------------------------c
A0A8C0NC28_BCL2-02      ccc----------------------------------------------c
Q75SV7_BCL2-01          ccc----------------------------------------------c
A0A8C0KWE3_BCL2-01      ccc----------------------------------------------c
A0A8C0NC28_BCL2-01      ccc----------------------------------------------c
A0A8I3MLT5_BCL2-01      ccc----------------------------------------------c
A0A8C6AXM8_BCL2-01      ccc----------------------------------------------c
A0A8C9CJ69_BCL2-01      ccc----------------------------------------------c
A0A8B8V3A7_BCL2-02      ccc----------------------------------------------c
A0A8B8V3A7_BCL2-01      ccc----------------------------------------------c
A0A8B8V3A7_BCL2-03      ccc----------------------------------------------c
A0A8C3WCN0_BCL2-01      ccc----------------------------------------------c
A0A8D0QLD9_BCL2-03      ccc----------------------------------------------g
A0A4X1TRR9_BCL2-01      ccc----------------------------------------------g
A0A8D0QLD9_BCL2-01      ccc----------------------------------------------g
A0A4X1TRR9_BCL2-03      ccc----------------------------------------------g
                                                                          

A3KNH9_BCL2-01          gtcactcgttcagaccctcatttgaggc---------------------t
Q564A4_BCL2-01          gtcactcgttcagaccctcatttgaggc---------------------t
X4ZGI8_BCL2-01          gtcacacgttcagacccttattcgagga---------------------t
A0A673HVU7_BCL2-01      gtcactcgttcagacccttattcaagga---------------------t
A0A4W4F7Z4_BCL2-01      -------------------------------------------------t
B9ZYL7_BCL2-01          gttatgcagccag---tcccttcggcag---------------------t
A0A8C5MT36_BCL2-03      cttgtacgaccag---ttccccaagcgg---------------------t
A0A8C5MT36_BCL2-01      cttgtacgaccag---ttccccaagcgg---------------------t
A0A8C5MT36_BCL2-02      cttgtacgaccag---ttccccaagcgg---------------------t
A0A8C5MT36_BCL2-04      cttgtacgaccag---ttccccaagcgg---------------------t
A0A7M4G2E0_BCL2-01      acttacactcctgttcctcgtcg--ttggggcaaagcaaattcatcgtct
A0A7M4G2E0_BCL2-02      acttacactcctgttcctcgtcg--ttggggcaaagcaaattcatcgtct
A0A673Z0A3_BCL2-01      -------gaccga---catgccc--ggc---------------------t
A0A8C7CHJ0_BCL2-01      -------gaccga---catgccc--ggc---------------------t
A0A8C7Q7B4_BCL2-01      -------gaccga---catgccc--ggc---------------------t
A0A0U3DHY6_BCL2-01      -------gaccca---catgtca--ggc---------------------t
A0A4W5NW18_BCL2-01      -------gaccca---catgcca--ggc---------------------t
A0A674B8T7_BCL2-01      -------gaccca---catgcca--ggc---------------------t
A0A8C7RG50_BCL2-01      -------gaccca---catgcca--ggc---------------------t
A0A8C8GL24_BCL2-01      -------gaccca---catgcca--ggc---------------------t
A0A6Q2YIU6_BCL2-01      -------gacccg---catgcag--cta---------------------t
A0A4W5KV00_BCL2-01      -------gaccca---catgcag--caa---------------------t
A0A8C7G8X1_BCL2-01      -------gacccg---catgcag--cta---------------------t
A0A674B0E5_BCL2-01      -------gacccg---catgcag--cta---------------------t
A0A8C8JWJ1_BCL2-02      -------gacccg---catgcag--cta---------------------t
A0A8C7N3I9_BCL2-01      -------gacccg---catgcag--cta---------------------t
A0A8C8JWJ1_BCL2-01      -------gacccg---catgcag--cta---------------------t
A0A8C5C4C3_BCL2-01      ccacggggacccg---cgcgcgg--cga---------------------c
A0A3B4A3G8_BCL2-01      -------gaccca---cacgcgg--cca---------------------t
A0A3Q3B0R2_BCL2-01      -------gagccg---ctcgcgc--aca---------------------t
A0A8C7ZK61_BCL2-01      -------gacccg---ctcgcgg--aca---------------------t
A0A3P8WUE9_BCL2-01      -------gaggcg---cacgccg--cca---------------------t
A0A665U7Y7_BCL2-01      -------gacccg---aacgccg--aca---------------------t
A0A672HHE5_BCL2-01      -------gacccg---cacgccg--cca---------------------t
A0A3Q3G1D7_BCL2-01      -------gacccagcctacgcgg--ata---------------------t
A0A8C2X310_BCL2-06      -------gacccg---accgccg--cca---------------------t
A0A3Q3MEY1_BCL2-01      -------gaccca---caagccg--cca---------------------t
A0A2U9BJ09_BCL2-01      -------gagccg---cgcgccg--ccg---------------------t
A0A8C9ZFJ5_BCL2-09      -------gacccg---accgccg--cca---------------------t
A0A7N6A4C8_BCL2-01      -------gacccg---cacgctg--cgc---------------------t
A0A3Q0S5Z7_BCL2-01      -------gaccca---cacgcag--aca---------------------t
A0A668TEB6_BCL2-05      -------gaccca---cacgcag--gca---------------------t
A0A3P8QVM8_BCL2-01      -------gaccca---cacgcag--gca---------------------t
A0A3P9DIG5_BCL2-01      -------gaccca---cacgcag--gca---------------------t
A0A3Q2UYW8_BCL2-01      -------gaccca---cacgcag--gca---------------------t
A0A3B4G3K4_BCL2-01      -------gaccca---cacgcag--gca---------------------t
A0A4W6DDI0_BCL2-01      -------gacccg---tacgccg--cca---------------------t
A0A1X9JZA1_BCL2-01      -------gacccg---catgccg--cca---------------------t
A0A3B4TX71_BCL2-01      -------gacccg---cacgccg--aga---------------------t
A0A3B4YAG2_BCL2-01      -------gacccg---cacgccg--aga---------------------t
A0A3B5BBQ0_BCL2-01      -------gacccg---cacgctg--cca---------------------t
A0A3Q1B8C3_BCL2-01      -------gacccg---cacgctg--cca---------------------t
A0A3P8S9L3_BCL2-01      -------gacccg---cacgctg--cca---------------------t
A0A3Q1FLK7_BCL2-01      -------gacccg---cacgctg--cca---------------------t
A0A673LV42_BCL2-01      -------------------------------------------------t
A0A8C1IQE4_BCL2-01      -------------------------------------------------t
A0A672T179_BCL2-01      -------------------------------------------------t
A0A3B3TCS4_BCL2-01      ------------a---cacgccc--ggc---------------------t
A0A8C9T5U7_BCL2-01      gctgcg--accac---cacgccg--cac---------------------t
W5N4F7_BCL2-01          --------acccc---cacgccg--ctc---------------------t
H9GPE7_BCL2-01          gt------gccac---ag----g--ttg---------------------t
A0A8D2Q1J0_BCL2-01      --------actac---ttgggga--gca---------------------t
A0A8D2Q1J0_BCL2-03      --------actac---ttgggga--gca---------------------t
A0A668TEB6_BCL2-01      --------actac---ctgggca--gcg---------------------t
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      --------actac---ctgggca--gcg---------------------t
A0A668TEB6_BCL2-03      --------actac---ctgggca--gcg---------------------t
A0A3Q3MEY1_BCL2-02      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-04      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-05      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-07      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-09      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-03      --------actac---ctgggca--gtg---------------------t
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      --------actac---ctgggca--gcg---------------------t
A0A7N6A4C8_BCL2-04      --------actac---ctgggca--gcg---------------------t
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      --------actac---ctgggca--gcg---------------------t
A0A7N6A4C8_BCL2-03      --------actac---ctgggca--gcg---------------------t
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      --------actac---ctgggga--gcg---------------------t
A0A8C2X310_BCL2-02      --------actac---ctgggga--gcg---------------------t
A0A8C2X310_BCL2-04      --------actac---ctgggga--gcg---------------------t
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      --------actac---ctgggga--gcg---------------------t
A0A8C9ZFJ5_BCL2-01      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-05      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-03      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-04      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-07      --------actac---ctgggca--gcg---------------------t
A0A8C9ZFJ5_BCL2-08      --------actac---ctgggca--gcg---------------------t
A0A674GNG3_BCL2-02      --------attac---ctgggga--gtg---------------------t
A0A674GNG3_BCL2-04      --------attac---ctgggga--gtg---------------------t
A0A8C5IH35_BCL2-01      --------attac---ctgggca--gtg---------------------t
A0A8C5IH35_BCL2-02      --------attac---ctgggca--gtg---------------------t
A0A670IB81_BCL2-01      gt------gccac---ag----g--ttg---------------------t
A0A8D0BPX3_BCL2-01      gt------gccac---an----g--tgg---------------------t
A0A8D2Q1J0_BCL2-02      gtgccagcgccac---ag----g--ttg---------------------t
A0A8C5S4J3_BCL2-01      gt------acccc---aa----g--ttg---------------------t
A0A670ZV01_BCL2-01      gt------acccc---aa----g--ttg---------------------t
A0A8D0L5Z6_BCL2-01      gt------actac---ag----g--ctg---------------------t
A0A7M4EPU7_BCL2-01      gt------cctac---ag----g--ctg---------------------t
A0A7M4G2E0_BCL2-03      gc------cccac---ag----g--ctg---------------------t
A0A8C8SWU7_BCL2-01      gt------accgc---ag----g--ctg---------------------t
K7F5Y3_BCL2-02          gc------accac---ag----g--ctg---------------------t
K7F5Y3_BCL2-01          gc------accac---ag----g--ctg---------------------t
K7F5Y3_BCL2-03          gc------accac---ag----g--ctg---------------------t
A0A452I9V7_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A8C3SV21_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A8C3ITE1_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A674IMR0_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A8C0G2Q6_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A8C4VT25_BCL2-01      gc------accgc---ag----g--ctg---------------------t
A0A7N4PQN7_BCL2-01      gt------gccac---ct----g--tgg---------------------t
F6YNL8_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A4X2L5Q0_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C2U1A2_BCL2-01      gc------acctc---ca----g--gcg---------------------t
A0A8C9L7I6_BCL2-01      gc------gcctc---cc----g--gcg---------------------t
G1MZW1_BCL2-01          gc------acctc---cc----g--gcg---------------------t
A0A8C3LBC4_BCL2-01      gc------acctc---cc----g--gcg---------------------t
A0A669PDH6_BCL2-01      gc------acctc---cc----g--gcg---------------------t
A0A8C9MG30_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A663MPN9_BCL2-01      gc------ggccg---cgcagaa--tcg---------------------t
A0A8C6ZF48_BCL2-01      gc------gccgc---cc----g--gcg---------------------t
A0A8B9PRT7_BCL2-01      gc------gccac---cg----g--tgg---------------------t
A0A8B9PRT7_BCL2-02      gc------gccac---cg----g--tgg---------------------t
A0A8C0UAC7_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A8B9UYC3_BCL2-01      gc------gcccc---cc----g--tgg---------------------t
A0A8B9E2U6_BCL2-01      gc------gcccc---cc----g--tgg---------------------t
A0A8B9C4H4_BCL2-01      gc------gcccc---cc----g--tgg---------------------t
A0A8C3CIW8_BCL2-01      gc------acccc---cc----g--tgg---------------------t
A0A493T1X3_BCL2-01      gc------gcccc---cc----g--tgg---------------------t
A0A8B9SFH3_BCL2-01      gc------gcccc---cc----g--tgg---------------------t
A0A8D2P664_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A674GNG3_BCL2-01      gc------acccc---ag----g--ccg---------------------t
A0A674GNG3_BCL2-03      gc------acccc---ag----g--ccg---------------------t
A0A8C5TLV4_BCL2-01      gc------acccc---ag----g--ttg---------------------t
A0A672TR23_BCL2-01      gc------gcccc---ag----g--tcg---------------------t
A0A8C3JHE5_BCL2-01      gc------gcccc---ag----g--tgg---------------------t
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      gc------gcccc---ag----g--tcg---------------------t
A0A663FHR0_BCL2-01      gc------gcccc---ag----g--tcg---------------------t
A0A8C8ANG9_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A8C0IE77_BCL2-01      ----------------------g--tcg---------------------t
A0A8D0G0L7_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A8C4U538_BCL2-01      gc------acccc---ag----g--ttg---------------------t
A0A8C4U538_BCL2-02      gc------acccc---ag----g--ttg---------------------t
A0A8C3TNF2_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A8C3QX54_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A803VR88_BCL2-01      gc------acccc---ag----g--tcg---------------------t
A0A803VR88_BCL2-02      gc------acccc---ag----g--tcg---------------------t
A0A8C5IH35_BCL2-05      gc------acccc---ag----g--tcg---------------------t
A0A8C5IH35_BCL2-04      gc------acccc---ag----g--tcg---------------------t
A0A8C5IH35_BCL2-03      gc------acccc---ag----g--tcg---------------------t
A0A8D2N8C6_BCL2-01      ---------cgct---gg----g--t-----------------------g
A0A8D0QLD9_BCL2-07      gt------gtcaa---ct----acctgg---------------------g
A0A4X1TRR9_BCL2-06      gt------gtcaa---ct----acctgg---------------------g
A0A8D0QLD9_BCL2-05      gt------gtcaa---ct----acctgg---------------------g
A0A4X1TRR9_BCL2-05      gt------gtcaa---ct----acctgg---------------------g
A0A8D0QLD9_BCL2-04      gt------gtcaa---ct----acctgg---------------------g
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      gt------gtcaa---ct----acctgg---------------------g
A0A4X1TRR9_BCL2-02      gt------gtcaa---ct----acctgg---------------------g
A0A8D0QLD9_BCL2-02      gt------gtcaa---ct----acctgg---------------------g
A0A8C6RID6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C6RID6_BCL2-02      gt------gccac---ct----g--tgg---------------------t
Q6R755_BCL2-01          gt------gccac---ct----g--tgg---------------------t
Q923R6_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8C8U7I9_BCL2-01      gt------gccac---ct----g--tgg---------------------t
Q6NTH7_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8C6H5J8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
Q7TSN8_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8I6AJ02_BCL2-01      gt------gccac---ct----g--tgg---------------------t
P49950_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A4W2DSR6_BCL2-02      gt------gccgc---ct----g--tgg---------------------t
A0A4W2DSR6_BCL2-02      gt------gccgc---ct----g--tgg---------------------t
A0A8C6CUJ2_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A4W2DSR6_BCL2-01      gt------gccgc---ct----g--tgg---------------------t
A0A4W2DSR6_BCL2-01      gt------gccgc---ct----g--tgg---------------------t
F6R2C4_BCL2-01          gt------gccgc---ct----g--tgg---------------------t
O02718_BCL2-01          gt------gccgc---ct----g--tgg---------------------t
A0A076FU27_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A076FZV9_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A452EV13_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C5JYS0_BCL2-01      gt------cccac---ct----g--tgg---------------------t
G3SLZ1_BCL2-01          gt------gccac---ct----g--tag---------------------t
G3SLZ1_BCL2-02          gt------gccac---ct----g--tag---------------------t
H0W1T3_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A5F9CRQ4_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A5F9CRQ4_BCL2-02      gt------gccac---ct----g--tgg---------------------t
M3YYK3_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8D2AUF5_BCL2-01      gt------gccac---ct----g--tgg---------------------t
I3MVK9_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8C5YTS1_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8D2IIB8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A250YD83_BCL2-01      gt------accac---ct----g--tgg---------------------t
A0A452T603_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C2VKS3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C9HUK6_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A2K5EB04_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K6UEL3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2R8MY14_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K6R2I5_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A2K5HK49_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-04      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-10      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-05      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-08      gt------gccac---ct----g--tgg---------------------t
A0A7N9CNB8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8D2EFR4_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K5XRD4_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K5NZS5_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A0D9S017_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A5F7ZZ15_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K6CIX3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A096MPU7_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-03      gt------tcc---------------------------------------
A9QXG9_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A2K6KHG1_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K6R2I5_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2J8W3J1_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C9HUK6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2I3GZF9_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-06      gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-07      gt------gccac---ct----g--tgg---------------------t
A0A2R9APW6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
G3QES9_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8B7H1C6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C9AC52_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A2K6G3I7_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A3Q2HRY3_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A8C4L1K6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A3Q2HRY3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A673VDM8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A5F5Y6Y3_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A8C9J3W6_BCL2-01      gt------gccac---ct----g--tgg---------------------t
