Dataset for CDS MCL-1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452GA25_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg

A0A452GA25_MCL1-02      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A452GA25_MCL1-01      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc

A0A452GA25_MCL1-02      ttttggctgcggggaaggaggccacggcgc--------------------
A0A452GA25_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg

A0A452GA25_MCL1-02      -------------------------gcgccggcccgagccccccggccac
A0A452GA25_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac

A0A452GA25_MCL1-02      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A452GA25_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg

A0A452GA25_MCL1-02      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A452GA25_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc

A0A452GA25_MCL1-02      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A452GA25_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc

A0A452GA25_MCL1-02      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A452GA25_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg

A0A452GA25_MCL1-02      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
A0A452GA25_MCL1-01      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt

A0A452GA25_MCL1-02      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
A0A452GA25_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc

A0A452GA25_MCL1-02      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
A0A452GA25_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc

A0A452GA25_MCL1-02      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A452GA25_MCL1-01      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc

A0A452GA25_MCL1-02      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A452GA25_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg

A0A452GA25_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A452GA25_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga

A0A452GA25_MCL1-02      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A452GA25_MCL1-01      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg

A0A452GA25_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A452GA25_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct

A0A452GA25_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A452GA25_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag

A0A452GA25_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A452GA25_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg

A0A452GA25_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A452GA25_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga

A0A452GA25_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A452GA25_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg

A0A452GA25_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A452GA25_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga

A0A452GA25_MCL1-02      tag
A0A452GA25_MCL1-01      tag

© 1998-2020Legal notice