Dataset for CDS BCL2L2 of organism Piliocolobus tephrosceles

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9H679_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A8C9H679_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                        **************************************************

A0A8C9H679_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A8C9H679_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                        **************************************************

A0A8C9H679_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A8C9H679_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A8C9H679_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A8C9H679_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                        **************************************************

A0A8C9H679_BCL2L2-      gctgcatgtaaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A8C9H679_BCL2L2-      gctgcatgtaaccccaggctcagcgcagcaacgcttcacccaggtctctg
                        **************************************************

A0A8C9H679_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A8C9H679_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
                        **************************************************

A0A8C9H679_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A8C9H679_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
                        **************************************************

A0A8C9H679_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A8C9H679_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                        **************************************************

A0A8C9H679_BCL2L2-      tggctgactggatccacagcagtgggggctggtta----tcccagatcac
A0A8C9H679_BCL2L2-      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
                        ********************************       ** *** **  

A0A8C9H679_BCL2L2-      t-------------------gaagctgagatggctgatgaa--gtaattt
A0A8C9H679_BCL2L2-      tacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactg
                        *                   * **  * *  * ***  * *  * ** * 

A0A8C9H679_BCL2L2-      g----cagtga----aattttaa--gcgactgtgactctgctccaagttc
A0A8C9H679_BCL2L2-      ggcatcagtgaggacagtgctgacgggggccgtggcactg----ggggcc
                        *    ******    * *  * *  * * * *** * ***      *  *

A0A8C9H679_BCL2L2-      cccagatctcgaggtaaggaa-----ttgtgagaaaaagtgggggtga
A0A8C9H679_BCL2L2-      ctggtaact----gtaggggccttttttgctagcaa--------gtga
                        *    * **    *** **       ***  ** **        ****

© 1998-2023Legal notice