Q8I008_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A667GHH0_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A5F5Y6Y3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C8XJU8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C7B9K2_BCL2-01      gt------gccac---ct----g--tgg---------------------t
G1LIC9_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A452R110_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A452R110_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A8C0NC28_BCL2-03      gt------gccac---ct----g--tgg---------------------t
A0A8I3MLT5_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A8C0NC28_BCL2-02      gt------gccac---ct----g--tgg---------------------t
Q75SV7_BCL2-01          gt------gccac---ct----g--tgg---------------------t
A0A8C0KWE3_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C0NC28_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8I3MLT5_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C6AXM8_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8C9CJ69_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8B8V3A7_BCL2-02      gt------gccac---ct----g--tgg---------------------t
A0A8B8V3A7_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8B8V3A7_BCL2-03      gt------gccac---ct----g--tgg---------------------t
A0A8C3WCN0_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8D0QLD9_BCL2-03      gt------gccac---ct----g--tgg---------------------t
A0A4X1TRR9_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A8D0QLD9_BCL2-01      gt------gccac---ct----g--tgg---------------------t
A0A4X1TRR9_BCL2-03      gt------gccac---ct----g--tgg---------------------t
                                                                          

A3KNH9_BCL2-01          ctaccgggtgttacgggatgctggagatgaaatagaa-------aggatt
Q564A4_BCL2-01          ctaccgggtgttacgggatgctggagatgaaatagaa-------aggatt
X4ZGI8_BCL2-01          ctaccgatcgttacgcgaggctggagaccagatagaa-------aggatg
A0A673HVU7_BCL2-01      ctaccgggcgctacgcgaggctggagacgagatagaa-------aggcta
A0A4W4F7Z4_BCL2-01      ccacagggttttgcgcgaggccggcgacgagctggaa-------agatta
B9ZYL7_BCL2-01          gctacagaccttgagtcgagctggagatgagttctct-------cgccta
A0A8C5MT36_BCL2-03      tctccagactcttagccgagcaggcgatgagttttcc-------cggctg
A0A8C5MT36_BCL2-01      tctccagactcttagccgagcaggcgatgagttttcc-------cggctg
A0A8C5MT36_BCL2-02      tctccagactcttagccgagcaggcgatgagttttcc-------cggctg
A0A8C5MT36_BCL2-04      tctccagactcttagccgagcaggcgatgagttttcc-------cggctg
A0A7M4G2E0_BCL2-01      ctccatgccactgctcgtggcagaatgtgcctttgat-------attctg
A0A7M4G2E0_BCL2-02      ctccatgccactgctcgtggcagaatgtgcctttgat-------attctg
A0A673Z0A3_BCL2-01      ccatagggtgctgcgcgaggcgggggacgagattgaa-------ataatg
A0A8C7CHJ0_BCL2-01      ccatagggtgctgcgcgaggcgggggacgagattgaa-------ataatg
A0A8C7Q7B4_BCL2-01      ccatagggtgctgcgcgaggcgggggacgagattgaa-------ataatg
A0A0U3DHY6_BCL2-01      ccacagggtcctgcgcgaggcgggggacgagattgaa-------agaatg
A0A4W5NW18_BCL2-01      caacagggtcctgcgcgaggcgggtgacgagattgga-------agaatt
A0A674B8T7_BCL2-01      ccacagggtcctgcgcgaggcgggtggcgagattgaa-------agaatg
A0A8C7RG50_BCL2-01      ccacagggtcctgcgcgatgcgggtggcgagattgaa-------agaatg
A0A8C8GL24_BCL2-01      ccacagggtcctgcgcgaggctggtggcgagattgaa-------agaatg
A0A6Q2YIU6_BCL2-01      tcacagagtgttgcgtgaggccggggacgaactcgaa-------agactg
A0A4W5KV00_BCL2-01      tcacagagttttgcgtgaggccggggacgaactcgaa-------agactg
A0A8C7G8X1_BCL2-01      tcacagagttttgcgtgaggccggggacgaactcgaa-------agactg
A0A674B0E5_BCL2-01      tcacagagttttgcgtgaggccggggacgaactcgaa-------agactg
A0A8C8JWJ1_BCL2-02      tcacagagttttgcgtgaggccggggacgaactcgaa-------cgactg
A0A8C7N3I9_BCL2-01      tcacagagttttgcgtgaggccggggacgaactcgaa-------cgactg
A0A8C8JWJ1_BCL2-01      tcacagagttttgcgtgaggccggggacgaactcgaa-------cgactg
A0A8C5C4C3_BCL2-01      ccaccgggtgctgcgcgaggcgggggacgaactcgag-------agactc
A0A3B4A3G8_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgag-------cggctg
A0A3Q3B0R2_BCL2-01      ccacagggtgctgcgcgaggccggcgacgagctggag-------cgcctc
A0A8C7ZK61_BCL2-01      ccacagggtcctgcgcgaggcgggagacgagctggag-------cgcctg
A0A3P8WUE9_BCL2-01      tcacagagtcctgcgcgaagccggagacgaactggag-------cgactg
A0A665U7Y7_BCL2-01      ccacagagtcctccgggaggccggagacgaacttgag-------aggttg
A0A672HHE5_BCL2-01      ccaccgggtcctgcgggaggctggggacgaacttgag-------agactc
A0A3Q3G1D7_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactt
A0A8C2X310_BCL2-06      ccaccgggtcctgcgcgaggctggggacgaactcgag-------agactg
A0A3Q3MEY1_BCL2-01      tcacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A2U9BJ09_BCL2-01      ccaccgggtcctgcgcgaggcgggcgacgaacttgag-------agactg
A0A8C9ZFJ5_BCL2-09      ccacagagttctccgcgaggctggagacgaacttgag-------agacta
A0A7N6A4C8_BCL2-01      ccacagggtcctgcgtgaggctggagatgaacttgaa-------agacta
A0A3Q0S5Z7_BCL2-01      ccacagagtcctgcgagaggctggagatgaacttgaa-------agactg
A0A668TEB6_BCL2-05      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A3P8QVM8_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A3P9DIG5_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A3Q2UYW8_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A3B4G3K4_BCL2-01      ccacagagtcctgcgcgaggctggagatgaacttgaa-------agactg
A0A4W6DDI0_BCL2-01      ccacagagtcctgcgcgaggctggagacgaacttgag-------agactg
A0A1X9JZA1_BCL2-01      ccacagagtcctacgcgaggctggagacgaacttgaa-------agactg
A0A3B4TX71_BCL2-01      ccacagagtcctgcgcgaggctggagacgaacttgag-------agatta
A0A3B4YAG2_BCL2-01      ccacagagtcctgcgcgaggctggagacgaacttgag-------agatta
A0A3B5BBQ0_BCL2-01      ccacagagtcctgcgggaggctggagacgaacttgaa-------agactg
A0A3Q1B8C3_BCL2-01      ccacagagtcctgcgggaggctggagatgaacttgaa-------agactg
A0A3P8S9L3_BCL2-01      ccacagagtcctgcgggaggctggagatgaacttgaa-------agactg
A0A3Q1FLK7_BCL2-01      ccacagagtcctgcgggaggctggggatgaacttgaa-------agactg
A0A673LV42_BCL2-01      tcataaggtgctgcgggaggccggggatgaactggag-------cggctt
A0A8C1IQE4_BCL2-01      tcataaggtgctgcgggaggccggggacgagctggag-------cggctt
A0A672T179_BCL2-01      tcacacggtgctacgggaggctggggacgaactggag-------cggctt
A0A3B3TCS4_BCL2-01      gcacagggtcctgcgcgaagcgggggacgagatcgag-------aggatg
A0A8C9T5U7_BCL2-01      gcaccgggtcctgcgcgaggcgggcgacgagatcgag-------cggatg
W5N4F7_BCL2-01          ccacaaggtgctgcgggaggctggggacgagatcgag-------aggatg
H9GPE7_BCL2-01          ccatacaacattacgccaagccggagatgagttctcc-------cgacgc
A0A8D2Q1J0_BCL2-01      ttacccaactc-------gtgcagtagttaccaccatgaaggaacgaaga
A0A8D2Q1J0_BCL2-03      ttacccaactc-------gtgcagtagttaccaccatgaaggaacgaaga
A0A668TEB6_BCL2-01      ttacccaacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ttacccaacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A668TEB6_BCL2-03      ttacccaacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A3Q3MEY1_BCL2-02      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-04      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-05      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-07      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-09      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-03      ttatccaactc-------gggccgtcataaccaccatgaaggaacgcaga
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      ttacccaacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A7N6A4C8_BCL2-04      ttacccaacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ttacccaacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A7N6A4C8_BCL2-03      ttacccaacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      ttacccgacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A8C2X310_BCL2-02      ttacccgacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A8C2X310_BCL2-04      ttacccgacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      ttacccgacac-------gagccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-01      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-05      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-03      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-04      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-07      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A8C9ZFJ5_BCL2-08      ttacccgacac-------gggccgtcataaccaccatgaaggagcgaaga
A0A674GNG3_BCL2-02      ttacccaa------gccgagc-agtaatcgctaccatgaaggaacgcaga
A0A674GNG3_BCL2-04      ttacccaa------gccgagc-agtaatcgctaccatgaaggaacgcaga
A0A8C5IH35_BCL2-01      ttacccaa------gccgagc-agtaatcgctaccatgaaggagcgcaga
A0A8C5IH35_BCL2-02      ttacccaa------gccgagc-agtaatcgctaccatgaaggagcgcaga
A0A670IB81_BCL2-01      ccacgcgactttacgtcaagccggggatgagttttcg-------cggcgt
A0A8D0BPX3_BCL2-01      ccactcaactttacgtcaagctggtgatgagttttct-------cgacgt
A0A8D2Q1J0_BCL2-02      ccattcaactttacgccaagctggagatgagttttca-------cggctt
A0A8C5S4J3_BCL2-01      ttattccacactatgccaagctggtgatgagttttcc-------cggaga
A0A670ZV01_BCL2-01      ttattccacactatgccaagctggtgatgagttttcc-------cggagg
A0A8D0L5Z6_BCL2-01      tcacctgactctctgccatgctggtgacgaagtttcc-------cgccga
A0A7M4EPU7_BCL2-01      ccacctgaccctgcgccaagcgggagatgatttctcc-------tgccgc
A0A7M4G2E0_BCL2-03      ccacctgaccctgcgccaagcgggagatgatttctcc-------cgccgc
A0A8C8SWU7_BCL2-01      tcacttgaccctgtgccaagctggagatgaattttcc-------cgccgc
K7F5Y3_BCL2-02          tcacttgactctgtgccaagccggagatgaattttcc-------cgccgc
K7F5Y3_BCL2-01          tcacttgactctgtgccaagccggagatgaattttcc-------cgccgc
K7F5Y3_BCL2-03          tcacttgactctgtgccaagccggagatgaattttcc-------cgccgc
A0A452I9V7_BCL2-01      tctcttggctctgtgccaagctggagatgaattttcc-------cgtcgc
A0A8C3SV21_BCL2-01      tcacttgactctgtgccaagccggagatgaattttcc-------cgccgc
A0A8C3ITE1_BCL2-01      tctcttgactctgtgccaagctggagatgaattttcc-------cgccgc
A0A674IMR0_BCL2-01      tctcttgactctgtgccaagctggagatgaattttcc-------cgccgc
A0A8C0G2Q6_BCL2-01      tctcttggctctgtgccaagctggagatgaattttcc-------cgtcgc
A0A8C4VT25_BCL2-01      tctcttggctctgtgccaagctggagatgaattttcc-------cgtcgc
A0A7N4PQN7_BCL2-01      ccacctgactcttcgtcaagctggagatgatttctct-------cgaaga
F6YNL8_BCL2-01          ccacctgactcttcgtcaagctggagatgatttctct-------agaagg
A0A4X2L5Q0_BCL2-01      ccacctgacccttcgtcaagctggagatgatttctct-------cgaagg
A0A8C2U1A2_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctct-------cgccgc
A0A8C9L7I6_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctcg-------cgccgc
G1MZW1_BCL2-01          ccacctcgccctgcgccaggccggggatgagttctcg-------cgccgc
A0A8C3LBC4_BCL2-01      ccacctcgccctgcgccaggctggggacgaattctca-------cgccgc
A0A669PDH6_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctca-------cgccgc
A0A8C9MG30_BCL2-01      ccaccttgtcctgcgccaggcgggggacgagttctcc-------cgacgc
A0A663MPN9_BCL2-01      ccaccttgccctgcgccaggcgggcgacgagttctcc-------cgccgc
A0A8C6ZF48_BCL2-01      ccacctggccctgcgccaggccggcgatgagttctcg-------cgccgc
A0A8B9PRT7_BCL2-01      ccacctcgccctgcgccaagccggggatgagttctcc-------cgccgc
A0A8B9PRT7_BCL2-02      ccacctcgccctgcgccaagccggggatgagttctcc-------cgccgc
A0A8C0UAC7_BCL2-01      gcacctcgtcctgcgccaggcaggggatgagttctcc-------cgacgc
A0A8B9UYC3_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctcc-------cgtcgc
A0A8B9E2U6_BCL2-01      ccaccttgccctgcgccaggccggggacgagttctcc-------cgccgc
A0A8B9C4H4_BCL2-01      ccaccttgccctgcgccaggccggggacgagttctcc-------cgccgc
A0A8C3CIW8_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctcc-------cgtcgc
A0A493T1X3_BCL2-01      ccacctcgccctgcgccaggccggggacgagttctcc-------cgtcgc
A0A8B9SFH3_BCL2-01      ccacctcgccctgcgccaggccggggatgaattctcc-------cgtcgc
A0A8D2P664_BCL2-01      gcacctcgtcctgcgccaggcaggagacgagttctcc-------cgacgc
A0A674GNG3_BCL2-01      ccacctcgtcctacgccaggcgggggatgagttctcc-------cgacgc
A0A674GNG3_BCL2-03      ccacctcgtcctacgccaggcgggggatgagttctcc-------cgacgc
A0A8C5TLV4_BCL2-01      ccacctcgtcctgcgccaggcgggagacgagttctcc-------cgacgc
A0A672TR23_BCL2-01      ccacctcaccctgcgccaggcaggggacgagttctcc-------cgccgc
A0A8C3JHE5_BCL2-01      ccacctcaccttgcgccaggcaggggacgagttctcc-------cgccgc
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      ccacctcgccctgcgccaggcgggcgacgagttctcc-------cgccgc
A0A663FHR0_BCL2-01      ccacctcgccctgcgccaggcgggcgacgagttctcc-------cgccgc
A0A8C8ANG9_BCL2-01      ccacctcgccctgcgccaggcgggcgacgagttctcc-------cgccgc
A0A8C0IE77_BCL2-01      ccacctcgccctgcgccaggcgggcgacgagttctcc-------cgccgc
A0A8D0G0L7_BCL2-01      ccacctcgccctgcgccaggcgggcgatgagttctcc-------cgccgc
A0A8C4U538_BCL2-01      ccacctcaccctgcgccaggcgggggacgagttctcc-------cgccgc
A0A8C4U538_BCL2-02      ccacctcaccctgcgccaggcgggggacgagttctcc-------cgccgc
A0A8C3TNF2_BCL2-01      ccaccttgtcctgcgccaggcgggggatgagttctcc-------cgacgc
A0A8C3QX54_BCL2-01      gcacctcgtcctgcgccaggcaggggatgagttctcc-------cgacgc
A0A803VR88_BCL2-01      ccacctggtcctgcgccaggcgggcgacgagttctcc-------cggcgc
A0A803VR88_BCL2-02      ccacctggtcctgcgccaggcgggcgacgagttctcc-------cggcgc
A0A8C5IH35_BCL2-05      gcacctcgtcctgcgccaggcgggggacgagttctcc-------cgacgc
A0A8C5IH35_BCL2-04      gcacctcgtcctgcgccaggcgggggacgagttctcc-------cgacgc
A0A8C5IH35_BCL2-03      gcacctcgtcctgcgccaggcgggggacgagttctcc-------cgacgc
A0A8D2N8C6_BCL2-01      gcaac-------------agcgggggacgagttctcc-------cgacgc
A0A8D0QLD9_BCL2-07      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A4X1TRR9_BCL2-06      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A8D0QLD9_BCL2-05      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A4X1TRR9_BCL2-05      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A8D0QLD9_BCL2-04      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A4X1TRR9_BCL2-02      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A8D0QLD9_BCL2-02      cagcgtgtacccgagccgagc-ggtgatcaccaccatgaaggagcgccgc
A0A8C6RID6_BCL2-01      ccacctgaccctccgccaggctggggatgacttctcc-------cgtcgt
A0A8C6RID6_BCL2-02      ccacctgaccctccgccaggctggggatgacttctcc-------cgtcgt
Q6R755_BCL2-01          ccacctgaccctccgccgggctggggatgacttctcc-------cgtcgc
Q923R6_BCL2-01          ccacctgaccctccgccgggctggggatgacttctcc-------cgtcgc
A0A8C8U7I9_BCL2-01      ccacctgaccctccgccgggctggggatgacttctcc-------cgtcgc
Q6NTH7_BCL2-01          ccatctgaccctccgccgggctggggatgacttctct-------cgtcgc
A0A8C6H5J8_BCL2-01      ccatctgaccctccgccgggctggggatgacttctct-------cgtcgc
Q7TSN8_BCL2-01          ccatctgaccctccgccgggctggggatgacttctct-------cgtcgc
A0A8I6AJ02_BCL2-01      ccacctgaccctccgccgggctggggatgacttctct-------cgtcgc
P49950_BCL2-01          ccacctgaccctccgccgggctggggatgacttctct-------cgtcgc
A0A4W2DSR6_BCL2-02      gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A4W2DSR6_BCL2-02      gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A8C6CUJ2_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctcc-------cggcgc
A0A4W2DSR6_BCL2-01      gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A4W2DSR6_BCL2-01      gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
F6R2C4_BCL2-01          gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
O02718_BCL2-01          gcacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A076FU27_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A076FZV9_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A452EV13_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctct-------cggcgc
A0A8C5JYS0_BCL2-01      ccacctgaccctccgccaggccggcgatgacttctcc-------cgccgc
G3SLZ1_BCL2-01          tcacctgaccttgcgccaggccggcgacgacttctcc-------aggcgc
G3SLZ1_BCL2-02          tcacctgaccttgcgccaggccggcgacgacttctcc-------aggcgc
H0W1T3_BCL2-01          ccacctgaccctccgccaggccggcgatgacttctcc-------cgccgc
A0A5F9CRQ4_BCL2-01      ccacctgaccctccgccaggcgggcgacgacttctcc-------cggcgc
A0A5F9CRQ4_BCL2-02      ccacctgaccctccgccaggcgggcgacgacttctcc-------cggcgc
M3YYK3_BCL2-01          ccacctgaccctgcgccaggccggcgacgacttctcc-------cgtcgc
A0A8D2AUF5_BCL2-01      ccacctgaccctccgccaggccggcgatgacttctct-------cgtcgc
I3MVK9_BCL2-01          ccacctgaccctccgccaggccggcgatgacttctct-------cgtcgc
A0A8C5YTS1_BCL2-01      ccacctgaccctccgccaggccggcgatgacttctct-------cgtcgc
A0A8D2IIB8_BCL2-01      ccacctgaccctccgccaggccggcgatgacttctct-------cgtcgc
A0A250YD83_BCL2-01      ccacctgaccctccgccaggctggcgatgacttctcc-------cggcgc
A0A452T603_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C2VKS3_BCL2-01      ccacctgaccctccgccaggccggcgacgacttctcc-------cgtcgc
A0A8C9HUK6_BCL2-02      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K5EB04_BCL2-01      ccacctgaccctccgccaggccggggacgacttctcc-------cgccgc
A0A2K6UEL3_BCL2-01      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A2R8MY14_BCL2-01      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A2K6R2I5_BCL2-02      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K5HK49_BCL2-01      ccaccttaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-04      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-10      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-05      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-08      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7N9CNB8_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A8D2EFR4_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K5XRD4_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K5NZS5_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A0D9S017_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A5F7ZZ15_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K6CIX3_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A096MPU7_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A2K6KHG1_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2K6R2I5_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2J8W3J1_BCL2-01      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A8C9HUK6_BCL2-01      ccacctgaccctccgccaggccggtgacgacttctcc-------cgccgc
A0A2I3GZF9_BCL2-01      ccacctgaccctccgccaggccggcgatgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-06      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-07      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A2R9APW6_BCL2-01      ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
