Dataset for CDS Unclassified of Organism Hucho hucho

[Download (right click)]

8 sequence(s)

>gnl|bcl2dbcds|A0A4W5JVS4_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=474 residues).
acggtcagatgccaaacagttgccataccaggaggtgatgcaaccggtcaggatgctcttggtggtgcagttctagttgt
ttacccgggaccttcttttcgcagtttctacgagcgggttcatcgccatgctgacagcagtactcggttgtcagtgtcaa
ggacccagttgggtgggagtatgctgtgtggccccaaccacaagacactggccgtgtccctggagcagattggagttgag
ctggatggcaatacagacctccaaagtatgataaatgatactgcactccagcccagccaggaggtttttatgagagtggc
ctgtgagatcttctctgatgggacgttcaactggggcagggtggtttttacaaatgagggaatccgttcctactttggca
ctcccacctggcagaccgtgggggtgttcctcgctggagttcttaccactgtgctggtcatccgcaagatgtga
>gnl|bcl2dbcds|A0A4W5JVS4_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=378 residues).
taccctcttcacgactgtcttggttctcaacccgctccactacatactcggttgtcagtgtcaaggacccagttgggtgg
gagtatgctgtgtggccccaaccacaagacactggccgtgtccctggagcagattggagttgagctggatggcaatacag
acctccaaagtatgataaatgatactgcactccagcccagccaggaggtttttatgagagtggcctgtgagatcttctct
gatgggacgttcaactggggcagggtggtttttacaaatgagggaatccgttcctactttggcactcccacctggcagac
cgtgggggtgttcctcgctggagttcttaccactgtgctggtcatccgcaagatgtga
>gnl|bcl2dbcds|A0A4W5K1N9_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=525 residues).
atggtgttgtattatgacagaataatggatcaagcagctgtaattctgagaggctacgttatagagagattcagagcaga
agggatacagctgtctcctgaagagctgggtggaacacctaatgaaccccagggtcatgagttgaaggagattgtggaac
agctactggagactactgaggaactgaacacaaatactgagcttcagcgcttaataagtgaagtctcgattttcccatat
ggaatcaactggggcaaagtggcagtccttcatcacctgccctacaagcttattcacagagcacatacacagaaccaacc
ccaagtcatggttaacataatcaacgactctacactatgtttttggactgaaactttggtgatagaggcaccatgttttt
gtataataattgtagctgttgcttttaaagttggtaatattatatatcatttgaaaggtaatgtcatgacatttatacag
gtaattctgatatgtaccctagaggtcaaagttgtgttgacctga
>gnl|bcl2dbcds|A0A4W5PJ21_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=603 residues).
atggcgtgtgtagagacatcagattacagagtaggagaggtcctgctgaacagagtgatgcaggagcagctgaatgaggt
gtcatcagtcccggtagtggtctccacagaaacccaggaggtggagagtgatcaggagcagaagattgtgtcacaactag
ctatgatgatacggaccattggagatgccgtcaagaaggacgggaagctggacgatgcgatagatggaatggtggggcaa
atgaccagcaagaccagctactggaagttggtagaaaaggtatttgaggacagtcaaatcacctgggagagaattgctgt
gctgttttacgtagcagggaggatagctgtcaaggtggtgattgctaacctcccccagttagtgcaggacattctgaagt
ggactctggagtacttcagaaacaaattactggattggatccagaaacatggaggatggatgaacagttttgctgagctg
gcacgtgtgcaggtggagaagatgtcctctatgagcgcctggtcctcagggctcatcctggtcttcctcggaggtgtcat
actgggtagtgttatcacctggaaactgtccagcaggacctga
>gnl|bcl2dbcds|A0A4W5PJE2_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Hucho hucho (length=519 residues).
atgttacattactatatcaactatgtgaccgctgggcccgacggccacatagggccaccccctacagccacagcagcagc
cctgcaccatgctggggaccagctgctcattaggttccccatcttcttcaggcgctggccactcatcttccaggatatga
ctgagacctcagcctgccccgtgctcaccgccatcctagacgagcactttgcacccaccaacccgggagggtggcggcga
gacctggcctggagcgctgtgctgtctgtgtatgtgctggctggccagatggccctgcactgccacgagagtggcatgga
cggaatcgtgcctcaattaaggagtgtgtggggggtcatctgggtggagagggtcatctgggtagatggacagtctttgt
gtcgctttgggcagaagcaggacttggaggcccaggtgaagaaggtgtgttgctggactctattgctattggtcaccagt
atcctatcctatttcctgtggatacaaaaaatagcttaa
>gnl|bcl2dbcds|A0A4W5PJW0_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=609 residues).
atggcgtgtgtagagacatcagatgacagagtaggagaggtcctgctgaaaagagtgatgcaggagcagctggatgaggt
gttgtcatcagaagtcccggtagtggtctccacagaaacccaggaattggagagtgagcaagagcagaagatggtgttac
agctggctgtgatgatacgtaccatcggagacgccttcaaggagaacagggagctggacgatgtgatagatggaatggtg
gggcaaatgaccagcaagcccagctattggaagttggtagaaaaggtatttgaggacggtcaaatcacctgggagagaat
tgctgtgctgttctacgtagctgggaggatagctgtcaaggtggtgattgctaacctccccgagttagtgaaggacattc
tgaagtggactctggagtacttcagaagcaaattactggactggatccagaaacatggaggatggatgaacagtttcgct
gagctggcacgtgtacaggtggagaggatatcctctatgagcgcccggtcctcagggttcattctggtcttcctcggagg
tgtcataatgggtagtgttatcacctggaaactggccaggaggacctga
>gnl|bcl2dbcds|A0A4W5PQI2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Hucho hucho (length=510 residues).
atggatcaagcagctgtaactctgagaggctacgttatagagagattcagagcagaagggatacagctgtctcctgaaga
gctgggtggaacacctaatgaactccagggtcatgagttgaaagagatggtggaacagctactggagactactgaggaac
tgaacacaaatactgagctgcagcgcttaataagtgaagtctcggtctattgtatccaggatgttttctttgcaacaacc
aaggagattttcccatatggaatcaactggggcaaagtggcagtccttcatcacctgccctacaagcttattcacagagc
acatacacagaaccaaccccaagtcatggttaacataatcaacgactctacagttaatcagagaatacatttgcaaaaat
gtctaaaaacctgttttcactttgtcattatggggtattgtgatgtcattatggggtattgtgatgtcattatggggtat
tgtgatgtcattatggggtattgtgtgtag
>gnl|bcl2dbcds|A0A4W5QXT9_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Hucho hucho (length=609 residues).
atgggtcagtcagaggggctagagagcaggggaggcataaacagccctgaccccctggtacgagaggcctatctgatgtt
acatgactatatcaactatgtgatcgccgggcccgacggccacataggcccaccccctactgccacagcagcagccctgc
gccatgctggggatgagctgctgattaggttccccatcttcttcaggcgctggccacgcgtcttccacgatgtgaccgag
gccacagcctgccccatgctcaccgccatcctggatgagcactttgccaccaccacccccggggggcgccgacgagacct
ggcctggagtgcggtgctgtctgtgtatgtgctggctggccagatggccctgcactgccacgagaggggcatggggggaa
tcctgccccagcttaaggagtgtgtggggggttacgtggagagggtcatctgtccagagattcgggacaagggtggatgg
acaggctttgtgtcccgctttggacagaagcaggacttggagggccaggtgaagaaggtgtgttgctggactctactgct
attggtcaccagtatcctgtcctatttcctgtggaaacgaatatcttaa
© 1998-2023Legal notice