Dataset for CDS BOK of Organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W3IZA3_BOK-01      atgtctgatcttgcaggtttaatgctgagtatctttggtgtacctgtcac
K4FTK7_BOK-01          --------------------------------------------------
                                                                         

A0A4W3IZA3_BOK-01      aggtttgatcattttgatctctcatttactatcttctcagatggacatgt
K4FTK7_BOK-01          ----------------------------------------atggacatgt
                                                               **********

A0A4W3IZA3_BOK-01      tacggcgctcctcggtctttgctgctgaggtgatggaggtgtttgaacgt
K4FTK7_BOK-01          tacggcgctcctcggtctttgctgctgaggtgatggaggtgtttgaacgt
                       **************************************************

A0A4W3IZA3_BOK-01      tctccccctgacaaggagctcgtttctcaggctaaagccctctgtcggga
K4FTK7_BOK-01          tctccccctgacaaggagctcgtttctcaggctaaagccctctgtcggga
                       **************************************************

A0A4W3IZA3_BOK-01      ttacatccactcccggctgatccgagcaggcatagtctggagcaaacctg
K4FTK7_BOK-01          ttacatccactcccggctgatccgagcaggcatagtctggagcaaacctg
                       **************************************************

A0A4W3IZA3_BOK-01      agtgtgcagcagccagcccagccagcaaactcactgaggtgtcagctgca
K4FTK7_BOK-01          agtgtgcagcagccagcccagccagcaaactcactgaggtgtcagctgca
                       **************************************************

A0A4W3IZA3_BOK-01      ctcctccgcctgggtgatgaattagagtacatcaggccgaacatgtacag
K4FTK7_BOK-01          ctcctccgcctgggtgatgaattagagtacatcaggccgaacatgtacag
                       **************************************************

A0A4W3IZA3_BOK-01      gaatgtcgccaaacagttgaatatcaccgtcagttccgaaagcatcgtat
K4FTK7_BOK-01          gaatgtcgccaaacagttgaatatcaccgtcagttccgaaagcatcgtat
                       **************************************************

A0A4W3IZA3_BOK-01      cggatgcatttctcgctgtggccactgagatcttctctgcaggtataact
K4FTK7_BOK-01          cggatgcatttctcgctgtggccactgagatcttctctgcaggtataact
                       **************************************************

A0A4W3IZA3_BOK-01      tgggggaaggtggtagccttgtatgctgttgccggtggacttgccattga
K4FTK7_BOK-01          tgggggaaggtggtagccttgtatgctgttgccggtggacttgccattga
                       **************************************************

A0A4W3IZA3_BOK-01      ctgtgtgaaacaagggcaacctgccatggtgcacacaatagttgactgcc
K4FTK7_BOK-01          ctgtgtgaaacaagggcaacctgccatggtgcacacaatagttgactgcc
                       **************************************************

A0A4W3IZA3_BOK-01      tgggagaatttgtgcggaagacactggtgacttggctccggagacgggga
K4FTK7_BOK-01          tgggagaatttgtgcggaagacactggtgacttggctccggagacgggga
                       **************************************************

A0A4W3IZA3_BOK-01      ggatgggctgacattacaaaatccgtggtgaacaacgatcctagcattcg
K4FTK7_BOK-01          ggatgggctgacattacaaaatccgtggtgaacaacgatcctagcattcg
                       **************************************************

A0A4W3IZA3_BOK-01      tgatcactggctcgtctctgccgtctgcacgtttggacactttgtgaaag
K4FTK7_BOK-01          tgatcactggctcgtctctgccgtctgcacgtttggacactttgtgaaag
                       **************************************************

A0A4W3IZA3_BOK-01      cggtcttcttctttctgctgcgagaacggtga
K4FTK7_BOK-01          cggtcttcttctttctgctgcgagaacggtga
                       ********************************

© 1998-2023Legal notice