G3QES9_BCL2-01          ccacctgaccctccgccaggccggcgacgacttctcc-------cgccgc
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          ccacctgaccctccgccaggcgggcgatgacttctct-------cgccgc
A0A8B7H1C6_BCL2-01      ccacctgaccctccgccaggcgggcgatgacttctcc-------cgccgc
A0A8C9AC52_BCL2-01      ccacctgaccctccgccaggcgggcgatgacttctcc-------cgccgc
A0A2K6G3I7_BCL2-01      ccacctgaccctccgccaggcgggcgatgacttctcc-------cgccgc
A0A3Q2HRY3_BCL2-02      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C4L1K6_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A3Q2HRY3_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A673VDM8_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A5F5Y6Y3_BCL2-02      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C9J3W6_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
Q8I008_BCL2-01          ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A667GHH0_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A5F5Y6Y3_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C8XJU8_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C7B9K2_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgtcgc
G1LIC9_BCL2-01          ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A452R110_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A452R110_BCL2-02      ccacctgaccctgcgccaggccggcgatgacttctcc-------cgtcgc
A0A8C0NC28_BCL2-03      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8I3MLT5_BCL2-02      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8C0NC28_BCL2-02      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
Q75SV7_BCL2-01          ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8C0KWE3_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8C0NC28_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8I3MLT5_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctcc-------cgccgc
A0A8C6AXM8_BCL2-01      ccacctgaccctgcgccaggccggtgatgatttttct-------cgtcgc
A0A8C9CJ69_BCL2-01      ccacctgaccctgcgccaggccggtgatgatttttct-------cgtcgc
A0A8B8V3A7_BCL2-02      ccacctgaccctgcgccaggccggtgatgatttctct-------cgtcgc
A0A8B8V3A7_BCL2-01      ccacctgaccctgcgccaggccggtgatgatttctct-------cgtcgc
A0A8B8V3A7_BCL2-03      ccacctgaccctgcgccaggccggtgatgatttctct-------cgtcgc
A0A8C3WCN0_BCL2-01      ccacctgaccctgcgccaggccggcgacgacttctct-------cgtcgc
A0A8D0QLD9_BCL2-03      ccacctgaccctgcgccaggccggcgatgacttctct-------cgtcgc
A0A4X1TRR9_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctct-------cgtcgc
A0A8D0QLD9_BCL2-01      ccacctgaccctgcgccaggccggcgatgacttctct-------cgtcgc
A0A4X1TRR9_BCL2-03      ccacctgaccctgcgccaggccggcgatgacttctct-------cgtcgc
                                                                          

A3KNH9_BCL2-01          -----------taccaacgcgaa------------tttgaggaaatgtcc
Q564A4_BCL2-01          -----------taccaacgcgaa------------tttgaggaaatgtcc
X4ZGI8_BCL2-01          -----------taccagcgtgaa------------tttgaggagatgtcc
A0A673HVU7_BCL2-01      -----------taccagcgtgaa------------tttgaggagatgtcc
A0A4W4F7Z4_BCL2-01      -----------tatcagccggac------------tttgccgagatgtca
B9ZYL7_BCL2-01          -----------tatcagcaagat------------ttcagacagatctca
A0A8C5MT36_BCL2-03      -----------taccagcaagac------------tttaggcagatatcc
A0A8C5MT36_BCL2-01      -----------taccagcaagac------------tttaggcagatatcc
A0A8C5MT36_BCL2-02      -----------taccagcaagac------------tttaggcagatatcc
A0A8C5MT36_BCL2-04      -----------taccagcaagac------------tttaggcagatatcc
A0A7M4G2E0_BCL2-01      ------------gctggtatggc-------------------atacatct
A0A7M4G2E0_BCL2-02      ------------gctggtatggc-------------------atacatct
A0A673Z0A3_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A8C7CHJ0_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A8C7Q7B4_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A0U3DHY6_BCL2-01      -----------tatctgcgggac------------tttgcagagatgtcg
A0A4W5NW18_BCL2-01      -----------tatcacccggac------------tttgcagagatgtcg
A0A674B8T7_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A8C7RG50_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A8C8GL24_BCL2-01      -----------tatcagcgggac------------tttgcagagatgtcg
A0A6Q2YIU6_BCL2-01      -----------taccaacccgac------------tttttggagatgtca
A0A4W5KV00_BCL2-01      -----------taccagccagac------------ttcgcagagatgtca
A0A8C7G8X1_BCL2-01      -----------taccagcccgac------------tttgcagagatgtca
A0A674B0E5_BCL2-01      -----------taccagcccgac------------ttcgcagagatgtca
A0A8C8JWJ1_BCL2-02      -----------taccagcccgac------------tttgcggagatgtca
A0A8C7N3I9_BCL2-01      -----------taccagcccgac------------tttgcggagatgtca
A0A8C8JWJ1_BCL2-01      -----------taccagcccgac------------tttgcggagatgtca
A0A8C5C4C3_BCL2-01      -----------taccaggcggac------------ttcaccgagatgtcg
A0A3B4A3G8_BCL2-01      -----------taccagcccgac------------ttcaccgagatgtcc
A0A3Q3B0R2_BCL2-01      -----------taccagccggac------------ttcgtggagatgtcg
A0A8C7ZK61_BCL2-01      -----------taccagcgggac------------ttcacggagatgtcg
A0A3P8WUE9_BCL2-01      -----------taccagccggac------------ttctcagagatgtca
A0A665U7Y7_BCL2-01      -----------taccagccggac------------ttcacggagatgtcc
A0A672HHE5_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3Q3G1D7_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A8C2X310_BCL2-06      -----------taccagccggac------------ttcacggagatgtcg
A0A3Q3MEY1_BCL2-01      -----------tatcagccggac------------tttacggagatgtcg
A0A2U9BJ09_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A8C9ZFJ5_BCL2-09      -----------taccagccggac------------ttcacggagatgtcg
A0A7N6A4C8_BCL2-01      -----------tatcagccggac------------ttcacggagatgtcc
A0A3Q0S5Z7_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A668TEB6_BCL2-05      -----------taccagccggac------------ttcacggagatgtcg
A0A3P8QVM8_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3P9DIG5_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3Q2UYW8_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3B4G3K4_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A4W6DDI0_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A1X9JZA1_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3B4TX71_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3B4YAG2_BCL2-01      -----------taccagccggac------------ttcacggagatgtcg
A0A3B5BBQ0_BCL2-01      -----------taccagccggac------------ttcacggagatgtcc
A0A3Q1B8C3_BCL2-01      -----------taccagccggac------------ttcacggagatgtcc
A0A3P8S9L3_BCL2-01      -----------taccagccggac------------ttcacggagatgtcc
A0A3Q1FLK7_BCL2-01      -----------taccagccggac------------ttcacggagatgtcc
A0A673LV42_BCL2-01      -----------tatcagtcggac------------tttgcggagatgtcc
A0A8C1IQE4_BCL2-01      -----------tatcagtcggac------------tttgcggagatgtcc
A0A672T179_BCL2-01      -----------tatcagtcggac------------tttgcggagatgtcc
A0A3B3TCS4_BCL2-01      -----------ttccagcgggac------------ttctcagaaatgcac
A0A8C9T5U7_BCL2-01      -----------taccagcgggac------------ttcgcgcagatgccc
W5N4F7_BCL2-01          -----------taccaccgggac------------ttcgcggagatgtcg
H9GPE7_BCL2-01          -----------tatcggagggac------------tttgctcaaatgtct
A0A8D2Q1J0_BCL2-01      atgggaaggatcgtatttgtg--------------tcatcccagg---ct
A0A8D2Q1J0_BCL2-03      atgggaaggatcgtatttgtg--------------tcatcccagg---ct
A0A668TEB6_BCL2-01      atgggccgcatcatgttcgtt--------------tcctcccagg---cg
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      atgggccgcatcatgttcgtt--------------tcctcccagg---cg
A0A668TEB6_BCL2-03      atgggccgcatcatgttcgtt--------------tcctcccagg---cg
A0A3Q3MEY1_BCL2-02      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-04      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-05      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-07      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-09      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-03      atgggccgcatcatgtttgtg--------------tcctcccaag---ct
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      atgggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A7N6A4C8_BCL2-04      atgggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      atgggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A7N6A4C8_BCL2-03      atgggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      aggggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A8C2X310_BCL2-02      aggggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A8C2X310_BCL2-04      aggggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      aggggccgcatcatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-01      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-05      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-03      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-04      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-07      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A8C9ZFJ5_BCL2-08      atgggccgcattatgtttgtg--------------tcctcccaag---ca
A0A674GNG3_BCL2-02      atgggaaggattgtctttgtatc------------atccca-----ggct
A0A674GNG3_BCL2-04      atgggaaggattgtctttgtatc------------atccca-----ggct
A0A8C5IH35_BCL2-01      atgggaaggattgtcttcgtgtc------------gtctca-----ggct
A0A8C5IH35_BCL2-02      atgggaaggattgtcttcgtgtc------------gtctca-----ggct
A0A670IB81_BCL2-01      -----------tacaggagggac------------tttgctcagatgtct
A0A8D0BPX3_BCL2-01      -----------taccggagagac------------tttgctcagatgtct
A0A8D2Q1J0_BCL2-02      -----------taccggagggat------------tttgctcagatgtct
A0A8C5S4J3_BCL2-01      -----------tatcaaagggac------------tttacccaaatgtct
A0A670ZV01_BCL2-01      -----------tatcaaagggac------------tttacccagatgtct
A0A8D0L5Z6_BCL2-01      -----------taccagagggat------------ttttcccagatggct
A0A7M4EPU7_BCL2-01      -----------taccagagtgac------------gttgcccaaatgtct
A0A7M4G2E0_BCL2-03      -----------taccagagtgac------------tttgcccaaatgtct
A0A8C8SWU7_BCL2-01      -----------taccatagagat------------tttgcccagatgtct
K7F5Y3_BCL2-02          -----------tatcacagagat------------tttgcccagatgtct
K7F5Y3_BCL2-01          -----------tatcacagagat------------tttgcccagatgtct
K7F5Y3_BCL2-03          -----------tatcacagagat------------tttgcccagatgtct
A0A452I9V7_BCL2-01      -----------taccacagagat------------tttgcccagatgtct
A0A8C3SV21_BCL2-01      -----------taccacagagat------------tttgcccagatgtcc
A0A8C3ITE1_BCL2-01      -----------taccacagagat------------tttgcccagatgtct
A0A674IMR0_BCL2-01      -----------taccacagagat------------tttgcccagatgtct
A0A8C0G2Q6_BCL2-01      -----------taccacagagat------------tttgcccagatgtct
A0A8C4VT25_BCL2-01      -----------taccacagagat------------tttgcccagatgtct
A0A7N4PQN7_BCL2-01      -----------tatcgaagagat------------ttcgatgaaatgtca
F6YNL8_BCL2-01          -----------taccggagagac------------tttgatgaaatgtca
A0A4X2L5Q0_BCL2-01      -----------taccggagagac------------tttgatgaaatgtca
A0A8C2U1A2_BCL2-01      -----------taccagagggac------------tttgcccagatgtcg
A0A8C9L7I6_BCL2-01      -----------taccagagggac------------tttgcccagatgtcg
G1MZW1_BCL2-01          -----------taccagagggac------------tttgcccagatgtcg
A0A8C3LBC4_BCL2-01      -----------taccagagggac------------tttgcccagatgtcg
A0A669PDH6_BCL2-01      -----------taccagagggac------------tttgcccagatgtcg
A0A8C9MG30_BCL2-01      -----------taccagagggac------------ttcgcccaaatgtct
A0A663MPN9_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8C6ZF48_BCL2-01      -----------taccagagggac------------ttcgcgcacatgtcc
A0A8B9PRT7_BCL2-01      -----------taccagagggac------------ttcgcccaaatgtct
A0A8B9PRT7_BCL2-02      -----------taccagagggac------------ttcgcccaaatgtct
A0A8C0UAC7_BCL2-01      -----------taccagagggac------------tttgcccaaatgtct
A0A8B9UYC3_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A8B9E2U6_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A8B9C4H4_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A8C3CIW8_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A493T1X3_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A8B9SFH3_BCL2-01      -----------taccagcgggac------------ttcgcccagatgtcc
A0A8D2P664_BCL2-01      -----------taccagagggacnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A674GNG3_BCL2-01      -----------taccagagagac------------ttttcccaaatgtct
A0A674GNG3_BCL2-03      -----------taccagagagac------------ttttcccaaatgtct
A0A8C5TLV4_BCL2-01      -----------taccagagggac------------tttgcccaaatgtct
A0A672TR23_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8C3JHE5_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8C0BN28_BCL2-01      --------------------------------------------------
A0A8B9RWH9_BCL2-01      -----------taccagagggac------------ttcgcccaaatgtcc
A0A663FHR0_BCL2-01      -----------taccagagggac------------ttcgcccaaatgtcc
A0A8C8ANG9_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8C0IE77_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8D0G0L7_BCL2-01      -----------taccagagggac------------tttgcccaaatgtcc
A0A8C4U538_BCL2-01      -----------taccagagggac------------tttgcccaaatgtct
A0A8C4U538_BCL2-02      -----------taccagagggac------------tttgcccaaatgtct
A0A8C3TNF2_BCL2-01      -----------taccagagggac------------tttgcccaaatgtct
A0A8C3QX54_BCL2-01      -----------taccagagggac------------tttgcccagatgtct
A0A803VR88_BCL2-01      -----------taccagagggac------------tttgcccaaatgtct
A0A803VR88_BCL2-02      -----------taccagagggac------------tttgcccaaatgtct
A0A8C5IH35_BCL2-05      -----------taccagagggac------------ttcgcccagatgtcc
A0A8C5IH35_BCL2-04      -----------taccagagggac------------ttcgcccagatgtcc
A0A8C5IH35_BCL2-03      -----------taccagagggac------------ttcgcccagatgtcc
A0A8D2N8C6_BCL2-01      -----------taccagagggac------------ttcgcccagatgtcc
A0A8D0QLD9_BCL2-07      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A4X1TRR9_BCL2-06      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A8D0QLD9_BCL2-05      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A4X1TRR9_BCL2-05      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A8D0QLD9_BCL2-04      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A4X1TRR9_BCL2-02      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A8D0QLD9_BCL2-02      gtgggcaggatcgtcttcgtgtc------------ctctcagg-----cc
A0A8C6RID6_BCL2-01      -----------taccgccgcgac------------ttcgcagagatgtcc
A0A8C6RID6_BCL2-02      -----------taccgccgcgac------------ttcgcagagatgtcc
Q6R755_BCL2-01          -----------taccgtcgcgac------------ttcgcggagatgtcc
Q923R6_BCL2-01          -----------taccgtcgcgac------------ttcgcggagatgtcc
A0A8C8U7I9_BCL2-01      -----------taccgtcgcgac------------ttcgcggagatgtcc
Q6NTH7_BCL2-01          -----------taccgtcgtgac------------ttcgcagagatgtcc
A0A8C6H5J8_BCL2-01      -----------taccgtcgtgac------------ttcgcagagatgtcc
Q7TSN8_BCL2-01          -----------taccgtcgtgac------------ttcgcagagatgtcc
A0A8I6AJ02_BCL2-01      -----------taccgtcgcgac------------tttgcagagatgtcc
P49950_BCL2-01          -----------taccgtcgcgac------------tttgcagagatgtcc
A0A4W2DSR6_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A4W2DSR6_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C6CUJ2_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A4W2DSR6_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A4W2DSR6_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
F6R2C4_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
O02718_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
A0A076FU27_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A076FZV9_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A452EV13_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C5JYS0_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
G3SLZ1_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcg
G3SLZ1_BCL2-02          -----------taccgccgcgac------------ttcgccgagatgtcg
H0W1T3_BCL2-01          -----------tatcgccaagac------------ttcgctgagatgtcc
A0A5F9CRQ4_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A5F9CRQ4_BCL2-02      -----------taccgccgcgac------------ttcgcggagatgtcc
M3YYK3_BCL2-01          -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8D2AUF5_BCL2-01      -----------tatcgccgggac------------ttcgccgagatgtcc
I3MVK9_BCL2-01          -----------tatcgtcgcgac------------ttcgccgagatgtcc
A0A8C5YTS1_BCL2-01      -----------tatcgtcgcgac------------ttcgccgagatgtcc
A0A8D2IIB8_BCL2-01      -----------tatcgtcgcgac------------ttcgccgagatgtcc
A0A250YD83_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A452T603_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8C2VKS3_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C9HUK6_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K5EB04_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6UEL3_BCL2-01      -----------tatcgccgcgac------------ttcgccgagatgtcc
A0A2R8MY14_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6R2I5_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K5HK49_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-04      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-10      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-05      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-08      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7N9CNB8_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8D2EFR4_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K5XRD4_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K5NZS5_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A0D9S017_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A5F7ZZ15_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6CIX3_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A096MPU7_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6KHG1_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6R2I5_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2J8W3J1_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C9HUK6_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2I3GZF9_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-06      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-07      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2R9APW6_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
