Dataset for CDS MCL-1 of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2N853_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A8C2N853_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A8C2N853_MCL1-03      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-01      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
A0A452GA25_MCL1-02      atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgg
                        **************************************************

A0A8C2N853_MCL1-01      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A8C2N853_MCL1-02      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A8C2N853_MCL1-03      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A452GA25_MCL1-01      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
A0A452GA25_MCL1-02      gggagccgggttaggacagggcagcggcgcttcctctccgggggggcggc
                        **************************************************

A0A8C2N853_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A8C2N853_MCL1-02      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A8C2N853_MCL1-03      tttt----------------------------------------------
A0A452GA25_MCL1-01      ttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggg
A0A452GA25_MCL1-02      ttttggctgcggggaaggaggccacggcgc--------------------
                        ****                                              

A0A8C2N853_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A8C2N853_MCL1-02      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      gaagccggcacggtgattggcggaagcgccggcccgagccccccggccac
A0A452GA25_MCL1-02      -------------------------gcgccggcccgagccccccggccac
                                                                          

A0A8C2N853_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A8C2N853_MCL1-02      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
A0A452GA25_MCL1-02      tcttgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccg
                                                                          

A0A8C2N853_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A8C2N853_MCL1-02      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
A0A452GA25_MCL1-02      agggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgccc
                                                                          

A0A8C2N853_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A8C2N853_MCL1-02      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
A0A452GA25_MCL1-02      acacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgc
                                                                          

A0A8C2N853_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A8C2N853_MCL1-02      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
A0A452GA25_MCL1-02      catcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
                                                                          

A0A8C2N853_MCL1-01      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
A0A8C2N853_MCL1-02      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
A0A452GA25_MCL1-02      ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagt
                                                                          

A0A8C2N853_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
A0A8C2N853_MCL1-02      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
A0A452GA25_MCL1-02      aacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatc
                                                                          

A0A8C2N853_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
A0A8C2N853_MCL1-02      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
A0A8C2N853_MCL1-03      --------------------------------------------------
A0A452GA25_MCL1-01      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
A0A452GA25_MCL1-02      agaggaggaggaggacgagttatatcggcagtccctggagattatctctc
                                                                          

A0A8C2N853_MCL1-01      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A8C2N853_MCL1-02      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A8C2N853_MCL1-03      ----------------ggcaaccggcgccaaggacgcgaagcccctgggc
A0A452GA25_MCL1-01      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
A0A452GA25_MCL1-02      agtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggc
                                        **********************************

A0A8C2N853_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A8C2N853_MCL1-02      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A8C2N853_MCL1-03      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A452GA25_MCL1-01      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
A0A452GA25_MCL1-02      gggtctggggccaccagccggaaggcgttggagaccctgcgccgagtcgg
                        **************************************************

A0A8C2N853_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A8C2N853_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A8C2N853_MCL1-03      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A452GA25_MCL1-01      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
A0A452GA25_MCL1-02      ggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcgga
                        **************************************************

A0A8C2N853_MCL1-01      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A8C2N853_MCL1-02      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A8C2N853_MCL1-03      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A452GA25_MCL1-01      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
A0A452GA25_MCL1-02      aactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatg
                        **************************************************

A0A8C2N853_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8C2N853_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A8C2N853_MCL1-03      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A452GA25_MCL1-01      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A452GA25_MCL1-02      gttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A8C2N853_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A8C2N853_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A8C2N853_MCL1-03      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A452GA25_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
A0A452GA25_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaag
                        **************************************************

A0A8C2N853_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A8C2N853_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A8C2N853_MCL1-03      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A452GA25_MCL1-01      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
A0A452GA25_MCL1-02      aaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaagg
                        **************************************************

A0A8C2N853_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A8C2N853_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A8C2N853_MCL1-03      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A452GA25_MCL1-01      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
A0A452GA25_MCL1-02      tcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtgga
                        **************************************************

A0A8C2N853_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A8C2N853_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A8C2N853_MCL1-03      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A452GA25_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A452GA25_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
                        **************************************************

A0A8C2N853_MCL1-01      cttttgcagtcaatactagattgtatacagaaccagctgatgtaattgta
A0A8C2N853_MCL1-02      cttttgcaggtgttgctgg---------agtaggagctggttnn---nnn
A0A8C2N853_MCL1-03      cttttgcaggtgttgctgg---------agtaggagctggttnn---nnn
A0A452GA25_MCL1-01      cttttgcaggtgttgctgg---------agtaggagctggtttg---gca
A0A452GA25_MCL1-02      cttttgcaggtgttgctgg---------agtaggagctggtttg---gca
                        *********    * ** *         ** *  ***** *         

A0A8C2N853_MCL1-01      tgcaacttggtgtag
A0A8C2N853_MCL1-02      nnnnnnnnaagatag
A0A8C2N853_MCL1-03      nnnnnnnnaagatag
A0A452GA25_MCL1-01      tatctaataagatag
A0A452GA25_MCL1-02      tatctaataagatag
                                    ***

© 1998-2022Legal notice