Dataset for CDS BCL2L1 of organism Gasterosteus aculeatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3NJY1_BCL2L1-01      atgtctcaa---aacagagaactggtggttttctacataaactataaact
G3P7B4_BCL2L1-01      atggcgaacattaacagggagctggtggagttcttcctaagctacaagct
                      *** *  *    ***** ** *******  **** * *** *** ** **

G3NJY1_BCL2L1-01      ctcccagaggaacttacccctcaaccacatagggctgtccgagcctccca
G3P7B4_BCL2L1-01      gtctcagaaga----accacccaacctc-----tctgttgaggcc-----
                       ** **** **    *** * ***** *      ****    ***     

G3NJY1_BCL2L1-01      acagga--ctggcgggggggtagaggcaggggcggctgg-tgggcagcgg
G3P7B4_BCL2L1-01      ggaggatgccggcggaaggacggagggagacaaggccaactcggcgtc--
                        ****  * *****  **   **** **    ***    * ***  *  

G3NJY1_BCL2L1-01      ggagcgacgcactccaacgggactttcaacggcacgagtcccgggacccc
G3P7B4_BCL2L1-01      -------cgttcctggacg----------cgggagcagcgccggccagcc
                             **  *    ***          *** *  **  ****    **

G3NJY1_BCL2L1-01      gccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagcctgg
G3P7B4_BCL2L1-01      ggggatgtcgtcgccaccgccgccaccgt--ccggtgacaccgag-----
                      *  *  ***  ***  *  * ** ** **  ***  ***  ****     

G3NJY1_BCL2L1-01      atgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcga
G3P7B4_BCL2L1-01      --gccgtaaaggcagctcttcaggactctgcgaatgagtttgagctgctc
                        ** ** ****  ** ** * ****** ** ** ***** *******  

G3NJY1_BCL2L1-01      tacgctcgggccttcagcgatctgcacaaccagctgcacatcacgccggc
G3P7B4_BCL2L1-01      ttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccga
                      * * * *  ** ***** ** **   *   *****  ** **** ** * 

G3NJY1_BCL2L1-01      cacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacg
G3P7B4_BCL2L1-01      cacggcctaccacagcttcaagagcgtgatggacgaggtgttcaaggatg
                      ************ ****** **  *******************  *** *

G3NJY1_BCL2L1-01      gcgtcaactggggccgcatcgtggggctgttcgccttcggcggggcgctg
G3P7B4_BCL2L1-01      gcgtcaactggggccgcgtggtgggcctgtttgccttcggcggcgtgctc
                      ***************** * ***** ***** *********** * *** 

G3NJY1_BCL2L1-01      tgcgtggagtgcgtggacaaggagatgagtccgctggtgggcaggatcgt
G3P7B4_BCL2L1-01      tgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgc
                      ************** ** ***** ****    *******  * * **** 

G3NJY1_BCL2L1-01      cgagtggatgacgctctacctggacaaccacattcagccctggatccaga
G3P7B4_BCL2L1-01      ggactggatgaccacgtacctggacgagcacatcagtgcttggatccaga
                       ** ********    ********* * *****     * **********

G3NJY1_BCL2L1-01      accagggaggctggcgtt------cagacatt------------------
G3P7B4_BCL2L1-01      gccagggaggatgggactgttttgctgacattttcgggcgggacggcgcg
                       ********* ***   *      * ******                  

G3NJY1_BCL2L1-01      --------------------------------------------------
G3P7B4_BCL2L1-01      gcagcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcgg

G3NJY1_BCL2L1-01      --------------------------------------------------
G3P7B4_BCL2L1-01      ggtggcgctgctaatgggagtgctcgtcggtatggtcatggtcaagaagc

G3NJY1_BCL2L1-01      --tga
G3P7B4_BCL2L1-01      ggtga

© 1998-2022Legal notice