G3QES9_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8B7H1C6_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C9AC52_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A2K6G3I7_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A3Q2HRY3_BCL2-02      -----------taccgccgcgac------------tttgccgagatgtcc
A0A8C4L1K6_BCL2-01      -----------taccgccgcgac------------tttgccgagatgtcc
A0A3Q2HRY3_BCL2-01      -----------taccgccgcgac------------tttgccgagatgtcc
A0A673VDM8_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A5F5Y6Y3_BCL2-02      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8C9J3W6_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
Q8I008_BCL2-01          -----------taccgccgcgac------------ttcgcggagatgtcc
A0A667GHH0_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A5F5Y6Y3_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8C8XJU8_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8C7B9K2_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
G1LIC9_BCL2-01          -----------taccgccgcgac------------ttcgcggagatgtcc
A0A452R110_BCL2-01      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A452R110_BCL2-02      -----------taccgccgcgac------------ttcgcggagatgtcc
A0A8C0NC28_BCL2-03      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8I3MLT5_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C0NC28_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
Q75SV7_BCL2-01          -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C0KWE3_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C0NC28_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8I3MLT5_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C6AXM8_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C9CJ69_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8B8V3A7_BCL2-02      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8B8V3A7_BCL2-01      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8B8V3A7_BCL2-03      -----------taccgccgcgac------------ttcgccgagatgtcc
A0A8C3WCN0_BCL2-01      -----------taccgccgagac------------tttgccgagatgtcc
A0A8D0QLD9_BCL2-03      -----------taccgccgcgac------------tttgccgagatgtcc
A0A4X1TRR9_BCL2-01      -----------taccgccgcgac------------tttgccgagatgtcc
A0A8D0QLD9_BCL2-01      -----------taccgccgcgac------------tttgccgagatgtcc
A0A4X1TRR9_BCL2-03      -----------taccgccgcgac------------tttgccgagatgtcc
                                                                          

A3KNH9_BCL2-01          caacaaatggtgttcaacccaaa-----------------ttctgc----
Q564A4_BCL2-01          caacaaatggtgttcaacccaaa-----------------ttctgc----
X4ZGI8_BCL2-01          caccagatgacattcagtcccag-----------------tgcagc----
A0A673HVU7_BCL2-01      caccgcatgatattcagtcccaa-----------------tacaac----
A0A4W4F7Z4_BCL2-01      aagcagttacacctaacatctat-----------------cacggc----
B9ZYL7_BCL2-01          gggctcctccatttaaccccatc-----------------cacagt----
A0A8C5MT36_BCL2-03      gggctcctccacttaaccccatc-----------------aacagt----
A0A8C5MT36_BCL2-01      gggctcctccacttaaccccatc-----------------aacagt----
A0A8C5MT36_BCL2-02      gggctcctccacttaaccccatc-----------------aacagt----
A0A8C5MT36_BCL2-04      gggctcctccacttaaccccatc-----------------aacagt----
A0A7M4G2E0_BCL2-01      cagccgttggcctctacctgtattttgtcatccaggtgaacacaac----
A0A7M4G2E0_BCL2-02      cagccgttggcctctacctgtattttgtcatccaggtgaacacaac----
A0A673Z0A3_BCL2-01      gggcagttgcattttacgcccag-----------------tacagc----
A0A8C7CHJ0_BCL2-01      gggcagttgcattttacgcccag-----------------tacggc----
A0A8C7Q7B4_BCL2-01      gggcagttgcattttacgcccag-----------------tacggc----
A0A0U3DHY6_BCL2-01      gggcaattgcattttacgcccag-----------------cacggc----
A0A4W5NW18_BCL2-01      gggcagttgcattttacgcccaa-----------------cacggc----
A0A674B8T7_BCL2-01      gggcagttgcattttacacccag-----------------cacggc----
A0A8C7RG50_BCL2-01      gggcagttgcattttacacccag-----------------cacggc----
A0A8C8GL24_BCL2-01      gggcagttgcattttacacccag-----------------cacggc----
A0A6Q2YIU6_BCL2-01      caccagctgtatctgacgtcctc-----------------tgtggc----
A0A4W5KV00_BCL2-01      caccagctgtatctcacatcctc-----------------cacggc----
A0A8C7G8X1_BCL2-01      caccagctgtatctcacatcctc-----------------cacggc----
A0A674B0E5_BCL2-01      caccagctgtatctcacatcctc-----------------cacggc----
A0A8C8JWJ1_BCL2-02      caccaattgtatctcacgtcttc-----------------tatggc----
A0A8C7N3I9_BCL2-01      caccaattgtatctcacgtcttc-----------------tatggc----
A0A8C8JWJ1_BCL2-01      caccaattgtatctcacgtcttc-----------------tatggc----
A0A8C5C4C3_BCL2-01      caccagctgtacctcacgtcgac-----------------tacggc----
A0A3B4A3G8_BCL2-01      agacagctgtatctgacatcctc-----------------aacggc----
A0A3Q3B0R2_BCL2-01      cggcagctggggctcgccagcgc-----------------cgcggc----
A0A8C7ZK61_BCL2-01      cggcagctgtacctcacctccac-----------------cacggc----
A0A3P8WUE9_BCL2-01      cggcagctctatctcacctccag-----------------cacggc----
A0A665U7Y7_BCL2-01      cggcagctgtacatctcctcctc-----------------cgtggc----
A0A672HHE5_BCL2-01      cggcagctgtacctcacctcctc-----------------cacggc----
A0A3Q3G1D7_BCL2-01      cggcagctgtatctcacctccac-----------------cacggc----
A0A8C2X310_BCL2-06      cggcagctgtacctcacctccac-----------------cacggc----
A0A3Q3MEY1_BCL2-01      cgacagctgtatctcacctccac-----------------cacggc----
A0A2U9BJ09_BCL2-01      cggcagctgtacctcacctccac-----------------cacggc----
A0A8C9ZFJ5_BCL2-09      cggcaactgtatctcacctccac-----------------cacggc----
A0A7N6A4C8_BCL2-01      cgacagctgtatctcacctccac-----------------cacggc----
A0A3Q0S5Z7_BCL2-01      cggcagctgcatctcacctccgc-----------------cacggc----
A0A668TEB6_BCL2-05      cggcagctgcatctcacctccgc-----------------cacggc----
A0A3P8QVM8_BCL2-01      cggcagctgcatctcacctcctc-----------------cacggc----
A0A3P9DIG5_BCL2-01      cggcagctgcatctcacctcctc-----------------cacggc----
A0A3Q2UYW8_BCL2-01      cggcagctgcatctcacctccgc-----------------cacggc----
A0A3B4G3K4_BCL2-01      cggcagctgcatctcacctccgc-----------------cacggc----
A0A4W6DDI0_BCL2-01      cggcagctgtacctcacctccac-----------------cacggc----
A0A1X9JZA1_BCL2-01      cggcagctgtatctcacctccac-----------------cacggc----
A0A3B4TX71_BCL2-01      cggcagctctatctcacctccac-----------------cacggc----
A0A3B4YAG2_BCL2-01      cggcagctctatctcacctccac-----------------cacggc----
A0A3B5BBQ0_BCL2-01      aggcagctgtatctcacctccac-----------------cacggc----
A0A3Q1B8C3_BCL2-01      aggcagctgtatctcacctccac-----------------cacggc----
A0A3P8S9L3_BCL2-01      aggcagctgtatctcacctccac-----------------cacggc----
A0A3Q1FLK7_BCL2-01      aggcagctctatctcaccaccac-----------------cacggc----
A0A673LV42_BCL2-01      aaacggctgcacctcacgtccat-----------------cacggc----
A0A8C1IQE4_BCL2-01      aaacagctgcatctcacgtccat-----------------cacggc----
A0A672T179_BCL2-01      aaacagctgcatctcacgtccat-----------------cacggc----
A0A3B3TCS4_BCL2-01      gaagagctgcacatcacgcccag-----------------cacggc----
A0A8C9T5U7_BCL2-01      gagcggctgcacttcacgcccag-----------------cacggc----
W5N4F7_BCL2-01          gatcagttgcacttcacccccaa-----------------caccgc----
H9GPE7_BCL2-01          ggccagctgcatttgacccccag-----------------cactgc----
A0A8D2Q1J0_BCL2-01      gggcaggttggagtatttggcta-----------------cacagcttat
A0A8D2Q1J0_BCL2-03      gggcaggttggagtatttggcta-----------------cacagcttat
A0A668TEB6_BCL2-01      ggccagattggtctgtttggtta-----------------cactgcctac
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ggccagattggtctgtttggtta-----------------cactgcctac
A0A668TEB6_BCL2-03      ggccagattggtctgtttggtta-----------------cactgcctac
A0A3Q3MEY1_BCL2-02      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-04      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-05      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-07      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-09      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-03      ggccagattggcctgtttggata-----------------cactgcatac
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      ggacaggttggcctgtttggata-----------------cactgcctac
A0A7N6A4C8_BCL2-04      ggacaggttggcctgtttggata-----------------cactgcctac
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ggacaggttggcctgtttggata-----------------cactgcctac
A0A7N6A4C8_BCL2-03      ggacaggttggcctgtttggata-----------------cactgcctac
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      ggccagatcggcttgtttggata-----------------caccgcctac
A0A8C2X310_BCL2-02      ggccagatcggcttgtttggata-----------------caccgcctac
A0A8C2X310_BCL2-04      ggccagatcggcttgtttggata-----------------caccgcctac
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      ggccagatcggcttgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-01      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-05      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-03      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-04      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-07      ggccagatcggcctgtttggata-----------------caccgcctac
A0A8C9ZFJ5_BCL2-08      ggccagatcggcctgtttggata-----------------caccgcctac
A0A674GNG3_BCL2-02      gggcagttaggcctgtttggata-----------------tacagcttat
A0A674GNG3_BCL2-04      gggcagttaggcctgtttggata-----------------tacagcttat
A0A8C5IH35_BCL2-01      ggccagctgggcctgtttggata-----------------tacagcttat
A0A8C5IH35_BCL2-02      ggccagctgggcctgtttggata-----------------tacagcttat
A0A670IB81_BCL2-01      ggacagctgcacttgaccccggt-----------------cactgc----
A0A8D0BPX3_BCL2-01      gggcagctgcacttgaccccacg-----------------cactgc----
A0A8D2Q1J0_BCL2-02      ggccagttgcacttgactccagt-----------------cactgc----
A0A8C5S4J3_BCL2-01      ggacaactgcacttgactccagt-----------------gactgc----
A0A670ZV01_BCL2-01      ggacaactgcacttgactccagt-----------------gactgc----
A0A8D0L5Z6_BCL2-01      ggccggttgcttttgatcccttt-----------------tgctgc----
A0A7M4EPU7_BCL2-01      ggccagctgcacttgaccccctt-----------------cacagc----
A0A7M4G2E0_BCL2-03      ggccagctgcacttgaccccctt-----------------cacagc----
A0A8C8SWU7_BCL2-01      ggccagctgcacttgaccccatt-----------------cacagc----
K7F5Y3_BCL2-02          gggcagctgcacttgaccccatt-----------------cacggc----
K7F5Y3_BCL2-01          gggcagctgcacttgaccccatt-----------------cacggc----
K7F5Y3_BCL2-03          gggcagctgcacttgaccccatt-----------------cacggc----
A0A452I9V7_BCL2-01      ggccagctgcacttgaccccatt-----------------cacggc----
A0A8C3SV21_BCL2-01      ggccagctgcacttgaccccatt-----------------cacggc----
A0A8C3ITE1_BCL2-01      ggccagttgcacttgaccccatt-----------------cacggc----
A0A674IMR0_BCL2-01      ggccagctgcacttgaccccatt-----------------cacggc----
A0A8C0G2Q6_BCL2-01      ggccagctgcacttgaccccatt-----------------cacggc----
A0A8C4VT25_BCL2-01      ggccagctgcacttgaccccatt-----------------cacggc----
A0A7N4PQN7_BCL2-01      ggtcagctgcacctgacccctgt-----------------tactgc----
F6YNL8_BCL2-01          ggtcaactgcacctgacccctgt-----------------tactgc----
A0A4X2L5Q0_BCL2-01      ggtcagctgcacctgacccctgt-----------------tactgc----
A0A8C2U1A2_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C9L7I6_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
G1MZW1_BCL2-01          ggccagctgcacctgacgccctt-----------------cacagc----
A0A8C3LBC4_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A669PDH6_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C9MG30_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A663MPN9_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C6ZF48_BCL2-01      ggccagctgcacctgacgcccgt-----------------cacggc----
A0A8B9PRT7_BCL2-01      ggccagctgcacctgacaccctt-----------------cacggc----
A0A8B9PRT7_BCL2-02      ggccagctgcacctgacaccctt-----------------cacggc----
A0A8C0UAC7_BCL2-01      ggccagctgcacctgacaccctt-----------------cacggc----
A0A8B9UYC3_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8B9E2U6_BCL2-01      ggccagctgcacctgacgccttt-----------------cacggc----
A0A8B9C4H4_BCL2-01      ggccagctgcacctgacgccttt-----------------cacggc----
A0A8C3CIW8_BCL2-01      ggccagctgcacctgacaccctt-----------------cacggc----
A0A493T1X3_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8B9SFH3_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8D2P664_BCL2-01      nnnnnnnnnnnnnnnnnnnnnnn-----------------nnnnnn----
A0A674GNG3_BCL2-01      ggccagctgcacctgacgccctt-----------------tacagc----
A0A674GNG3_BCL2-03      ggccagctgcacctgacgccctt-----------------tacagc----
A0A8C5TLV4_BCL2-01      ggccagctgcacctcacgccctt-----------------cacggc----
A0A672TR23_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C3JHE5_BCL2-01      ggccagctgcacctgaccccctt-----------------cacggc----
A0A8C0BN28_BCL2-01      ------------------------------------------nggc----
A0A8B9RWH9_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A663FHR0_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C8ANG9_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C0IE77_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8D0G0L7_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C4U538_BCL2-01      ggccagttgcacctgacgccctt-----------------cacggc----
A0A8C4U538_BCL2-02      ggccagttgcacctgacgccctt-----------------cacggc----
A0A8C3TNF2_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C3QX54_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A803VR88_BCL2-01      ggccagctgcacctgacgccctt-----------------cacggc----
A0A803VR88_BCL2-02      ggccagctgcacctgacgccctt-----------------cacggc----
A0A8C5IH35_BCL2-05      ggccagctgcacctgacgcccct-----------------cacggc----
A0A8C5IH35_BCL2-04      ggccagctgcacctgacgcccct-----------------cacggc----
A0A8C5IH35_BCL2-03      ggccagctgcacctgacgcccct-----------------cacggc----
A0A8D2N8C6_BCL2-01      ggccagctgcacctgacgcccct-----------------cacggc----
A0A8D0QLD9_BCL2-07      gggcagctgggcctgttcggctt-----------------cacagcctac
A0A4X1TRR9_BCL2-06      gggcagctgggcctgtttggctt-----------------cacagcctac
A0A8D0QLD9_BCL2-05      gggcagctgggcctgttcggctt-----------------cacagcctac
A0A4X1TRR9_BCL2-05      gggcagctgggcctgtttggctt-----------------cacagcctac
A0A8D0QLD9_BCL2-04      gggcagctgggcctgttcggctt-----------------cacagcctac
A0A4X1TRR9_BCL2-07      --------------------------------------------------
A0A8D0QLD9_BCL2-06      --------------------------------------------------
A0A4X1TRR9_BCL2-04      gggcagctgggcctgtttggctt-----------------cacagcctac
A0A4X1TRR9_BCL2-02      gggcagctgggcctgtttggctt-----------------cacagcctac
A0A8D0QLD9_BCL2-02      gggcagctgggcctgttcggctt-----------------cacagcctac
A0A8C6RID6_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C6RID6_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
Q6R755_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
Q923R6_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A8C8U7I9_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
Q6NTH7_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A8C6H5J8_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
Q7TSN8_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A8I6AJ02_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
P49950_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A4W2DSR6_BCL2-02      agtcagctgcacctgacgccctt-----------------caccgc----
A0A4W2DSR6_BCL2-02      agtcagctgcacctgacgccctt-----------------caccgc----
A0A8C6CUJ2_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A4W2DSR6_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
A0A4W2DSR6_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
F6R2C4_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
O02718_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A076FU27_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A076FZV9_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A452EV13_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C5JYS0_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
G3SLZ1_BCL2-01          agccagctgcacctgactccctt-----------------caccgc----
G3SLZ1_BCL2-02          agccagctgcacctgactccctt-----------------caccgc----
H0W1T3_BCL2-01          agccagctgcacctgacgccttt-----------------caccgc----
A0A5F9CRQ4_BCL2-01      agccagctgcacctgacgccctt-----------------tcacgc----
A0A5F9CRQ4_BCL2-02      agccagctgcacctgacgccctt-----------------tcacgc----
M3YYK3_BCL2-01          agccagctgcacctgacgccctt-----------------caccgc----
A0A8D2AUF5_BCL2-01      agtcagctgcacctgacgccctt-----------------caccgc----
I3MVK9_BCL2-01          agtcagctgcacctgacgccctt-----------------caccgc----
A0A8C5YTS1_BCL2-01      agtcagctgcacctgaccccctt-----------------caccgc----
A0A8D2IIB8_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A250YD83_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A452T603_BCL2-01      agccagctgcacctgacaccctt-----------------caccgc----
A0A8C2VKS3_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C9HUK6_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K5EB04_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6UEL3_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2R8MY14_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6R2I5_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K5HK49_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-04      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-10      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-05      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-08      agccagctgcacctgacgccctt-----------------caccgc----
