Dataset for CDS BCL-2 of organism Strix occidentalis caurina

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D0G0L7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Strix occidentalis caurina GN=BCL-2 (length=726 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccggcgaggacagggcacccctgcctccgggtctctctcctcctgctgctgctgctgcggtcgctg
ctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagc
cacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtccacctcgccctgcgccaggcgggcgatgagttctc
ccgccgctaccagagggactttgcccaaatgtccggccagctgcacctgacgcccttcacggccaggggccgcttcgtgg
cagtggtggaggagctcttccgagacggggttaactggggcaggattgtggccttcttcgagtttggcggcgtgatgtgc
gtggagagcgtcaaccgggagatgtctccccttgtagacagcatcgccgcctggatgaccgagtacctgaaccggcacct
gcacaactggatccaggacaacggaggctgggatgccttcgtcgagttgtatggcaacagtatgaggcctttgtttgatt
tctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatctcggacat
aagtag
© 1998-2023Legal notice