Dataset for CDS BAX of Organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5JHH5_BAX-01      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
A0A2K5JHH5_BAX-02      atggacgggtccggggagcagcccagaggcggggggcccaccagctctga
                       **************************************************

A0A2K5JHH5_BAX-01      gcagatcatgaagacaggggcccttttgcttcagggtttcatccaggatc
A0A2K5JHH5_BAX-02      gcagatcatgaagacaggggcccttttgcttcagg---------------
                       ***********************************               

A0A2K5JHH5_BAX-01      gagcagggcgaatgggcggggagacgcccgagctggccctggacccagtg
A0A2K5JHH5_BAX-02      --------------------------------------------------
                                                                         

A0A2K5JHH5_BAX-01      cctcaggatgcgtccaccaagaggctgagcgagtgtctcaagcgcatcgg
A0A2K5JHH5_BAX-02      --------------------------------------------------
                                                                         

A0A2K5JHH5_BAX-01      ggacgaactggacagtaacatggagctgcagaggatgattgccgccgtgg
A0A2K5JHH5_BAX-02      --------------------------------ggatgattgccgccgtgg
                                                       ******************

A0A2K5JHH5_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A2K5JHH5_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A2K5JHH5_BAX-01      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
A0A2K5JHH5_BAX-02      tctgacggcaacttcaactggggccgtgttgtcgcccttttctactttgc
                       **************************************************

A0A2K5JHH5_BAX-01      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
A0A2K5JHH5_BAX-02      cagcaaactggtgctcaaggccctgtgtaccaaggtgcccgaactgatca
                       **************************************************

A0A2K5JHH5_BAX-01      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
A0A2K5JHH5_BAX-02      gaaccatcatgggctggacactggacttcctccgggagcggctgttgggc
                       **************************************************

A0A2K5JHH5_BAX-01      tggatccaagaccagggtggttgggacggcctcctctcctactttgggac
A0A2K5JHH5_BAX-02      tggatccaagaccagggtggttgggacggcctcctctcctactttgggac
                       **************************************************

A0A2K5JHH5_BAX-01      gcccacgtggcagaccgtgaccatcttggtggctggagtactcactgcct
A0A2K5JHH5_BAX-02      gcccacgtggcagaccgtgaccatcttggtggctggagtactcactgcct
                       **************************************************

A0A2K5JHH5_BAX-01      cgctcaccatctggaagaagatgggctga
A0A2K5JHH5_BAX-02      cgctcaccatctggaagaagatgggctga
                       *****************************

© 1998-2020Legal notice