A0A7N9CNB8_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8D2EFR4_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K5XRD4_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K5NZS5_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A0D9S017_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A5F7ZZ15_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6CIX3_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A096MPU7_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6KHG1_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6R2I5_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2J8W3J1_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C9HUK6_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2I3GZF9_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-06      agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-07      agccagctgcacctgacgccctt-----------------caccgc----
A0A2R9APW6_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
G3QES9_BCL2-01          agccagctgcacctgacgccctt-----------------caccgc----
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          agccagttgcacctgacgccctt-----------------caccgc----
A0A8B7H1C6_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C9AC52_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A2K6G3I7_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A3Q2HRY3_BCL2-02      agccagctgcacctgacgccttt-----------------caccgc----
A0A8C4L1K6_BCL2-01      agccagctgcacctgacgccttt-----------------caccgc----
A0A3Q2HRY3_BCL2-01      agccagctgcacctgacgccttt-----------------caccgc----
A0A673VDM8_BCL2-01      agccagctgcacctgaccccgtt-----------------caccgc----
A0A5F5Y6Y3_BCL2-02      agccagctgcacctgacaccctt-----------------taccgc----
A0A8C9J3W6_BCL2-01      agccagctgcacctgacaccctt-----------------taccgc----
Q8I008_BCL2-01          agccagctgcacctgacaccctt-----------------taccgc----
A0A667GHH0_BCL2-01      agccagctgcacctgacaccctt-----------------taccgc----
A0A5F5Y6Y3_BCL2-01      agccagctgcacctgacaccctt-----------------taccgc----
A0A8C8XJU8_BCL2-01      agccagctgcacctgacaccctt-----------------taccgc----
A0A8C7B9K2_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
G1LIC9_BCL2-01          agccagctgcacctgacaccctt-----------------caccgc----
A0A452R110_BCL2-01      agccagctgcacctgacaccctt-----------------caccgc----
A0A452R110_BCL2-02      agccagctgcacctgacaccctt-----------------caccgc----
A0A8C0NC28_BCL2-03      agccagctgcacctgacgccctt-----------------caccgc----
A0A8I3MLT5_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C0NC28_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
Q75SV7_BCL2-01          agccagctgcacctgacgccctt-----------------caccgc----
A0A8C0KWE3_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C0NC28_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8I3MLT5_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C6AXM8_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C9CJ69_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8B8V3A7_BCL2-02      agccagctgcacctgacgccctt-----------------caccgc----
A0A8B8V3A7_BCL2-01      agccagctgcacctgacgccctt-----------------caccgc----
A0A8B8V3A7_BCL2-03      agccagctgcacctgacgccctt-----------------caccgc----
A0A8C3WCN0_BCL2-01      agccagctgcacctgacaccctt-----------------caccgc----
A0A8D0QLD9_BCL2-03      agccagctgcacctgactccctt-----------------caccgc----
A0A4X1TRR9_BCL2-01      agccagctgcacctgactccctt-----------------caccgc----
A0A8D0QLD9_BCL2-01      agccagctgcacctgactccctt-----------------caccgc----
A0A4X1TRR9_BCL2-03      agccagctgcacctgactccctt-----------------caccgc----
                                                                          

A3KNH9_BCL2-01          ------------------------------------------------gc
Q564A4_BCL2-01          ------------------------------------------------gc
X4ZGI8_BCL2-01          ------------------------------------------------ac
A0A673HVU7_BCL2-01      ------------------------------------------------gc
A0A4W4F7Z4_BCL2-01      ------------------------------------------------gc
B9ZYL7_BCL2-01          ------------------------------------------------ta
A0A8C5MT36_BCL2-03      ------------------------------------------------tc
A0A8C5MT36_BCL2-01      ------------------------------------------------tc
A0A8C5MT36_BCL2-02      ------------------------------------------------tc
A0A8C5MT36_BCL2-04      ------------------------------------------------tc
A0A7M4G2E0_BCL2-01      ---------------------------------------agatgtatgca
A0A7M4G2E0_BCL2-02      ---------------------------------------agatgtatgca
A0A673Z0A3_BCL2-01      ------------------------------------------------ac
A0A8C7CHJ0_BCL2-01      ------------------------------------------------ac
A0A8C7Q7B4_BCL2-01      ------------------------------------------------ac
A0A0U3DHY6_BCL2-01      ------------------------------------------------ac
A0A4W5NW18_BCL2-01      ------------------------------------------------ac
A0A674B8T7_BCL2-01      ------------------------------------------------ac
A0A8C7RG50_BCL2-01      ------------------------------------------------ac
A0A8C8GL24_BCL2-01      ------------------------------------------------ac
A0A6Q2YIU6_BCL2-01      ------------------------------------------------cg
A0A4W5KV00_BCL2-01      ------------------------------------------------tg
A0A8C7G8X1_BCL2-01      ------------------------------------------------tg
A0A674B0E5_BCL2-01      ------------------------------------------------tg
A0A8C8JWJ1_BCL2-02      ------------------------------------------------ag
A0A8C7N3I9_BCL2-01      ------------------------------------------------ag
A0A8C8JWJ1_BCL2-01      ------------------------------------------------ag
A0A8C5C4C3_BCL2-01      ------------------------------------------------gc
A0A3B4A3G8_BCL2-01      ------------------------------------------------gc
A0A3Q3B0R2_BCL2-01      ------------------------------------------------ca
A0A8C7ZK61_BCL2-01      ------------------------------------------------ga
A0A3P8WUE9_BCL2-01      ------------------------------------------------gc
A0A665U7Y7_BCL2-01      ------------------------------------------------gc
A0A672HHE5_BCL2-01      ------------------------------------------------gc
A0A3Q3G1D7_BCL2-01      ------------------------------------------------gc
A0A8C2X310_BCL2-06      ------------------------------------------------gc
A0A3Q3MEY1_BCL2-01      ------------------------------------------------gc
A0A2U9BJ09_BCL2-01      ------------------------------------------------gc
A0A8C9ZFJ5_BCL2-09      ------------------------------------------------gc
A0A7N6A4C8_BCL2-01      ------------------------------------------------gc
A0A3Q0S5Z7_BCL2-01      ------------------------------------------------gc
A0A668TEB6_BCL2-05      ------------------------------------------------gc
A0A3P8QVM8_BCL2-01      ------------------------------------------------gc
A0A3P9DIG5_BCL2-01      ------------------------------------------------gc
A0A3Q2UYW8_BCL2-01      ------------------------------------------------gc
A0A3B4G3K4_BCL2-01      ------------------------------------------------gc
A0A4W6DDI0_BCL2-01      ------------------------------------------------gc
A0A1X9JZA1_BCL2-01      ------------------------------------------------gc
A0A3B4TX71_BCL2-01      ------------------------------------------------gc
A0A3B4YAG2_BCL2-01      ------------------------------------------------gc
A0A3B5BBQ0_BCL2-01      ------------------------------------------------gc
A0A3Q1B8C3_BCL2-01      ------------------------------------------------gc
A0A3P8S9L3_BCL2-01      ------------------------------------------------gc
A0A3Q1FLK7_BCL2-01      ------------------------------------------------gc
A0A673LV42_BCL2-01      ------------------------------------------------gc
A0A8C1IQE4_BCL2-01      ------------------------------------------------gc
A0A672T179_BCL2-01      ------------------------------------------------gc
A0A3B3TCS4_BCL2-01      ------------------------------------------------gc
A0A8C9T5U7_BCL2-01      ------------------------------------------------gc
W5N4F7_BCL2-01          ------------------------------------------------cc
H9GPE7_BCL2-01          ------------------------------------------------ca
A0A8D2Q1J0_BCL2-01      tctgcaacaaagtttgcacttcgaggactagctgaagctttgcagatgga
A0A8D2Q1J0_BCL2-03      tctgcaacaaagtttgcacttcgaggactagctgaagctttgcagatgga
A0A668TEB6_BCL2-01      tccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatgga
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      tccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatgga
A0A668TEB6_BCL2-03      tccccatctaagtttgccctgcgaggccttgcagagtcgctgcagatgga
A0A3Q3MEY1_BCL2-02      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-04      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-05      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-07      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-09      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-03      tccccatccaagtttgccctgcgaggcttggcagagtcactgcagatgga
A0A3Q3MEY1_BCL2-06      --------------------------------------------------
A0A7N6A4C8_BCL2-02      tccccatccaagtttgccctgcgtggtttagcagagtcactgcagatgga
A0A7N6A4C8_BCL2-04      tccccatccaagtttgccctgcgtggtttagcagagtcactgcagatgga
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      tccccatccaagtttgccctgcgtggtttagcagagtcactgcagatgga
A0A7N6A4C8_BCL2-03      tccccatccaagtttgccctgcgtggtttagcagagtcactgcagatgga
A0A7N6A4C8_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      tccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatgga
A0A8C2X310_BCL2-02      tccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatgga
A0A8C2X310_BCL2-04      tccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatgga
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      tccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatgga
A0A8C9ZFJ5_BCL2-01      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-05      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-03      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-04      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-07      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A8C9ZFJ5_BCL2-08      tccccatccaagtttgctctgcgtggcttagcagagtcgctgcagatgga
A0A674GNG3_BCL2-02      tctcccacgaaatttgctcttcgagggttggctgaagccctgcaaatgga
A0A674GNG3_BCL2-04      tctcccacgaaatttgctcttcgagggttggctgaagccctgcaaatgga
A0A8C5IH35_BCL2-01      tctcccaccaagtttgctcttcgagggttggctgaagccctgcaaatgga
A0A8C5IH35_BCL2-02      tctcccaccaagtttgctcttcgagggttggctgaagccctgcaaatgga
A0A670IB81_BCL2-01      ------------------------------------------------ca
A0A8D0BPX3_BCL2-01      ------------------------------------------------ca
A0A8D2Q1J0_BCL2-02      ------------------------------------------------ca
A0A8C5S4J3_BCL2-01      ------------------------------------------------ca
A0A670ZV01_BCL2-01      ------------------------------------------------ca
A0A8D0L5Z6_BCL2-01      ------------------------------------------------ca
A0A7M4EPU7_BCL2-01      ------------------------------------------------ca
A0A7M4G2E0_BCL2-03      ------------------------------------------------ca
A0A8C8SWU7_BCL2-01      ------------------------------------------------ca
K7F5Y3_BCL2-02          ------------------------------------------------ca
K7F5Y3_BCL2-01          ------------------------------------------------ca
K7F5Y3_BCL2-03          ------------------------------------------------ca
A0A452I9V7_BCL2-01      ------------------------------------------------ca
A0A8C3SV21_BCL2-01      ------------------------------------------------ca
A0A8C3ITE1_BCL2-01      ------------------------------------------------ca
A0A674IMR0_BCL2-01      ------------------------------------------------ca
A0A8C0G2Q6_BCL2-01      ------------------------------------------------ca
A0A8C4VT25_BCL2-01      ------------------------------------------------ca
A0A7N4PQN7_BCL2-01      ------------------------------------------------ta
F6YNL8_BCL2-01          ------------------------------------------------ta
A0A4X2L5Q0_BCL2-01      ------------------------------------------------ta
A0A8C2U1A2_BCL2-01      ------------------------------------------------cc
A0A8C9L7I6_BCL2-01      ------------------------------------------------cc
G1MZW1_BCL2-01          ------------------------------------------------cc
A0A8C3LBC4_BCL2-01      ------------------------------------------------cc
A0A669PDH6_BCL2-01      ------------------------------------------------cc
A0A8C9MG30_BCL2-01      ------------------------------------------------ca
A0A663MPN9_BCL2-01      ------------------------------------------------ca
A0A8C6ZF48_BCL2-01      ------------------------------------------------gc
A0A8B9PRT7_BCL2-01      ------------------------------------------------ca
A0A8B9PRT7_BCL2-02      ------------------------------------------------ca
A0A8C0UAC7_BCL2-01      ------------------------------------------------ca
A0A8B9UYC3_BCL2-01      ------------------------------------------------ca
A0A8B9E2U6_BCL2-01      ------------------------------------------------ca
A0A8B9C4H4_BCL2-01      ------------------------------------------------ca
A0A8C3CIW8_BCL2-01      ------------------------------------------------ca
A0A493T1X3_BCL2-01      ------------------------------------------------ca
A0A8B9SFH3_BCL2-01      ------------------------------------------------ca
A0A8D2P664_BCL2-01      ------------------------------------------------nn
A0A674GNG3_BCL2-01      ------------------------------------------------ca
A0A674GNG3_BCL2-03      ------------------------------------------------ca
A0A8C5TLV4_BCL2-01      ------------------------------------------------ca
A0A672TR23_BCL2-01      ------------------------------------------------ca
A0A8C3JHE5_BCL2-01      ------------------------------------------------ca
A0A8C0BN28_BCL2-01      ------------------------------------------------ca
A0A8B9RWH9_BCL2-01      ------------------------------------------------ca
A0A663FHR0_BCL2-01      ------------------------------------------------ca
A0A8C8ANG9_BCL2-01      ------------------------------------------------cc
A0A8C0IE77_BCL2-01      ------------------------------------------------ca
A0A8D0G0L7_BCL2-01      ------------------------------------------------ca
A0A8C4U538_BCL2-01      ------------------------------------------------ca
A0A8C4U538_BCL2-02      ------------------------------------------------ca
A0A8C3TNF2_BCL2-01      ------------------------------------------------ca
A0A8C3QX54_BCL2-01      ------------------------------------------------ca
A0A803VR88_BCL2-01      ------------------------------------------------ca
A0A803VR88_BCL2-02      ------------------------------------------------ca
A0A8C5IH35_BCL2-05      ------------------------------------------------ca
A0A8C5IH35_BCL2-04      ------------------------------------------------ca
A0A8C5IH35_BCL2-03      ------------------------------------------------ca
A0A8D2N8C6_BCL2-01      ------------------------------------------------ca
A0A8D0QLD9_BCL2-07      tcttcctcaaagtttgccatcaggggattggcagaagctctgcagatgga
A0A4X1TRR9_BCL2-06      tcttcctcgaagtttgccatcaggggattggcagaagctctgcagatgga
A0A8D0QLD9_BCL2-05      tcttcctcaaagtttgccatcaggggattggcagaagctctgcagatgg-
A0A4X1TRR9_BCL2-05      tcttcctcgaagtttgccatcaggggattggcagaagctctgcagatgg-
A0A8D0QLD9_BCL2-04      tcttcctcaaagtttgccatcaggggattggcagaagctctgcagatgga
A0A4X1TRR9_BCL2-07      ------------------------------------------------ga
A0A8D0QLD9_BCL2-06      ------------------------------------------------ga
A0A4X1TRR9_BCL2-04      tcttcctcgaagtttgccatcaggggattggcagaagctctgcagatgga
A0A4X1TRR9_BCL2-02      tcttcctcgaagtttgccatcaggggattggcagaagctctgcagatgga
A0A8D0QLD9_BCL2-02      tcttcctcaaagtttgccatcaggggattggcagaagctctgcagatgga
A0A8C6RID6_BCL2-01      ------------------------------------------------ga
A0A8C6RID6_BCL2-02      ------------------------------------------------ga
Q6R755_BCL2-01          ------------------------------------------------ga
Q923R6_BCL2-01          ------------------------------------------------ga
A0A8C8U7I9_BCL2-01      ------------------------------------------------ga
Q6NTH7_BCL2-01          ------------------------------------------------ga
A0A8C6H5J8_BCL2-01      ------------------------------------------------ga
Q7TSN8_BCL2-01          ------------------------------------------------ga
A0A8I6AJ02_BCL2-01      ------------------------------------------------ga
P49950_BCL2-01          ------------------------------------------------ga
A0A4W2DSR6_BCL2-02      ------------------------------------------------ga
A0A4W2DSR6_BCL2-02      ------------------------------------------------ga
A0A8C6CUJ2_BCL2-01      ------------------------------------------------ga
A0A4W2DSR6_BCL2-01      ------------------------------------------------ga
A0A4W2DSR6_BCL2-01      ------------------------------------------------ga
F6R2C4_BCL2-01          ------------------------------------------------ga
O02718_BCL2-01          ------------------------------------------------ga
A0A076FU27_BCL2-01      ------------------------------------------------ga
A0A076FZV9_BCL2-01      ------------------------------------------------ga
A0A452EV13_BCL2-01      ------------------------------------------------ga
A0A8C5JYS0_BCL2-01      ------------------------------------------------gc
