Dataset for CDS MCL-1 of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6V5Y3_MCL1-01      atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6V5Y3_MCL1-03      atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K6V5Y3_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccccccgggagggc
A0A2K6V5Y3_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccccccgggagggc
                        **************************************************

A0A2K6V5Y3_MCL1-01      ggcttctggccgcggagaaggaggcctcggcccagcgagaggtaggggga
A0A2K6V5Y3_MCL1-03      ggcttct-------------------------------------------
                        *******                                           

A0A2K6V5Y3_MCL1-01      ggggaggccggcgcggtgattggcggaagcgccggcgctagccctccggc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      cgccctgacgcctgacgcccggagggtcgtgcggccgccgcccattggcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      ccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      cccacccgccgcgcggcgccgctggaggagatggaagccccggccgccga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      cgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcct
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      ggtcatggctccagtacggacgggtcactcccctcgacgccgccgcccgc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6V5Y3_MCL1-01      ggtacctccgggagcaggcgaccggcgccaaggacacaaagccaatgggc
A0A2K6V5Y3_MCL1-03      ----------------ggcgaccggcgccaaggacacaaagccaatgggc
                                        **********************************

A0A2K6V5Y3_MCL1-01      aggtccggggccgccagcaggaaggcgctggagaccctgcggcgggtcgg
A0A2K6V5Y3_MCL1-03      aggtccggggccgccagcaggaaggcgctggagaccctgcggcgggtcgg
                        **************************************************

A0A2K6V5Y3_MCL1-01      ggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K6V5Y3_MCL1-03      ggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                        **************************************************

A0A2K6V5Y3_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K6V5Y3_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                        **************************************************

A0A2K6V5Y3_MCL1-01      gtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
A0A2K6V5Y3_MCL1-03      gtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
                        **************************************************

A0A2K6V5Y3_MCL1-01      catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaag
A0A2K6V5Y3_MCL1-03      catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaag
                        **************************************************

A0A2K6V5Y3_MCL1-01      aaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2K6V5Y3_MCL1-03      aaagctgcattgaaccattagcagaaagtatcacagacgttctcgtaagg
                        **************************************************

A0A2K6V5Y3_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2K6V5Y3_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                        **************************************************

A0A2K6V5Y3_MCL1-01      gttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctgg
A0A2K6V5Y3_MCL1-03      gttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctgg
                        **************************************************

A0A2K6V5Y3_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K6V5Y3_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

A0A2K6V5Y3_MCL1-01      tag
A0A2K6V5Y3_MCL1-03      tag
                        ***

© 1998-2020Legal notice