Dataset for CDS BCL-2-like of organism Meleagris gallopavo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1N8C5_BCL2A1-01      atgga-----------------------------------aactgctgag
G1MPY7_MCL1-01        atgga---------------------------------------ggtggg
G1MZW1_BCL2-01        atggctcaccccgggagaagaggctacgacaaccgcgagatagtgctgaa
G1N5N5_BCL2L1-01      atgtc------------------cagcagtaaccgggagttagtgattga
                      ***                                         * *   

G1N8C5_BCL2A1-01      ttctattatgtttattatttagctcaaga---------------------
G1MPY7_MCL1-01        gtccctgctctgctcattct-gtggcagggcc------------------
G1MZW1_BCL2-01        gtacatccactataaactctcgcagcggggctacgactgggcc--gccgg
G1N5N5_BCL2L1-01      ctttgtttcctacaagctctcgcagaaggggcactgctggagcgagctgg
                       *   *    *      * * *     *                      

G1N8C5_BCL2A1-01      --------------------------------------------------
G1MPY7_MCL1-01        ----------------------------tgcagcag--------------
G1MZW1_BCL2-01        ----------cgaggacagg-ccacccgtgcccc-----------cggcc
G1N5N5_BCL2L1-01      aggaagaggatgagaacaggactgacactgcagcagaggcagagatggac
                                                                        

G1N8C5_BCL2A1-01      ------------------------------ttatctgc------------
G1MPY7_MCL1-01        -------------------------------cagctgctctgtcacagct
G1MZW1_BCL2-01        ctggctcccactg-----ctgctcccgctccccccggctcggctgctgct
G1N5N5_BCL2L1-01      agcgtcctcaatgggagcccatcctggcacccgcctgc-cggccacg--t
                                                        * **            

G1N8C5_BCL2A1-01      ----aatatgtccttcaggaatcacgtcttggacc---agcccaaa----
G1MPY7_MCL1-01        ------ttcagaccccaggtacagaggctgtgtcc----tctca------
G1MZW1_BCL2-01        agtga--ggtgccccca-gctgaggggctgcgccccgcacctc-------
G1N5N5_BCL2L1-01      agtgaatggagccgccgtgcacaggagc--agcctggaagttcatgaaat
                                  *  *  *        *   * *        *       

G1N8C5_BCL2A1-01      -----------ccagagttgctcatgtcttgcgaaatat------tgcat
G1MPY7_MCL1-01        -----------ctggtg--------------------gcttggcatggct
G1MZW1_BCL2-01        -----------ccggcgtccacctcgccctgcgccaggccggggatgagt
G1N5N5_BCL2L1-01      tgttcgagcatctgacgtgaggcagacgctgagagatgcaggggatgagt
                                 *    *                            **  *

G1N8C5_BCL2A1-01      cctcactccaaga--tcagacagaggaggcactcagacccttcttggaca
G1MPY7_MCL1-01        cagcccgtctctaagctgga------atctcttttcaggaatgcttcgga
G1MZW1_BCL2-01        tctcgcgccgcta--ccaga------gggactttgcccagatgtcgggcc
G1N5N5_BCL2L1-01      ttgagctgaggta--ccgga------gggctttcagcgatctcacctccc
                           *      *     **            *        *        

G1N8C5_BCL2A1-01      ggatcgatatcacctctgtagatg-ttgccaagagaattttcaatggagt
G1MPY7_MCL1-01        agctggaaatcaaaaaagaagaagatctgcaggcg---gtgtgtg-aggt
G1MZW1_BCL2-01        agctgcacctgacgcccttcacag-cccacggccg---cttcgtggccgt
G1N5N5_BCL2L1-01      agctccacatcacccctggcacgg-cgtaccagag---ctttgagcaggt
                       * *  *  * *           *     *    *    *        **

G1N8C5_BCL2A1-01      catggaagaaaaatttgctgacggaaatactaactggggacgaattatga
G1MPY7_MCL1-01        ggctgctcacgttttcagtgatggagtaacaaactggggccgagttgtca
G1MZW1_BCL2-01        ggtggaggagcttttccgtgatggggt---caattggggccggatcgtcg
G1N5N5_BCL2L1-01      agtgaacgaactcttccatgatggtgt---gaactgggggcgcatcgtgg
                              *    **   *** **       ** ***** **  *  *  

G1N8C5_BCL2A1-01      ccatatttacttttgg--------aggtcttctcaccaagaagcttcaag
G1MPY7_MCL1-01        cactcatctcatttggtgccttcgttgcaaaacacctgaaaagcatcaac
G1MZW1_BCL2-01        ccttctttgagttcgg------cggcgtgatgtgcgtcgagagcgtcaac
G1N5N5_BCL2L1-01      ctttcttctccttcgg------aggggctttgtgcgtggagagcgtggac
                      *  *  *    ** **          *              *** *  * 

G1N8C5_BCL2A1-01      agcagggagt---tcagctcactggagaggagaaggagcagatttcttat
G1MPY7_MCL1-01        caagagaaatgcatcagctcgctggcggggatc--------atcacagac
G1MZW1_BCL2-01        cgggagatgt------cgccgctggtggacaac--------attgccacc
G1N5N5_BCL2L1-01      aaggagatgc------gggtactggtgggacgc--------attgtgtct
                           *               **** *              **       

G1N8C5_BCL2A1-01      ttcatcacagagtacatcataaataacaaagccgcatggatagatgcaaa
G1MPY7_MCL1-01        gctttggtctcatccaagcgcgagtggctga------tgagccag-----
G1MZW1_BCL2-01        tggatgaccgaatacctgaacaggcacctgcacaactggatccaggacaa
G1N5N5_BCL2L1-01      tggatgaccacgtacttgaccgaccatctagacccctggatccaggagaa
                          *       * *                       **   *      

G1N8C5_BCL2A1-01      cggtggctgggaaaatggtttcctaacaaagtttgaaa------------
G1MPY7_MCL1-01        -ggaggctggg---agggctttgtcgacttcttccg----agt-------
G1MZW1_BCL2-01        cggaggatggg---atgccttcgtggaattgtacggcaccagt-------
G1N5N5_BCL2L1-01      tggcggctggg---agcgctttgtggacctgtatgggaataatgctgctg
                       ** ** ****   *    **  *       *                  

G1N8C5_BCL2A1-01      -------------------gaagatcaccactatctttctctacaatt--
G1MPY7_MCL1-01        -------------------tgaggacctgga-aagcagcatcaggaatgt
G1MZW1_BCL2-01        ------------------atgaggcctttgtttgatttctcctggatctc
G1N5N5_BCL2L1-01      ccgagctgaggaagggccaggagaccttcaacaaatggctcctga----c
                                           **  *            *           

G1N8C5_BCL2A1-01      ----acagacatatttgcag-ctgttttttc-----------------ct
G1MPY7_MCL1-01        gctgatggcctttgcaggag--tggccggcctgggggcgag-------ct
G1MZW1_BCL2-01        tctgaagaccat--cctgagcctggttctggtgggagcttgcatcactct
G1N5N5_BCL2L1-01      cggggcgaccgtggccggag--tgcttctgctgggatc----------cc
                               * *      **  **                        * 

G1N8C5_BCL2A1-01      tg-----ttcagagactactactga
G1MPY7_MCL1-01        tg--gcctacatgatccg---gtga
G1MZW1_BCL2-01        tggcgcttatcttggacataagtag
G1N5N5_BCL2L1-01      tg--------ctgagccgcaagtga
                      **                    *  

© 1998-2022Legal notice