G3SLZ1_BCL2-01          ------------------------------------------------ga
G3SLZ1_BCL2-02          ------------------------------------------------ga
H0W1T3_BCL2-01          ------------------------------------------------ga
A0A5F9CRQ4_BCL2-01      ------------------------------------------------ga
A0A5F9CRQ4_BCL2-02      ------------------------------------------------ga
M3YYK3_BCL2-01          ------------------------------------------------ga
A0A8D2AUF5_BCL2-01      ------------------------------------------------ga
I3MVK9_BCL2-01          ------------------------------------------------aa
A0A8C5YTS1_BCL2-01      ------------------------------------------------aa
A0A8D2IIB8_BCL2-01      ------------------------------------------------aa
A0A250YD83_BCL2-01      ------------------------------------------------ga
A0A452T603_BCL2-01      ------------------------------------------------aa
A0A8C2VKS3_BCL2-01      ------------------------------------------------ga
A0A8C9HUK6_BCL2-02      ------------------------------------------------gc
A0A2K5EB04_BCL2-01      ------------------------------------------------gc
A0A2K6UEL3_BCL2-01      ------------------------------------------------gc
A0A2R8MY14_BCL2-01      ------------------------------------------------gc
A0A2K6R2I5_BCL2-02      ------------------------------------------------gc
A0A2K5HK49_BCL2-01      ------------------------------------------------gc
A0A7I2V3S7_BCL2-04      ------------------------------------------------gc
A0A7I2V3S7_BCL2-10      ------------------------------------------------gc
A0A7I2V3S7_BCL2-05      ------------------------------------------------gc
A0A7I2V3S7_BCL2-08      ------------------------------------------------gc
A0A7N9CNB8_BCL2-01      ------------------------------------------------gc
A0A8D2EFR4_BCL2-01      ------------------------------------------------gc
A0A2K5XRD4_BCL2-01      ------------------------------------------------gc
A0A2K5NZS5_BCL2-01      ------------------------------------------------gc
A0A0D9S017_BCL2-01      ------------------------------------------------gc
A0A5F7ZZ15_BCL2-01      ------------------------------------------------gc
A0A2K6CIX3_BCL2-01      ------------------------------------------------gc
A0A096MPU7_BCL2-01      ------------------------------------------------gc
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          ------------------------------------------------gc
A0A2K6KHG1_BCL2-01      ------------------------------------------------gc
A0A2K6R2I5_BCL2-01      ------------------------------------------------gc
A0A2J8W3J1_BCL2-01      ------------------------------------------------gc
A0A8C9HUK6_BCL2-01      ------------------------------------------------gc
A0A2I3GZF9_BCL2-01      ------------------------------------------------gc
A0A7I2V3S7_BCL2-06      ------------------------------------------------gc
A0A7I2V3S7_BCL2-07      ------------------------------------------------gc
A0A2R9APW6_BCL2-01      ------------------------------------------------gc
G3QES9_BCL2-01          ------------------------------------------------gc
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          ------------------------------------------------ga
A0A8B7H1C6_BCL2-01      ------------------------------------------------ga
A0A8C9AC52_BCL2-01      ------------------------------------------------ga
A0A2K6G3I7_BCL2-01      ------------------------------------------------ga
A0A3Q2HRY3_BCL2-02      ------------------------------------------------aa
A0A8C4L1K6_BCL2-01      ------------------------------------------------ga
A0A3Q2HRY3_BCL2-01      ------------------------------------------------aa
A0A673VDM8_BCL2-01      ------------------------------------------------ga
A0A5F5Y6Y3_BCL2-02      ------------------------------------------------aa
A0A8C9J3W6_BCL2-01      ------------------------------------------------aa
Q8I008_BCL2-01          ------------------------------------------------aa
A0A667GHH0_BCL2-01      ------------------------------------------------aa
A0A5F5Y6Y3_BCL2-01      ------------------------------------------------aa
A0A8C8XJU8_BCL2-01      ------------------------------------------------aa
A0A8C7B9K2_BCL2-01      ------------------------------------------------ga
G1LIC9_BCL2-01          ------------------------------------------------aa
A0A452R110_BCL2-01      ------------------------------------------------aa
A0A452R110_BCL2-02      ------------------------------------------------aa
A0A8C0NC28_BCL2-03      ------------------------------------------------ga
A0A8I3MLT5_BCL2-02      ------------------------------------------------ga
A0A8C0NC28_BCL2-02      ------------------------------------------------ga
Q75SV7_BCL2-01          ------------------------------------------------ga
A0A8C0KWE3_BCL2-01      ------------------------------------------------ga
A0A8C0NC28_BCL2-01      ------------------------------------------------ga
A0A8I3MLT5_BCL2-01      ------------------------------------------------ga
A0A8C6AXM8_BCL2-01      ------------------------------------------------ga
A0A8C9CJ69_BCL2-01      ------------------------------------------------ga
A0A8B8V3A7_BCL2-02      ------------------------------------------------ga
A0A8B8V3A7_BCL2-01      ------------------------------------------------ga
A0A8B8V3A7_BCL2-03      ------------------------------------------------ga
A0A8C3WCN0_BCL2-01      ------------------------------------------------ga
A0A8D0QLD9_BCL2-03      ------------------------------------------------ga
A0A4X1TRR9_BCL2-01      ------------------------------------------------ga
A0A8D0QLD9_BCL2-01      ------------------------------------------------ga
A0A4X1TRR9_BCL2-03      ------------------------------------------------ga
                                                                          

A3KNH9_BCL2-01          aacgcagc-----------tttctaaccgtggcc------gaagagctct
Q564A4_BCL2-01          aacgcagc-----------tttctaaccgtggcc------gaagagctct
X4ZGI8_BCL2-01          aacgcagc-----------ttcttagctgtggct------gaagagctct
A0A673HVU7_BCL2-01      aacgcagc-----------ttcttagccgtggca------gaagagctct
A0A4W4F7Z4_BCL2-01      agagaagg-----------ttcacagctgtcata------gacgaactgt
B9ZYL7_BCL2-01          gggtgcgc-----------tttgcaacagtggtg------gaggagctct
A0A8C5MT36_BCL2-03      gtccacgg-----------tttgctgctgtggtg------gaggaactct
A0A8C5MT36_BCL2-01      gtccacgg-----------tttgctgctgtggtg------gaggaactct
A0A8C5MT36_BCL2-02      gtccacgg-----------tttgctgctgtggtg------gaggaactct
A0A8C5MT36_BCL2-04      gtccacgg-----------tttgctgctgtggtg------gaggaactct
A0A7M4G2E0_BCL2-01      agaggagggagaggttgtatgcacgccggggatacacatcaatgaact--
A0A7M4G2E0_BCL2-02      agaggagggagaggttgtatgcacgccggggatacacatcaatgaact--
A0A673Z0A3_BCL2-01      agagaagg-----------tttactgctgtaata------gaggagctct
A0A8C7CHJ0_BCL2-01      agagaagg-----------tttactgctgttata------gaggagctct
A0A8C7Q7B4_BCL2-01      agagaagg-----------tttactgctgttata------gaggagctct
A0A0U3DHY6_BCL2-01      aganaagg-----------tttaccgctgtaata------gatgagctct
A0A4W5NW18_BCL2-01      agagaagg-----------tttacggctgtaata------gatgagctct
A0A674B8T7_BCL2-01      agagaagg-----------tttaccgctgtaata------gatgagctct
A0A8C7RG50_BCL2-01      agagaagg-----------tttaccgctgtaata------gatgagctct
A0A8C8GL24_BCL2-01      agagaagg-----------tttaccgctgtaata------gatgagctct
A0A6Q2YIU6_BCL2-01      agaggaga-----------ttcagagaggttata------gacgagctgt
A0A4W5KV00_BCL2-01      agaggaga-----------tttagagaggtgata------gacgagctgt
A0A8C7G8X1_BCL2-01      agaggaga-----------tttagagaggtgata------gacgagctgt
A0A674B0E5_BCL2-01      agaggaga-----------tttagagaggtgata------gacgagctgt
A0A8C8JWJ1_BCL2-02      aaaggaga-----------ttcagagaggtgata------gacgagctgt
A0A8C7N3I9_BCL2-01      aaaggaga-----------ttcagagaggtgata------gacgagctgt
A0A8C8JWJ1_BCL2-01      aaaggaga-----------ttcagagaggtgata------gacgagctgt
A0A8C5C4C3_BCL2-01      agaggcgg-----------ttcagggaggtgatc------gacgagctgt
A0A3B4A3G8_BCL2-01      agaggagg-----------ttcgcggaggttata------gacgaactgt
A0A3Q3B0R2_BCL2-01      aggcgcgc-----------ttcgccgaggtgatg------gacgagctgt
A0A8C7ZK61_BCL2-01      agacgagg-----------ttcgccgaggtgatt------gacgaactgt
A0A3P8WUE9_BCL2-01      agaggaga-----------ttcaccgaggtgatt------gacgaactgt
A0A665U7Y7_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactct
A0A672HHE5_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3Q3G1D7_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A8C2X310_BCL2-06      agcggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3Q3MEY1_BCL2-01      agaggcga-----------ttcgccgaggtgata------gatgaactgt
A0A2U9BJ09_BCL2-01      agaggcgc-----------ttcgccgaggtgatc------gacgaactgt
A0A8C9ZFJ5_BCL2-09      aaaggaga-----------ttcgccgaggtgatc------gacgaactgt
A0A7N6A4C8_BCL2-01      agcggaga-----------ttcgccgaggtgata------gacgaactgt
A0A3Q0S5Z7_BCL2-01      agaggaga-----------ttcgccgaggtgata------gacgaactgt
A0A668TEB6_BCL2-05      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3P8QVM8_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3P9DIG5_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3Q2UYW8_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A3B4G3K4_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A4W6DDI0_BCL2-01      agaggagg-----------ttcgccgaggtgata------gacgaactgt
A0A1X9JZA1_BCL2-01      agaggaga-----------ttcgccgacgtgata------gacgaactgt
A0A3B4TX71_BCL2-01      agagaaga-----------ttcgccgaggtgata------gacgaactgt
A0A3B4YAG2_BCL2-01      agagaaga-----------ttcgccgaggttata------gacgaactgt
A0A3B5BBQ0_BCL2-01      agaggaga-----------ttcgccgaggtgata------gacgaactgt
A0A3Q1B8C3_BCL2-01      agaggaga-----------ttcgccgaggtgata------gacgaactgt
A0A3P8S9L3_BCL2-01      agaggaga-----------ttcgccgaggtgata------gacgaactgt
A0A3Q1FLK7_BCL2-01      agaggaga-----------ttcgccgaggtgata------gacgaactgt
A0A673LV42_BCL2-01      atcagcgc-----------ttcaccgcggtcata------gacgagctgt
A0A8C1IQE4_BCL2-01      agcagcgc-----------tttaccgcggtcata------gacgagctgt
A0A672T179_BCL2-01      accagcgc-----------ttcaccgcggtcata------gacgagctgt
A0A3B3TCS4_BCL2-01      agcgccgc-----------ttcacggccgtcatc------gaggagctgt
A0A8C9T5U7_BCL2-01      agcgcaag-----------ttcacggccgtcatc------gaggagctct
W5N4F7_BCL2-01          ggaggaag-----------ttcaccgcggtggtg------gaggagctgt
H9GPE7_BCL2-01          gaagtcgt-----------tttgtggccgtggtg------gaagagctct
A0A8D2Q1J0_BCL2-01      ggtaaagccctacaatatctacataacagttgcg------ta----tcct
A0A8D2Q1J0_BCL2-03      ggtaaagccctacaatatctacataacagttgcg------ta----tcct
A0A668TEB6_BCL2-01      gataaagccctacaatatctacgtgactgtggca------ta----cccc
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      gataaagccctacaatatctacgtgactgtggca------ta----cccc
A0A668TEB6_BCL2-03      gataaagccctacaatatctacgtgactgtggca------ta----cccc
A0A3Q3MEY1_BCL2-02      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-04      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-05      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-07      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-09      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-03      gataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A3Q3MEY1_BCL2-06      -ataaagccgtacaacatctatgtgaccgtggcc------ta----cccg
A0A7N6A4C8_BCL2-02      gataaagccctacaatatatatgtgacagtggcc------ta----cccc
A0A7N6A4C8_BCL2-04      gataaagccctacaatatatatgtgacagtggcc------ta----cccc
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      gataaagccctacaatatatatgtgacagtggcc------ta----cccc
A0A7N6A4C8_BCL2-03      gataaagccctacaatatatatgtgacagtggcc------ta----cccc
A0A7N6A4C8_BCL2-06      -ataaagccctacaatatatatgtgacagtggcc------ta----cccc
A0A8C2X310_BCL2-01      gataaagccatacaatatctacgtgacggtggcc------ta----cccc
A0A8C2X310_BCL2-02      gataaagccatacaatatctacgtgacggtggcc------ta----cccc
A0A8C2X310_BCL2-04      gataaagccatacaatatctacgtgacggtggcc------ta----cccc
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      gataaagccatacaatatctacgtgacggtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-01      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-05      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-03      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-04      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-07      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A8C9ZFJ5_BCL2-08      gataaagccatacaatatctatgtgactgtggcc------ta----cccc
A0A674GNG3_BCL2-02      ggtaaaaccttacaatgtctacgtaacagtggcc------ta----tcct
A0A674GNG3_BCL2-04      ggtaaaaccttacaatgtctacgtaacagtggcc------ta----tcct
A0A8C5IH35_BCL2-01      ggtaaaaccttacaatgtctacgtaacggtggcc------ta----tcct
A0A8C5IH35_BCL2-02      ggtaaaaccttacaatgtctacgtaacggtggcc------ta----tcct
A0A670IB81_BCL2-01      gagctcgc-----------tttgcggcagttgtc------gaagagctct
A0A8D0BPX3_BCL2-01      gagctcgt-----------tttacggcagttgtg------gaagagctgt
A0A8D2Q1J0_BCL2-02      gaagccgt-----------ttcgtggctgtggtg------gaagagctgt
A0A8C5S4J3_BCL2-01      gaagtcat-----------ttcatggctgttgta------gaagagctgt
A0A670ZV01_BCL2-01      gaagtcat-----------ttcatggctgttgtg------gaagagctgt
A0A8D0L5Z6_BCL2-01      gggagagc-----------tttatggaagtggca------gaagagctgt
A0A7M4EPU7_BCL2-01      ggaggcgt-----------tttatggcagtagta------gaggaactgt
A0A7M4G2E0_BCL2-03      gggggcgc-----------tttgtggcggtagtg------gaggagctgt
A0A8C8SWU7_BCL2-01      ggggacgc-----------tttgtggcggtggtg------gaggagctgt
K7F5Y3_BCL2-02          gggggcgc-----------tttgtggcggtggtg------gaggagctat
K7F5Y3_BCL2-01          gggggcgc-----------tttgtggcggtggtg------gaggagctat
K7F5Y3_BCL2-03          gggggcgc-----------tttgtggcggtggtg------gaggagctat
A0A452I9V7_BCL2-01      gggggcgc-----------tttgtggcggtggtg------gaggagctgt
A0A8C3SV21_BCL2-01      gggggcgc-----------tttgtggcggtggtg------gaggagctgt
A0A8C3ITE1_BCL2-01      gggggcgc-----------tttgtggcggtggtg------gaggagctgt
A0A674IMR0_BCL2-01      gggggcgc-----------tttgtggcggtggtg------gaggagctgt
A0A8C0G2Q6_BCL2-01      gggggcgc-----------tttgtggcagtggtg------gaggagctgt
A0A8C4VT25_BCL2-01      gggggcgc-----------tttgtggcggtggtg------gaggagctgt
A0A7N4PQN7_BCL2-01      ggggacgc-----------tttgccacagtagtg------gaagagctgt
F6YNL8_BCL2-01          ggggacgc-----------tttgccacagtggta------gaggagctgt
A0A4X2L5Q0_BCL2-01      ggggacgc-----------tttgccacagtggtg------gaggagttgt
A0A8C2U1A2_BCL2-01      acggtcgc-----------ttcgtggccgtggtg------gaggagctct
A0A8C9L7I6_BCL2-01      acggccgc-----------ttcgtggccgtggtg------gaggagctct
G1MZW1_BCL2-01          acggccgc-----------ttcgtggccgtggtg------gaggagcttt
A0A8C3LBC4_BCL2-01      acggccgc-----------ttcgtggccgtggtg------gaggagcttt
A0A669PDH6_BCL2-01      acggccgc-----------ttcgtggccgtggtg------gaggagcttt
A0A8C9MG30_BCL2-01      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A663MPN9_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C6ZF48_BCL2-01      gcggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8B9PRT7_BCL2-01      gaggccgc-----------tttgtggccgtggtg------gaggagctct
A0A8B9PRT7_BCL2-02      gaggccgc-----------tttgtggccgtggtg------gaggagctct
A0A8C0UAC7_BCL2-01      ggagccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8B9UYC3_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8B9E2U6_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8B9C4H4_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8C3CIW8_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A493T1X3_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8B9SFH3_BCL2-01      gaggccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8D2P664_BCL2-01      nnnnnnnn-----------nnnnnnnnnnnnnnn------nnnnnnnnnn
A0A674GNG3_BCL2-01      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A674GNG3_BCL2-03      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C5TLV4_BCL2-01      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A672TR23_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C3JHE5_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C0BN28_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8B9RWH9_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A663FHR0_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C8ANG9_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C0IE77_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8D0G0L7_BCL2-01      ggggccgc-----------ttcgtggcagtggtg------gaggagctct
A0A8C4U538_BCL2-01      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C4U538_BCL2-02      ggggccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C3TNF2_BCL2-01      ggagccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8C3QX54_BCL2-01      ggagccgc-----------ttcgtagccgtggtg------gaagagctct
A0A803VR88_BCL2-01      ggagccgc-----------ttcgtggccgtggtg------gaggagctct
A0A803VR88_BCL2-02      ggagccgc-----------ttcgtggccgtggtg------gaggagctct
A0A8C5IH35_BCL2-05      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C5IH35_BCL2-04      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8C5IH35_BCL2-03      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8D2N8C6_BCL2-01      ggagccgc-----------ttcgtggcggtggtg------gaggagctct
A0A8D0QLD9_BCL2-07      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A4X1TRR9_BCL2-06      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A8D0QLD9_BCL2-05      --------------------------------------------------
A0A4X1TRR9_BCL2-05      --------------------------------------------------
A0A8D0QLD9_BCL2-04      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A4X1TRR9_BCL2-07      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A8D0QLD9_BCL2-06      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A4X1TRR9_BCL2-04      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A4X1TRR9_BCL2-02      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A8D0QLD9_BCL2-02      ggtgaagccatataatgtttatgtcacagtggcc------ta----ccct
