Dataset for CDS BCL2L1 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P53563_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
P53563_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
P53563_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct

P53563_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
P53563_BCL2L1-02      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca
P53563_BCL2L1-03      ctcccagaaaggatacagctggagtcagtttagcgatgtcgaagagaaca

P53563_BCL2L1-01      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
P53563_BCL2L1-02      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc
P53563_BCL2L1-03      ggactgaagccccagaagaaactgaaccagaaagggagacccccagtgcc

P53563_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
P53563_BCL2L1-02      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg
P53563_BCL2L1-03      atcaatggcaacccatcctggcacctggcggatagccccgcggtgaatgg

P53563_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
P53563_BCL2L1-02      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg
P53563_BCL2L1-03      agccactggccacagcagcagtttggatgcgcgggaggtaatccccatgg

P53563_BCL2L1-01      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
P53563_BCL2L1-02      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg
P53563_BCL2L1-03      cagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcgg

P53563_BCL2L1-01      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
P53563_BCL2L1-02      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg
P53563_BCL2L1-03      taccggagagcattcagtgatctaacatcccagcttcatataaccccagg

P53563_BCL2L1-01      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
P53563_BCL2L1-02      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
P53563_BCL2L1-03      gacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg

P53563_BCL2L1-01      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
P53563_BCL2L1-02      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg
P53563_BCL2L1-03      gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactg

P53563_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
P53563_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
P53563_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc

P53563_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
P53563_BCL2L1-02      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
P53563_BCL2L1-03      aagttggatggccacctacctgaatgaccacctagagccttggatccagg

P53563_BCL2L1-01      agaacggcggctgg--------------------------gacacttttg
P53563_BCL2L1-02      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
P53563_BCL2L1-03      agaacggcggctgggtaagaaccacgccccttgtgtgtccgccccttgtg
                      **************                          * * *** **

P53563_BCL2L1-01      tggatctctacgggaacaatgc--agcagcc-------------------
P53563_BCL2L1-02      tgtctctcctctgtggagatccctaactgccctttttggtctcctggcat
P53563_BCL2L1-03      tgtctctcctctgtggagatccctaactgccctttttggtctcctggcat
                      **  ****  * *     ** *  * * ***                   

P53563_BCL2L1-01      --------gagagccggaaaggccaggag-------------cgtttcaa
P53563_BCL2L1-02      ggttgttgaagatatcgattattcaggagacattcctggcttcactttaa
P53563_BCL2L1-03      ggttgttgaagatatcgattattcaggagacattcctggcttcactttaa
                               ***    **     ******             *  ** **

P53563_BCL2L1-01      ccgctg-----------------------------gttcctgacgggcat
P53563_BCL2L1-02      taccaggggttaactttgggaatattgatgaccctgtttttaaggaacct
P53563_BCL2L1-03      taccaggggttaactttgggaatattgatgaccctgtttttaaggaacct
                         * *                             ***  * * *  * *

P53563_BCL2L1-01      g--------actgtggctg-----gtg--------------tagttctgc
P53563_BCL2L1-02      gtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
P53563_BCL2L1-03      gtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
                      *        * * *****      ***              ***** ** 

P53563_BCL2L1-01      tgggctcactcttcagtcggaagtga------------------------
P53563_BCL2L1-02      tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaa
P53563_BCL2L1-03      tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaa
                      *    *  ***  **     **                            

P53563_BCL2L1-01      -----
P53563_BCL2L1-02      cctag
P53563_BCL2L1-03      cctag

© 1998-2022Legal notice