Dataset for CDS MCL-1 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A452GA25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452GA25_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1008 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcgcgccggcccgagccccccggccactcttg
cgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccaccagactg
ctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgcccga
agaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagctttgatggtcggagaag
ccagtaacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatcagaggaggaggaggacgagttatat
cggcagtccctggagattatctctcagtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
tggggccaccagccggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttcc
aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagt
gacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaa
tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaac
aaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttt
gcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2N853_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1065 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagtcaatactagattgtatacagaaccagctga
tgtaattgtatgcaacttggtgtag
>gnl|bcl2dbcds|A0A8C2N853_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggttnnnnnnn
nnnnnnaagatag
>gnl|bcl2dbcds|A0A8C2N853_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccgga
aggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagt
aggagctggttnnnnnnnnnnnnnaagatag
© 1998-2022Legal notice