A0A8C6RID6_BCL2-01      ggggacgc-----------ttcgtcacggtggtg------gaggagctct
A0A8C6RID6_BCL2-02      ggggacgc-----------ttcgtcacggtggtg------gaggagctct
Q6R755_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
Q923R6_BCL2-01          ggggacgc-----------tttgctacggtggtg------gaggaactct
A0A8C8U7I9_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaagaactct
Q6NTH7_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggaactct
A0A8C6H5J8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggaactct
Q7TSN8_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggaactct
A0A8I6AJ02_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggaactct
P49950_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggaactct
A0A4W2DSR6_BCL2-02      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A4W2DSR6_BCL2-02      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A8C6CUJ2_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A4W2DSR6_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A4W2DSR6_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
F6R2C4_BCL2-01          ggggacgc-----------ttcgccacggtggtg------gaggagctct
O02718_BCL2-01          gggaacgc-----------ttcgccacggtggtg------gaggagctct
A0A076FU27_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A076FZV9_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A452EV13_BCL2-01      ggggacgc-----------ttcgccacggtggtg------gaggagctct
A0A8C5JYS0_BCL2-01      gggggcgc-----------ttcgccacggtggtg------gaggagctgt
G3SLZ1_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
G3SLZ1_BCL2-02          ggggacgc-----------tttgccacggtggtg------gaggagctct
H0W1T3_BCL2-01          ggggacgc-----------tttgccac------------------gctct
A0A5F9CRQ4_BCL2-01      gggggcgc-----------tttgccacggtggtg------gaggagctct
A0A5F9CRQ4_BCL2-02      gggggcgc-----------tttgccacggtggtg------gaggagctct
M3YYK3_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8D2AUF5_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
I3MVK9_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C5YTS1_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8D2IIB8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A250YD83_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A452T603_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C2VKS3_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C9HUK6_BCL2-02      gggggcgc-----------tttgccacggtggtg------gaggagctct
A0A2K5EB04_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6UEL3_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2R8MY14_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6R2I5_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K5HK49_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-04      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-10      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-05      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-08      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7N9CNB8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8D2EFR4_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K5XRD4_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K5NZS5_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A0D9S017_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A5F7ZZ15_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6CIX3_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A096MPU7_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6KHG1_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6R2I5_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2J8W3J1_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C9HUK6_BCL2-01      gggggcgc-----------tttgccacggtggtg------gaggagctct
A0A2I3GZF9_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-06      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-07      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2R9APW6_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
G3QES9_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          gaggacgc-----------tttgccacggtggtg------gaggagctct
A0A8B7H1C6_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C9AC52_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A2K6G3I7_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A3Q2HRY3_BCL2-02      ggggacgc-----------tttgccacggtagtg------gaggagctct
A0A8C4L1K6_BCL2-01      ggggacgc-----------tttgccacggtagtg------gaggagctct
A0A3Q2HRY3_BCL2-01      ggggacgc-----------tttgccacggtagtg------gaggagctct
A0A673VDM8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A5F5Y6Y3_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C9J3W6_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
Q8I008_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A667GHH0_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A5F5Y6Y3_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C8XJU8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C7B9K2_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
G1LIC9_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A452R110_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A452R110_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C0NC28_BCL2-03      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8I3MLT5_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C0NC28_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
Q75SV7_BCL2-01          ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C0KWE3_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C0NC28_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8I3MLT5_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C6AXM8_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C9CJ69_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8B8V3A7_BCL2-02      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8B8V3A7_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8B8V3A7_BCL2-03      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8C3WCN0_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8D0QLD9_BCL2-03      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A4X1TRR9_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A8D0QLD9_BCL2-01      ggggacgc-----------tttgccacggtggtg------gaggagctct
A0A4X1TRR9_BCL2-03      ggggacgc-----------tttgccacggtggtg------gaggagctct
                                                                          

A3KNH9_BCL2-01          ttagagacggagtgaactggg------ggcgga---------------tc
Q564A4_BCL2-01          ttagagacggagtgaactggg------ggcgga---------------tc
X4ZGI8_BCL2-01          tcagagacggagtgaactggg------ggcgga---------------tc
A0A673HVU7_BCL2-01      ttaaagacggagtgaactggg------ggcgga---------------tc
A0A4W4F7Z4_BCL2-01      ttagggacggggtcaattggg------gtcgga---------------tt
B9ZYL7_BCL2-01          ttcatgatggggtaaactggg------gaagga---------------tt
A0A8C5MT36_BCL2-03      tccatgatggggtgaactggg------gaagga---------------tt
A0A8C5MT36_BCL2-01      tccatgatggggtgaactggg------gaagga---------------tt
A0A8C5MT36_BCL2-02      tccatgatggggtgaactggg------gaagga---------------tt
A0A8C5MT36_BCL2-04      tccatgatggggtgaactggg------gaagga---------------tt
A0A7M4G2E0_BCL2-01      ------gcgaggtgcaggggg-gcgatgcag-----------------ct
A0A7M4G2E0_BCL2-02      ------gcgaggtgcaggggg-gcgatgcag-----------------ct
A0A673Z0A3_BCL2-01      tccgcgacggtgtaaactggg------gtcgga---------------tt
A0A8C7CHJ0_BCL2-01      tcagcgacggtgtaaactggg------gtcgga---------------tt
A0A8C7Q7B4_BCL2-01      tcagcgacggtataaactggg------gtcgga---------------tt
A0A0U3DHY6_BCL2-01      tcagcgacggggtaaactggg------gtcgga---------------tt
A0A4W5NW18_BCL2-01      tcagcgacggggtaaactggg------gtcgga---------------tt
A0A674B8T7_BCL2-01      tcagcgacggggtaaactggg------gtcgga---------------tt
A0A8C7RG50_BCL2-01      tcagcgacggggtaaactggg------gtcgga---------------tt
A0A8C8GL24_BCL2-01      tcagcgacggggtaaactggg------gtcgga---------------tt
A0A6Q2YIU6_BCL2-01      tcagagacggagttaactggg------gacgta---------------tt
A0A4W5KV00_BCL2-01      tcagggatggggttaactggg------gacgga---------------tt
A0A8C7G8X1_BCL2-01      tcagggatggggttaactggg------gacgga---------------tt
A0A674B0E5_BCL2-01      tcagggatggggttaactggg------gacgga---------------tt
A0A8C8JWJ1_BCL2-02      tcagggacggggttaactggg------gacgaa---------------tt
A0A8C7N3I9_BCL2-01      tcagggacggggttaactggg------gacgaa---------------tt
A0A8C8JWJ1_BCL2-01      tcagggacggggttaactggg------gacgaa---------------tt
A0A8C5C4C3_BCL2-01      tcagggacggcgtgaactggg------gccgga---------------tc
A0A3B4A3G8_BCL2-01      tccgcgatggagtgaactggg------gcagga---------------tt
A0A3Q3B0R2_BCL2-01      tccgggacggcgtcaactggg------gccgca---------------tc
A0A8C7ZK61_BCL2-01      tccgggacggcgtgaactggg------gccgga---------------tt
A0A3P8WUE9_BCL2-01      tccgggacggcgtgaactggg------gccgga---------------tt
A0A665U7Y7_BCL2-01      tccgggacggagtgaactggg------gccgga---------------tt
A0A672HHE5_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q3G1D7_BCL2-01      ttcgggacggggtgaactggg------gccgga---------------tt
A0A8C2X310_BCL2-06      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q3MEY1_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A2U9BJ09_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A8C9ZFJ5_BCL2-09      tccgggacggggtgaactggg------gccgga---------------tt
A0A7N6A4C8_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q0S5Z7_BCL2-01      tccgggacggagtgaactggg------gccgga---------------tt
A0A668TEB6_BCL2-05      tccgggacggagtgaactggg------gccgga---------------tt
A0A3P8QVM8_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3P9DIG5_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q2UYW8_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3B4G3K4_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A4W6DDI0_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A1X9JZA1_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3B4TX71_BCL2-01      tccgggacggggtgaattggg------gccgga---------------tt
A0A3B4YAG2_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3B5BBQ0_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q1B8C3_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3P8S9L3_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A3Q1FLK7_BCL2-01      tccgggacggggtgaactggg------gccgga---------------tt
A0A673LV42_BCL2-01      tcggggacggcgtgaactggg------gcagaa---------------tc
A0A8C1IQE4_BCL2-01      tcagggacggcgtgaactggg------gcagaa---------------tc
A0A672T179_BCL2-01      tcagggacggcgtgaactggg------gcagaa---------------tc
A0A3B3TCS4_BCL2-01      tcagcgatggcgtgaactggg------gccgta---------------tt
A0A8C9T5U7_BCL2-01      tcagcgacggcgtgaactggg------ggcgca---------------tc
W5N4F7_BCL2-01          ttcgggacggagtcaactggg------ggcgga---------------tt
H9GPE7_BCL2-01          tccaggacggtgtgaactggg------ggagga---------------tt
A0A8D2Q1J0_BCL2-01      ccagatacagacacccctggctatgcagaagaaaataagcataaggtttt
A0A8D2Q1J0_BCL2-03      ccagatacagacacccctggctatgcagaagaaaataagcataaggtttt
A0A668TEB6_BCL2-01      cctgacactgacactccaggactggctgaagagaacaagacaaaacctct
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      cctgacactgacactccaggactggctgaagagaacaagacaaaacctct
A0A668TEB6_BCL2-03      cctgacactgacactccaggactggctgaagagaacaagacaaaacctct
A0A3Q3MEY1_BCL2-02      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-04      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-05      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-07      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-09      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-03      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A3Q3MEY1_BCL2-06      ccagacacagacactccaggattggctgaggaaaataagacaaagcctct
A0A7N6A4C8_BCL2-02      cccgacactgacactccaggtttggctgaggaaaataagacaaagcctct
A0A7N6A4C8_BCL2-04      cccgacactgacactccaggtttggctgaggaaaataagacaaagcctct
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      cccgacactgacactccaggtttggctgaggaaaataagacaaagcctct
A0A7N6A4C8_BCL2-03      cccgacactgacactccaggtttggctgaggaaaataagacaaagcctct
A0A7N6A4C8_BCL2-06      cccgacactgacactccaggtttggctgaggaaaataagacaaagcctct
A0A8C2X310_BCL2-01      cctgacactgacactccaggattggctgaggaaaacaagaccaagcctct
A0A8C2X310_BCL2-02      cctgacactgacactccaggattggctgaggaaaacaagaccaagcctct
A0A8C2X310_BCL2-04      cctgacactgacactccaggattggctgaggaaaacaagaccaagcctct
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      cctgacactgacactccaggattggctgaggaaaacaagaccaagcctct
A0A8C9ZFJ5_BCL2-01      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-05      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-03      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-04      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-07      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A8C9ZFJ5_BCL2-08      cctgacactgagactccaggattagctgaggaaaataagacaaagcctct
A0A674GNG3_BCL2-02      ccagatactgatactcctggctttgcagaagaaagtaaaacaaagccctt
A0A674GNG3_BCL2-04      ccagatactgatactcctggctttgcagaagaaagtaaaacaaagccctt
A0A8C5IH35_BCL2-01      ccagatactgatactcctggctttgcagaagaaagtaaaacaaagccctt
A0A8C5IH35_BCL2-02      ccagatactgatactcctggctttgcagaagaaagtaaaacaaagccctt
A0A670IB81_BCL2-01      tccgagacggggtgaactggg------ggagga---------------tt
A0A8D0BPX3_BCL2-01      tccgagatgggataaactggg------gcagga---------------tt
A0A8D2Q1J0_BCL2-02      tccgtgatgggatcaattggg------gcagga---------------tt
A0A8C5S4J3_BCL2-01      tccgagatggagtaaattggg------gaagga---------------tt
A0A670ZV01_BCL2-01      tccgagatggagtaaattggg------gaagga---------------tt
A0A8D0L5Z6_BCL2-01      tccgagatggggttaactggg------ggagga---------------tc
A0A7M4EPU7_BCL2-01      tccgagatggagtgaactggg------gaagaa---------------tt
A0A7M4G2E0_BCL2-03      tccgagacggagtgaactggg------ggagaa---------------tt
A0A8C8SWU7_BCL2-01      tccgtgatggggttaactggg------gcagga---------------tc
K7F5Y3_BCL2-02          tccgagatgggattaactggg------gaagga---------------tc
K7F5Y3_BCL2-01          tccgagatgggattaactggg------gaagga---------------tc
K7F5Y3_BCL2-03          tccgagatgggattaactggg------gaagga---------------tc
A0A452I9V7_BCL2-01      tccgagatggggttaactggg------gaagga---------------tc
A0A8C3SV21_BCL2-01      tccgagatggagttaactggg------gaagga---------------tc
A0A8C3ITE1_BCL2-01      tccgagatggggttaactggg------gaagga---------------tc
A0A674IMR0_BCL2-01      tccgagatggggttaactggg------gaagga---------------tc
A0A8C0G2Q6_BCL2-01      tccgagatggggttaactggg------gaagga---------------tc
A0A8C4VT25_BCL2-01      tccgagatggggttaactggg------gaagga---------------tc
A0A7N4PQN7_BCL2-01      tcagggatggggtgaactggg------ggcgga---------------tt
F6YNL8_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tc
A0A4X2L5Q0_BCL2-01      tcagggatggggtgaactggg------ggcgga---------------tc
A0A8C2U1A2_BCL2-01      tccgtgatggggtcaactggg------gccgga---------------tt
A0A8C9L7I6_BCL2-01      tccgtgatggggtcaactggg------gccgga---------------tc
G1MZW1_BCL2-01          tccgtgatggggtcaattggg------gccgga---------------tc
A0A8C3LBC4_BCL2-01      tccgtgatggggtcaactggg------gtcgga---------------tc
A0A669PDH6_BCL2-01      tccgtgatggggtcaactggg------gccgga---------------tc
A0A8C9MG30_BCL2-01      tccgagatggggttaactggg------gcagaa---------------tt
A0A663MPN9_BCL2-01      tccgagacggggttaactggg------gcagga---------------tt
A0A8C6ZF48_BCL2-01      tccgagatggcgtcaactggg------ggagga---------------tc
A0A8B9PRT7_BCL2-01      tccgagacggggtcaactggg------ggagaa---------------tc
A0A8B9PRT7_BCL2-02      tccgagacggggtcaactggg------ggagaa---------------tc
A0A8C0UAC7_BCL2-01      tccgagacggggttaactggg------gcagaa---------------tt
A0A8B9UYC3_BCL2-01      tccgagacggggtgaactggg------gccgca---------------tc
A0A8B9E2U6_BCL2-01      tccgagacggggtgaactggg------gccgga---------------tc
A0A8B9C4H4_BCL2-01      tccgagacggggtgaactggg------gccgga---------------tc
A0A8C3CIW8_BCL2-01      tccgagacggggtgaactggg------gccgga---------------tc
A0A493T1X3_BCL2-01      tccgagacggggtgaactggg------gccgga---------------tc
A0A8B9SFH3_BCL2-01      tccgagacggggtgaactggg------gccgga---------------tc
A0A8D2P664_BCL2-01      nnnnnnnnngggttaactggg------gcagaa---------------tt
A0A674GNG3_BCL2-01      tccgagatggggttaactggg------gcagaa---------------tt
A0A674GNG3_BCL2-03      tccgagatggggttaactggg------gcagaa---------------tt
A0A8C5TLV4_BCL2-01      tccgagatggggttaactggg------gcagaa---------------tt
A0A672TR23_BCL2-01      tccgagacggggttaactggg------gcagga---------------tc
A0A8C3JHE5_BCL2-01      tccgagacggggttaactggg------gcagga---------------tc
A0A8C0BN28_BCL2-01      tccgagacggcgtcaactggg------gcagga---------------tc
A0A8B9RWH9_BCL2-01      tccgagacggcgtcaactggg------gcagga---------------tc
A0A663FHR0_BCL2-01      tccgagacggcgttaactggg------gcagga---------------tc
A0A8C8ANG9_BCL2-01      tccgagacggggttaactggg------gcagga---------------tc
A0A8C0IE77_BCL2-01      tccgagacggggttaactggg------gcagga---------------tt
A0A8D0G0L7_BCL2-01      tccgagacggggttaactggg------gcagga---------------tt
A0A8C4U538_BCL2-01      tccgagatggggttaactggg------gcagga---------------tt
A0A8C4U538_BCL2-02      tccgagatggggttaactggg------gcagga---------------tt
A0A8C3TNF2_BCL2-01      tccgagatggggttaactggg------gcagaa---------------tt
A0A8C3QX54_BCL2-01      tccgagatggggttaactggg------gcagaa---------------tt
A0A803VR88_BCL2-01      tccgagacggggttaactggg------gcagaa---------------tc
A0A803VR88_BCL2-02      tccgagacggggttaactggg------gcagaa---------------tc
A0A8C5IH35_BCL2-05      tccgcgatggggttaactggg------gcagga---------------tt
A0A8C5IH35_BCL2-04      tccgcgatggggttaactggg------gcagga---------------tt
