Dataset for CDS BAX-like of Organism Chrysemys picta bellii

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C3F4C0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Chrysemys picta bellii GN=BOK (length=642 residues).
atggaggtgctacgccgttcctcggtctttgctgcggaggtgatggaggtttttgatcggtctcccaccgacaaggagct
ggtgtcccaggctaaggtgctctgcagagactacatacattcccggctgctttgggctggcattggctggagcaaaccag
agcacagtgcacccatgcctggcggcagactggctgaggtgtccagcgtgcttctgcgactaggggacgagctggaatac
atccgaccaaatgtttaccggaatattgcccgccagctgaacatctcactgcactctgagaccgtggtgactgacgcctt
cttggcagtagcggcccagatcttcacggcaggcataacatggggcaaggtcgtgtctctctatgctgtggccgctgggc
tggctgtggactgcgtcagacaggcccagccagcaatggtgcatgccattgtggactgcctgggagagtttgtccgcaag
accttggtgacatggctgaagaggcgaggaggctgggaagacatcacaaaatgtgtggtgaatactgatcccagccttcg
ctcccattggcttgtggctgccatttgtagttttggtcacttcctgaaggccatcttctttgtgctgttaccagagagat
ga
>gnl|bcl2dbcds|A0A8C3HFY6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Chrysemys picta bellii GN=BAX (length=498 residues).
attggtggagctgggagagagccaaggactcctattgctgagccgggcagagctggggggccggagccccccccctgcga
cgagaacaccaagcggctcagcgagtgcctgcggcggatcggggacgagctcgacagcaacaccgaactgcagagtatga
ttgaccgggtgggggcccacgcccctaaggacgtcttcttccgcgtggccgccgagatgttctccgacgggaccttcaac
tggggccgggtcgtggcgcttttctactttgcctgcaagctggtgctcaaggctctgtgcaccaaggtccccgagctggt
gcggaccatcgtgggctggacgttggagtacctccgggatcatgtgctggcctggatccaggcccagggaggatgggatg
gcctcctctcctacttcggcacgcccacctggcaaaccatcaccatcttcgctgctggcgtgctcaccgcctccctcacc
atctggaagatgtcgtag
>gnl|bcl2dbcds|A0A8C3HFY6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Chrysemys picta bellii GN=BAX (length=507 residues).
catccgggaccgggcccagcgctgcggggactcccaggccgtggagctgagccgggcagagctggggggccggagccccc
cccctgcgacgagaacaccaagcggctcagcgagtgcctgcggcggatcggggacgagctcgacagcaacaccgaactgc
agagtatgattgaccgggtgggggcccacgcccctaaggacgtcttcttccgcgtggccgccgagatgttctccgacggg
accttcaactggggccgggtcgtggcgcttttctactttgcctgcaagctggtgctcaaggctctgtgcaccaaggtccc
cgagctggtgcggaccatcgtgggctggacgttggagtacctccgggatcatgtgctggcctggatccaggcccagggag
gatgggatggcctcctctcctacttcggcacgcccacctggcaaaccatcaccatcttcgctgctggcgtgctcaccgcc
tccctcaccatctggaagatgtcgtag
>gnl|bcl2dbcds|A0A8C3IM95_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BAK1 (length=654 residues).
atggcctctgggaacagcagcgacccaccagaccgtcatcggcacagggccagagaggggcgtagaccgtcgctgaggct
caattcagaagatcaggtggcccaggagaccgaggaggtgttccggagctatgccttctaccgctaccagcaggagaggg
aagagagtggaggggaggtgccgatggaccccgagattgcagagatccagcaggagccgggcagcaccagtaaccaggtg
ggcaggcgcctggctatcatcggagatgacatcaacatgcggtatgatgcagagtttcagaacatgctgaagaccctgca
gcccacgaaggacaatgcctatgagtacttcactaagatagcctccagcttgtttgacagtggcattaactggggcaggg
tgattgcgctgctggggttcggttaccggatggcgattcatgtgtaccagcacggggtgaccggcttcctccggagcatc
gctcgctacgtggcagaattcgtgctccgcaaccgcatcgcccagtggatcgccgaccaaggaggatgggtggcagcact
ggagctggataacgtttacgtgttgtacatgatgggggtgttggtcgtggtcctgctgggtcatttggtggtacgacgct
tcttcagcccgtga
>gnl|bcl2dbcds|A0A8C3IM95_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BAK1 (length=657 residues).
atgagaggggccgcacagtttccccagtgttataagagcatgaggataaggaggggtttccttactcctgcgcaccccag
aggagctgcctgcctgaccctgccaatcattgtctctccctcagaagatcaggtggcccaggagaccgaggaggtgttcc
ggagctatgccttctaccgctaccagcaggagagggaagagagtggaggggaggtgccgatggaccccgagattgcagag
atccagcaggagccgggcagcaccagtaaccaggtgggcaggcgcctggctatcatcggagatgacatcaacatgcggta
tgatgcagagtttcagaacatgctgaagaccctgcagcccacgaaggacaatgcctatgagtacttcactaagatagcct
ccagcttgtttgacagtggcattaactggggcagggtgattgcgctgctggggttcggttaccggatggcgattcatgtg
taccagcacggggtgaccggcttcctccggagcatcgctcgctacgtggcagaattcgtgctccgcaaccgcatcgccca
gtggatcgccgaccaaggaggatgggtaagtgagccgggctttttttctcggcagggcagctgggtcgggctaggggcag
cacgattcctcgcttag
© 1998-2023Legal notice