Dataset for CDS Unclassified of Organism Chelonoidis abingdonii

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C0GPE9_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelonoidis abingdonii (length=462 residues).
atgtctcaaccaagaagaatccccaggcatttttttctctctcacgaccagaatggggtagcagtaccaaatgaggaaag
ccagaatagactcttaactgttgcagacaccaccgagcaaatggcgtttaatatcagctctgccacccaagttggccacc
aactggcagtcattggggatgaatttaacagcacatacactaggaagttagaggacatgctgtttcatcttgcacagggc
aggatggctgtgaatgttttaaaaatactccatatgcatgtttggaaaagtattataaaaagtttcagaagtcttttgaa
caatggttggcctaagagagttgttgcctatggaagctggatttctaggcttcctcttaagtccatgtgccagaggttga
tgccggcagccctgtttgtcgtcttattttggtggactgtcagttatggattgcagaactaa
>gnl|bcl2dbcds|A0A8C0JBU5_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Chelonoidis abingdonii (length=339 residues).
atgaacaatcataattttataatcttttttttcccctctttgacaaacgtgctgaatacttcttacagctctgccaccca
agttggccaccaactggcagtcattggggatgaatttaacagcacatacactaggaagttagaggacatgctgtttcatc
ttgcacaggggatggctgtgaatgttttaaaaatactccatatgcatgtttggaaaagtattataaaaagtttcagaagt
cttttgaacaatggttggcctaagagagttgttgcctatggaagctgggtaagctttgttttgttaatttttttttaccc
tcacaactttctgttttgg
© 1998-2023Legal notice