Dataset for CDS BCL2L1 of organism Chrysemys picta bellii

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C3IUT0_BCL2L1-      atgtcaaacactaacagggagttagtgactgactttctctcctacaagct
A0A8C3IUT0_BCL2L1-      atgtcaaacactaacagggagttagtgactgactttctctcctacaagct
A0A8C3IUT0_BCL2L1-      atgtcaaacactaacagggagttagtgactgactttctctcctacaagct
A0A8C3IUT0_BCL2L1-      atgtcaaacactaacagggagttagtgactgactttctctcctacaagct

A0A8C3IUT0_BCL2L1-      atcgcagcggggatacagctggagtcggttcgagggggaggatgagatca
A0A8C3IUT0_BCL2L1-      atcgcagcggggatacagctggagtcggttcgagggggaggatgagatca
A0A8C3IUT0_BCL2L1-      atcgcagcggggatacagctggagtcggttcgagggggaggatgagatca
A0A8C3IUT0_BCL2L1-      atcgcagcggggatacagctggagtcggttcgagggggaggatgagatca

A0A8C3IUT0_BCL2L1-      ggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagt
A0A8C3IUT0_BCL2L1-      ggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagt
A0A8C3IUT0_BCL2L1-      ggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagt
A0A8C3IUT0_BCL2L1-      ggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagt

A0A8C3IUT0_BCL2L1-      ccatcctggcacccgggtgccagccacgtggtgaatggggctgccgggca
A0A8C3IUT0_BCL2L1-      ccatcctggcacccgggtgccagccacgtggtgaatggggctgccgggca
A0A8C3IUT0_BCL2L1-      ccatcctggcacccgggtgccagccacgtggtgaatggggctgccgggca
A0A8C3IUT0_BCL2L1-      ccatcctggcacccgggtgccagccacgtggtgaatggggctgccgggca

A0A8C3IUT0_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccggcaactggagtgaggc
A0A8C3IUT0_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccggcaactggagtgaggc
A0A8C3IUT0_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccggcaactggagtgaggc
A0A8C3IUT0_BCL2L1-      cagtaacagccttgaagcccatgaaagggttccggcaactggagtgaggc

A0A8C3IUT0_BCL2L1-      aggcactgagagaggcaggagatgagtttgaattgaggtatcggagggct
A0A8C3IUT0_BCL2L1-      aggcactgagagaggcaggagatgagtttgaattgaggtatcggagggct
A0A8C3IUT0_BCL2L1-      aggcactgagagaggcaggagatgagtttgaattgaggtatcggagggct
A0A8C3IUT0_BCL2L1-      aggcactgagagaggcaggagatgagtttgaattgaggtatcggagggct

A0A8C3IUT0_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctggcacggcatacca
A0A8C3IUT0_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctggcacggcatacca
A0A8C3IUT0_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctggcacggcatacca
A0A8C3IUT0_BCL2L1-      ttcagtgacctcacttcccagctccacatcacccctggcacggcatacca

A0A8C3IUT0_BCL2L1-      gagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
A0A8C3IUT0_BCL2L1-      gagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
A0A8C3IUT0_BCL2L1-      gagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
A0A8C3IUT0_BCL2L1-      gagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg

A0A8C3IUT0_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagt
A0A8C3IUT0_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagt
A0A8C3IUT0_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagt
A0A8C3IUT0_BCL2L1-      ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagt

A0A8C3IUT0_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac
A0A8C3IUT0_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac
A0A8C3IUT0_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac
A0A8C3IUT0_BCL2L1-      gtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggatgac

A0A8C3IUT0_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt
A0A8C3IUT0_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt
A0A8C3IUT0_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt
A0A8C3IUT0_BCL2L1-      cacttacctgactgaccacctagatccctggatccaagagaatggcggtt

A0A8C3IUT0_BCL2L1-      gggagcggtttgtggagctctacgggaatgacgctgctgccaagagcagg
A0A8C3IUT0_BCL2L1-      gggagcggtttgtggagctctacgggaatgacgctgctgccaagagcagg
A0A8C3IUT0_BCL2L1-      gggagcggtttgtggagctctacgggaatgacgctgctgccaagagcagg
A0A8C3IUT0_BCL2L1-      gggagcggtttgtggagctctacgggaatgacgctgctgccaagagcagg

A0A8C3IUT0_BCL2L1-      aaaggccaggagcagttcaacaggtggcttctg----accggggcgactc
A0A8C3IUT0_BCL2L1-      aaaggccaggagcagttcaacaggtggcttctg----accggggcgactc
A0A8C3IUT0_BCL2L1-      aaaggccaggagcagttcaacaggtggcttctg----accggggcgactc
A0A8C3IUT0_BCL2L1-      aaaggccaggagcagttcaacaggagccatctgctgtcccattgcgtctc
                        ************************ * * ****     **   *** ***

A0A8C3IUT0_BCL2L1-      tggcgggagtg------------------ctcctgctgggctctctgctg
A0A8C3IUT0_BCL2L1-      tggcgggagtg------------------ctcctgctgggctctctgctg
A0A8C3IUT0_BCL2L1-      tggcgggagtg------------------ctcctgctgggctctctgctg
A0A8C3IUT0_BCL2L1-      --gctgcagcggccaaggccccgtctcgacgctggctgtgcccagcccag
                          ** * ** *                  * *  **** ** *    * *

A0A8C3IUT0_BCL2L1-      agc-cgcaagtaa
A0A8C3IUT0_BCL2L1-      agc-cgcaagtaa
A0A8C3IUT0_BCL2L1-      agc-cgcaagtaa
A0A8C3IUT0_BCL2L1-      ggcactcggctag
                         ** * *   ** 

© 1998-2023Legal notice