Dataset for CDS BCL2L2 of organism Carlito syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
                                                                          

A0A1U7UJF2_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagccggccctg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagccggccctg
                                                                          

A0A1U7UJF2_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggcagctgga
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gggagggcccagcagccgacccgctgcaccaagccatgcgggcagctgga
                                                                          

A0A1U7UJF2_BCL2L2-      gatgagttcgagacccgcttccggcgcacgttctctgatctggcggctca
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gatgagttcgagacccgcttccggcgcacgttctctgatctggcggctca
                                                                          

A0A1U7UJF2_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctg
                                                                          

A0A1U7UJF2_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttt
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtggccttcttt
                                                                          

A0A1U7UJF2_BCL2L2-      gtctttggggctgcactctgtgctgaaagtgtcaacaaggagatggagcc
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gtctttggggctgcactctgtgctgaaagtgtcaacaaggagatggagcc
                                                                          

A0A1U7UJF2_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
                                                                          

A0A1U7UJF2_BCL2L2-      tggccgactggatccacagcagtgggggctgg------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                                                                          

A0A1U7UJF2_BCL2L2-      ------------------------------gcggagttcacagctctata
A0A1U7UJF2_BCL2L2-      ---------------atggaggaggaagctgaaaagctaaaagagctaca
A0A1U7UJF2_BCL2L2-      gcccgagtcagggagatggaggaggaagctgaaaagctaaaagagctaca
                                                      *   ** * * **  *** *

A0A1U7UJF2_BCL2L2-      cggggacggggc-------------------------cctggaggaggcg
A0A1U7UJF2_BCL2L2-      ---gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
A0A1U7UJF2_BCL2L2-      ---gaacgaggtagagaagcagatgaatatgagtccacctccaggcaatg
                           * *** **                          ***  ***    *

A0A1U7UJF2_BCL2L2-      cgg------------cgtctgcgggaggggaactggg-------------
A0A1U7UJF2_BCL2L2-      ctggcccagtgatcatgtccattgaggaaaagatggaggctgatgctcgt
A0A1U7UJF2_BCL2L2-      ctggcccagtgatcatgtccattgaggaaaagatggaggctgatgctcgt
                        * *             ***    *  *   *  ***              

A0A1U7UJF2_BCL2L2-      --catcagtgaggacagtgctga--------cgggagccgtggcactggg
A0A1U7UJF2_BCL2L2-      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctaga
A0A1U7UJF2_BCL2L2-      tccatctatgttggcaatgtggactatggtgcaacagcagaagagctaga
                          ****  **  * ** **  **        *   *** *  *  ** * 

A0A1U7UJF2_BCL2L2-      ggccc-------------------------------------------tg
A0A1U7UJF2_BCL2L2-      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg
A0A1U7UJF2_BCL2L2-      agctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtg
                         ** *                                           **

A0A1U7UJF2_BCL2L2-      gtaactgtaggggcctt--------ttttgct------------------
A0A1U7UJF2_BCL2L2-      acaaatttagtggccatcccaaaggttttgcttatatagagttctcagac
A0A1U7UJF2_BCL2L2-      acaaatttagtggccatcccaaaggttttgcttatatagagttctcagac
                          ** * *** **** *        *******                  

A0A1U7UJF2_BCL2L2-      ----agcaagtga-------------------------------------
A0A1U7UJF2_BCL2L2-      aaagagtcagtgaggacttccctggccttagatgagtccctatttagagg
A0A1U7UJF2_BCL2L2-      aaagagtcagtgaggacttccctggccttagatgagtccctatttagagg
                            **  *****                                     

A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      aagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
A0A1U7UJF2_BCL2L2-      aagacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagca
                                                                          

A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      caacagaccggggtttcccacgagcccgctaccgtgcccggaccaccaat
A0A1U7UJF2_BCL2L2-      caacagaccggggtttcccacgagcccgctaccgtgcccggaccaccaat
                                                                          

A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggcctcg
A0A1U7UJF2_BCL2L2-      tacaacagttcccgctctcgattctacagtggttttaacagcaggcctcg
                                                                          

A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
A0A1U7UJF2_BCL2L2-      gggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctt
                                                                          

A0A1U7UJF2_BCL2L2-      -----
A0A1U7UJF2_BCL2L2-      actaa
A0A1U7UJF2_BCL2L2-      actaa
                             

© 1998-2022Legal notice