Dataset for CDS MCL-1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452GA25_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
                        **************************************************

A0A452GA25_MCL1-01      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A452GA25_MCL1-02      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
                        **************************************************

A0A452GA25_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A452GA25_MCL1-02      ttttggctgcggggaaggaggccacggcgc--------------------
                        ******************************                    

A0A452GA25_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A452GA25_MCL1-02      -------------------------gcgccggcccgagccccccggccac
                                                 *************************

A0A452GA25_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A452GA25_MCL1-02      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
                        **************************************************

A0A452GA25_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A452GA25_MCL1-02      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
                        **************************************************

A0A452GA25_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A452GA25_MCL1-02      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
                        **************************************************

A0A452GA25_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A452GA25_MCL1-02      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
                        **************************************************

A0A452GA25_MCL1-01      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
A0A452GA25_MCL1-02      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
                        **************************************************

A0A452GA25_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
A0A452GA25_MCL1-02      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
                        **************************************************

A0A452GA25_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
A0A452GA25_MCL1-02      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
                        **************************************************

A0A452GA25_MCL1-01      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A452GA25_MCL1-02      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
                        **************************************************

A0A452GA25_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A452GA25_MCL1-02      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
                        **************************************************

A0A452GA25_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A452GA25_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
                        **************************************************

A0A452GA25_MCL1-01      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A452GA25_MCL1-02      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
                        **************************************************

A0A452GA25_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A452GA25_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A452GA25_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A452GA25_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
                        **************************************************

A0A452GA25_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A452GA25_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
                        **************************************************

A0A452GA25_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A452GA25_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
                        **************************************************

A0A452GA25_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A452GA25_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
                        **************************************************

A0A452GA25_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A452GA25_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

A0A452GA25_MCL1-01      tag
A0A452GA25_MCL1-02      tag
                        ***

© 1998-2022Legal notice