A0A8C5IH35_BCL2-03      tccgcgatggggttaactggg------gcagga---------------tt
A0A8D2N8C6_BCL2-01      tccgagatggggttaactggg------gcagga---------------tt
A0A8D0QLD9_BCL2-07      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A4X1TRR9_BCL2-06      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A8D0QLD9_BCL2-05      -------------------------------------------agccttt
A0A4X1TRR9_BCL2-05      -------------------------------------------agccttt
A0A8D0QLD9_BCL2-04      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A4X1TRR9_BCL2-07      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A8D0QLD9_BCL2-06      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A4X1TRR9_BCL2-04      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A4X1TRR9_BCL2-02      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A8D0QLD9_BCL2-02      ccagacacagacacccctgggtttgccgaagaaaacaaaaccaagccttt
A0A8C6RID6_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C6RID6_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tt
Q6R755_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tc
Q923R6_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8C8U7I9_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
Q6NTH7_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8C6H5J8_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
Q7TSN8_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8I6AJ02_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
P49950_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A4W2DSR6_BCL2-02      tcagggacggggtgaactggg------ggcgca---------------tc
A0A4W2DSR6_BCL2-02      tcagggacggggtgaactggg------ggcgca---------------tc
A0A8C6CUJ2_BCL2-01      tcagggacggcgtgaactggg------ggcgca---------------tc
A0A4W2DSR6_BCL2-01      tcagggacggggtgaactggg------ggcgca---------------tc
A0A4W2DSR6_BCL2-01      tcagggacggggtgaactggg------ggcgca---------------tc
F6R2C4_BCL2-01          tcagggacggggtgaactggg------ggcgca---------------tc
O02718_BCL2-01          tcagggacggggtgaactggg------ggcgca---------------tc
A0A076FU27_BCL2-01      tcagggacggggtgaactggg------ggcgca---------------tc
A0A076FZV9_BCL2-01      tcagggacggggtgaactggg------ggcgca---------------tc
A0A452EV13_BCL2-01      tcagggacggggtgaactggg------ggcgca---------------tc
A0A8C5JYS0_BCL2-01      tccgggacggggtgaactggg------ggcgga---------------tc
G3SLZ1_BCL2-01          tcagggacggggtgaactggg------ggcgga---------------tt
G3SLZ1_BCL2-02          tcagggacggggtgaactggg------ggcgga---------------tt
H0W1T3_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A5F9CRQ4_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A5F9CRQ4_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tt
M3YYK3_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8D2AUF5_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
I3MVK9_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8C5YTS1_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8D2IIB8_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A250YD83_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A452T603_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C2VKS3_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C9HUK6_BCL2-02      tcagggacggggtgaactggg------ggagga---------------tt
A0A2K5EB04_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2K6UEL3_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2R8MY14_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2K6R2I5_BCL2-02      tcagggacggggtgaactggg------ggagga---------------tt
A0A2K5HK49_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-04      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-10      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-05      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-08      tcagggacggggtgaactggg------ggagga---------------tt
A0A7N9CNB8_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A8D2EFR4_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A2K5XRD4_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A2K5NZS5_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A0D9S017_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A5F7ZZ15_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A2K6CIX3_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A096MPU7_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tc
A0A7I2V3S7_BCL2-03      --------------------------------------------------
A9QXG9_BCL2-01          tcagggacggggtgaactggg------ggagga---------------tt
A0A2K6KHG1_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2K6R2I5_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2J8W3J1_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A8C9HUK6_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A2I3GZF9_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-06      tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-07      tcagggacggggtgaactggg------ggagga---------------tt
A0A2R9APW6_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
G3QES9_BCL2-01          tcagggacggggtgaactggg------ggagga---------------tt
A0A7I2V3S7_BCL2-09      --------------------------------------------------
H0WKI0_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tc
A0A8B7H1C6_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C9AC52_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A2K6G3I7_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A3Q2HRY3_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C4L1K6_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A3Q2HRY3_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A673VDM8_BCL2-01      tcagggacggggtgaactggg------ggagga---------------tt
A0A5F5Y6Y3_BCL2-02      tcagggatggagtgaactggg------ggagga---------------tt
A0A8C9J3W6_BCL2-01      tcagggatggagtgaactggg------ggagga---------------tt
Q8I008_BCL2-01          tcagggatggcgtgaactggg------ggagga---------------tt
A0A667GHH0_BCL2-01      tcagggatggagtgaactggg------ggagga---------------tt
A0A5F5Y6Y3_BCL2-01      tcagggatggagtgaactggg------ggagga---------------tt
A0A8C8XJU8_BCL2-01      tcagggatggagtgaactggg------ggagga---------------tt
A0A8C7B9K2_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
G1LIC9_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A452R110_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A452R110_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C0NC28_BCL2-03      tcagggatggggtgaactggg------ggagga---------------tc
A0A8I3MLT5_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tc
A0A8C0NC28_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tc
Q75SV7_BCL2-01          tcagggatggggtgaactggg------ggagga---------------tt
A0A8C0KWE3_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tc
A0A8C0NC28_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tc
A0A8I3MLT5_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tc
A0A8C6AXM8_BCL2-01      tcagggatggagtaaactggg------ggagga---------------tc
A0A8C9CJ69_BCL2-01      tcagggatggagtaaactggg------ggagga---------------tc
A0A8B8V3A7_BCL2-02      tcagggatggggtgaactggg------ggagga---------------tt
A0A8B8V3A7_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8B8V3A7_BCL2-03      tcagggatggggtgaactggg------ggagga---------------tt
A0A8C3WCN0_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8D0QLD9_BCL2-03      tcagggatggggtgaactggg------ggagga---------------tt
A0A4X1TRR9_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A8D0QLD9_BCL2-01      tcagggatggggtgaactggg------ggagga---------------tt
A0A4X1TRR9_BCL2-03      tcagggatggggtgaactggg------ggagga---------------tt
                                                                          

A3KNH9_BCL2-01          attgcattcttcgagtttggtgggaccatgtgcgtggaaagc-------g
Q564A4_BCL2-01          attgcattcttcgagtttggtgggaccatgtgcgtggaaagc-------g
X4ZGI8_BCL2-01          gtcgctttctttgagtttggtgggaccatgtgtgtggagagc-------t
A0A673HVU7_BCL2-01      atcgctttctttgagtttggtgggaccatgtgtgtggagagc-------g
A0A4W4F7Z4_BCL2-01      attgcgtttttcgagttcggagcgtcggtgtgtgtagaatgt-------g
B9ZYL7_BCL2-01          gttgcttttttcgagtttggtggggtcatgtgcgtggagatt-------g
A0A8C5MT36_BCL2-03      gtggctttctttgagtttggaggtgtcatgtgcgtggagagt-------g
A0A8C5MT36_BCL2-01      gtggctttctttgagtttggaggtgtcatgtgcgtggagagt-------g
A0A8C5MT36_BCL2-02      gtggctttctttgagtttggaggtgtcatgtgcgtggagagt-------g
A0A8C5MT36_BCL2-04      gtggctttctttgagtttggaggtgtcatgtgcgtggagagt-------g
A0A7M4G2E0_BCL2-01      gttgctgtctttg-gtattgtggctgcctgtttgt--------------a
A0A7M4G2E0_BCL2-02      gttgctgtctttg-gtattgtggctgcctgtttgt--------------a
A0A673Z0A3_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A8C7CHJ0_BCL2-01      gtggctttctttgaatttggagggacaatgtgcgtggagagc-------g
A0A8C7Q7B4_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A0U3DHY6_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A4W5NW18_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A674B8T7_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A8C7RG50_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A8C8GL24_BCL2-01      gtggctttctttgagtttggagggacaatgtgcgtggagagc-------g
A0A6Q2YIU6_BCL2-01      atcgctttcttcgagttcgggggcacaatatgcgtggaatgc----gtga
A0A4W5KV00_BCL2-01      atcgccttcttcgagttcgggggcacaatatgcgtggaatgc----gtga
A0A8C7G8X1_BCL2-01      atcgccttcttcgagttcgggggcacaatatgcgtggaatgc----gtga
A0A674B0E5_BCL2-01      atcgccttcttcgagttcgggggcacaatatgcgtggaatgc----gtga
A0A8C8JWJ1_BCL2-02      gtagccttcttcgagttcggtggcacaatatgtgtggaatgc----gtga
A0A8C7N3I9_BCL2-01      gtcgccttcttcgagttcggtggcacaatatgtgtggaatgc----gtga
A0A8C8JWJ1_BCL2-01      gtagccttcttcgagttcggtggcacaatatgtgtggaatgc----gtga
A0A8C5C4C3_BCL2-01      atcgcatttttcgagttcgggggtacagtgtgcgtggagtgcgccggcgg
A0A3B4A3G8_BCL2-01      attgcgtttttcgagtttggtggaaccgtgtgcgtggagtgc----gcgt
A0A3Q3B0R2_BCL2-01      attgccttcttcgagttcggcggcacggtgtgcgtggagtgc----gcgt
A0A8C7ZK61_BCL2-01      atcgcgttcttcgagttcgggggcacggtgtgcgtggagtgc----gcgt
A0A3P8WUE9_BCL2-01      atcgccttcttcgagtttggaggcgtcgtgtgtgtggagtgt----gcgg
A0A665U7Y7_BCL2-01      atcgccttcttcgagttcgggggggccgtgtgcgtcgagtgc----gcgg
A0A672HHE5_BCL2-01      atcgccttcttcgagttcggtggcacggtgtgcgtggagtgc----gtgt
A0A3Q3G1D7_BCL2-01      atcgcctttttcgagttcgggggcacggtgtgcgtggagtgc----atgt
A0A8C2X310_BCL2-06      atcgcgttcttcgagttcgggggcacggtgtgcgcggagtgc----gccg
A0A3Q3MEY1_BCL2-01      atcgctttcttcgagttcggcggcaccgtgtgcgtggagtgc----gcgg
A0A2U9BJ09_BCL2-01      atcgcgttcttcgagttcgggggcaccgtgtgcgtggagtgc----gccg
A0A8C9ZFJ5_BCL2-09      atcgctttcttcgagttcgggggcacggtgtgcgtggagtgc----gccg
A0A7N6A4C8_BCL2-01      atcgctttcttcgagttcggcggcaccgtgtgcgtggagtgc----gcgt
A0A3Q0S5Z7_BCL2-01      attgctttcttcgagtttgggggcacggtgtgcgtggagtgc----gctt
A0A668TEB6_BCL2-05      attgctttcttcgagtttgggggcacggtgtgcgtggaatgc----gctt
A0A3P8QVM8_BCL2-01      attgctttcttcgagtttgggggcactgtgtgcgtggagtgc----gctt
A0A3P9DIG5_BCL2-01      attgctttcttcgagtttgggggcactgtgtgcgtggagtgc----gctt
A0A3Q2UYW8_BCL2-01      attgctttcttcgagtttgggggcactgtgtgcgtggagtgc----gctt
A0A3B4G3K4_BCL2-01      attgctttcttcgagtttgggggcactgtgtgcgtggagtgc----gctt
A0A4W6DDI0_BCL2-01      atcgcattcttcgagttcgggggcaccgtgtgcgtggagtgc----gcgg
A0A1X9JZA1_BCL2-01      atcgctttcttcgagttcgggggcacggtgtgcgtggagtgc----gtgg
A0A3B4TX71_BCL2-01      atcgctttcttcgagttcgggggcacggtgtgcgttgagtgc----gcgg
A0A3B4YAG2_BCL2-01      atcgctttcttcgagttcgggggcacggtgtgcgttgagtgc----gcgg
A0A3B5BBQ0_BCL2-01      atcgctttcttcgagttcgggggaaccgtgtgcgtcgagtgc----gcgg
A0A3Q1B8C3_BCL2-01      atcgctttcttcgagttcggggggacggtgtgcgtcgagtgc----gcgg
A0A3P8S9L3_BCL2-01      atcgctttcttcgagttcggggggacggtgtgcgtcgagtgc----gcgg
A0A3Q1FLK7_BCL2-01      atcgctttcttcgagttcggggggacggtgtgcgtcgagtgc----gcgg
A0A673LV42_BCL2-01      atcgcttttttcgagtttggagggactgtttgtgtcgaatgc-------g
A0A8C1IQE4_BCL2-01      atcgcttttttcgagtttggagggaccgtttgtgtcgaatgc-------g
A0A672T179_BCL2-01      atcgcttttttcgagtttggagggaccgtttgcgtcgaatgc-------g
A0A3B3TCS4_BCL2-01      gtggcgtttctcgagttcggcggcaccatgtgcgtggagagt-------g
A0A8C9T5U7_BCL2-01      gtggcctttttcgagttcgggggcaccatgtgcgtggagagc-------g
W5N4F7_BCL2-01          gtcgctttcttcgagttcggcgggacgatgtgcgtggagagc-------g
H9GPE7_BCL2-01          gtggcgttctttgaatttggtggcatgctgtgcgtggagagt-------g
A0A8D2Q1J0_BCL2-01      agagaccaagcttatttcagaagcatcatcaatct--------------g
A0A8D2Q1J0_BCL2-03      agagaccaagcttatttcagaagcatcatcaatct--------------g
A0A668TEB6_BCL2-01      ggagaccaaattaatctctgaaacctc-------tggagttt-------g
A0A668TEB6_BCL2-04      --------------------------------------------------
A0A668TEB6_BCL2-02      ggagaccaaattaatctctgaaacctc-------tggagttt-------g
A0A668TEB6_BCL2-03      ggagaccaaattaatctctgaaacctc-------tggagttt-------g
A0A3Q3MEY1_BCL2-02      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-10      --------------------------------------------------
A0A3Q3MEY1_BCL2-08      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-04      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-05      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-07      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-09      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-03      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A3Q3MEY1_BCL2-06      agagaccaaattaatctctgaaacatc-------tggcgttt-------g
A0A7N6A4C8_BCL2-02      ggagaccaaattaatctctgaaacatc-------tggagtct-------g
A0A7N6A4C8_BCL2-04      ggagaccaaattaatctctgaaacatc-------tggagtct-------g
A0A7N6A4C8_BCL2-07      --------------------------------------------------
A0A7N6A4C8_BCL2-05      ggagaccaaattaatctctgaaacatc-------tggagtct-------g
A0A7N6A4C8_BCL2-03      ggagaccaaattaatctctgaaacatc-------tggagtct-------g
A0A7N6A4C8_BCL2-06      ggagaccaaattaatctctgaaacatc-------tggagtct-------g
A0A8C2X310_BCL2-01      ggagaccaaattaatctctgaaacctc-------aggagttt-------g
A0A8C2X310_BCL2-02      ggagaccaaattaatctctgaaacctc-------aggagttt-------g
A0A8C2X310_BCL2-04      ggagaccaaattaatctctgaaacctc-------aggagttt-------g
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      ggagaccaaattaatctctgaaacctc-------aggagttt-------g
A0A8C9ZFJ5_BCL2-01      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-05      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-03      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-04      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-07      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A8C9ZFJ5_BCL2-08      agagactaaattaatctctgaaacttc-------tggagttt-------g
A0A674GNG3_BCL2-02      agagacgaagctaatttctgagacctcatctgttt--------------g
A0A674GNG3_BCL2-04      agagacgaagctaatttctgagacctcatctgttt--------------g
A0A8C5IH35_BCL2-01      agagacgaagctgatttctgaaacctcatctgttt--------------g
A0A8C5IH35_BCL2-02      agagacgaagctgatttctgaaacctcatctgttt--------------g
A0A670IB81_BCL2-01      gtggcgttctttgagttcggtggcatgatgtgcgtggagagc-------g
A0A8D0BPX3_BCL2-01      gtggcattctttgaatttggtggcatgatgtgtgtggagagc-------g
A0A8D2Q1J0_BCL2-02      gtagcgttctttgaattcggtggcatgctgagcgtggagagt-------g
A0A8C5S4J3_BCL2-01      gtggcattctttgaatttggtggcatgctgtgtgtggaaagt-------g
A0A670ZV01_BCL2-01      gtggcattctttgaatttggtggcatgctgtgtgtggaaagt-------g
A0A8D0L5Z6_BCL2-01      gtggccttccttgaatttggtggcatgatgtgtgtggagagt-------g
A0A7M4EPU7_BCL2-01      gtagccttctttgggttcggtggcgtgatgtgcgtggagaat-------g
A0A7M4G2E0_BCL2-03      gtggccttctttgagttcggtggcgtgatgtgcgtggagagt-------g
A0A8C8SWU7_BCL2-01      gtggccttcttcgaatttggtggtgtgatgtgtgtggagagc-------g
K7F5Y3_BCL2-02          gtggccttctttgaatttggtggcgtgatgtgtgtggagagt-------g
K7F5Y3_BCL2-01          gtggccttctttgaatttggtggcgtgatgtgtgtggagagt-------g
K7F5Y3_BCL2-03          gtggccttctttgaatttggtggcgtgatgtgtgtggagagt-------g
A0A452I9V7_BCL2-01      gtggccttctttgaatttggtggtgtgatgtgtgtggagagc-------g
A0A8C3SV21_BCL2-01      gtggccttctttgaatttggtggcgtgatgtgcgtggagagc-------g
A0A8C3ITE1_BCL2-01      gtggccttctttgaattcggtggcgtgatgtgcgtggagagc-------g
A0A674IMR0_BCL2-01      gtggccttctttgaattcggtggcgtgatgtgcgtggagagt-------g
A0A8C0G2Q6_BCL2-01      gtggccttctttgaatttggtggtgtgatgtgcgtggagagc-------g
A0A8C4VT25_BCL2-01      gtggccttctttgaatttggtggtgtgatgtgtgtggagagc-------g
A0A7N4PQN7_BCL2-01      gtggccttctttgaatttggtggtgttatgtgtgtggagagc-------g
F6YNL8_BCL2-01          gtggccttctttgagtttggtggtgttatgtgtgtggagagc-------g
A0A4X2L5Q0_BCL2-01      gtggccttctttgaatttggtggtgtcatgtgtgtggagagc-------g
A0A8C2U1A2_BCL2-01      gtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagc-------g
A0A8C9L7I6_BCL2-01      gtcgccttcttcgagttcggcggcgtgatgtgcgtcgagagc-------g
G1MZW1_BCL2-01          gtcgccttctttgagttcggcggcgtgatgtgcgtcgagagc-------g
A0A8C3LBC4_BCL2-01      gtcgccttctttgagttcggtggcgtgatgtgcgtcgagagc-------g
A0A669PDH6_BCL2-01      gtcgccttcttcgagttcggcggtgtgatgtgcgtcgagagc-------g
A0A8C9MG30_BCL2-01      gtggccttcttcgagtttggcggtgtgatgtgcgtggagagc-------g
A0A663MPN9_BCL2-01      gtggccttcttcgagtttggcggcgtgatgtgtgtggagagc-------g
A0A8C6ZF48_BCL2-01      gtggccttcttcgagttcggcggcgtcatgtgcgtggagagc-------g
A0A8B9PRT7_BCL2-01      gtggccttcttcgagttcggcagcgtcatgtgcgtggagagc-------g
A0A8B9PRT7_BCL2-02      gtggccttcttcgagttcggcagcgtcatgtgcgtggagagc-------g
A0A8C0UAC7_BCL2-01      gtggccttcttcgagtttggcggtgtgatgtgtgtggagagc-------g
A0A8B9UYC3_BCL2-01      gtggccttcttcgagttcggcggcgtcatgtgcgtggagagc-------g
A0A8B9E2U6_BCL2-01      gtggccttcttcgagttcggcggcgtgatgtgcgtcgagagc-------g
A0A8B9C4H4_BCL2-01      gtggccttcttcgagttcggcggcgtgatgtgcgtcgagagc-------g
A0A8C3CIW8_BCL2-01      gtggccttcttcgagttcggcggcgtcatgtgcgtggagagc-------g
A0A493T1X3_BCL2-01      gtggccttcttcgagttcggcggcgtcatgtgcgtggagagc-------g
A0A8B9SFH3_BCL2-01      gtggccttcttcgagttcggcggcgtcatgtgcgtggagagt-------g
A0A8D2P664_BCL2-01      gtggccttcttcgagtttggcggtgtcatgtgtg