Dataset for CDS BAX-like of Organism Chinchilla lanigera

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2VI87_BAX-01       ---------cccaccagctctgagcacatc----atgaagacaggggccc
A0A8C2VI87_BAX-02       ---------cccaccagctctgagcacatc----atgaagacaggggccc
A0A8C2VZ66_BAK1-01      atggca--tctgaccaaggcccgggtcccc----ccgagg--aggggtgc
A0A8C2YJA8_BOK-01       atggaggtcctgcgccgctcctcggtcctcgccgccgagatcatggacgc
                                 *    *    *   *  *  *      **    * **   *

A0A8C2VI87_BAX-01       ttttgcttcagggtttcatccaggatcgagc-----agggcacatgggcg
A0A8C2VI87_BAX-02       ttttgcttcagg--------------------------------------
A0A8C2VZ66_BAK1-01      a---g----agaggccgccccaccgtccgaagcggagcagcaggtggccc
A0A8C2YJA8_BOK-01       ctttg----agcgcacg-cccaccgacaaag-------agctggtggccc
                            *    **                                       

A0A8C2VI87_BAX-01       gggacaccctggagctggccat----------------------------
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      gggacaccgaggaggttttcctcagctatgtgtac--------------t
A0A8C2YJA8_BOK-01       agg---ccaaggcgctgggccgggagttcgtgcacgcgcggctcctgcgc
                                                                          

A0A8C2VI87_BAX-01       -------------ggagcaggcgccccaggacgcgtccacca--------
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      accgccatcagcaggagcaggaggccgagggggcagctgcccccactgac
A0A8C2YJA8_BOK-01       gccggcctggcctggagc--gcgcccgagcgcgccgcggtgccggggggc
                                                                          

A0A8C2VI87_BAX-01       -------agaagctgagcgagtgtctcaagcggattggggacgaactgga
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      c------ctgagatggatgccctgccgctagatccaaacagcaccctggc
A0A8C2YJA8_BOK-01       cgcctggcggaggtgtgcgctgtgctgctgcgtctgggggatgagctgga
                                                                          

A0A8C2VI87_BAX-01       c-------------------------------------------------
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      ccaggtgggtcggcagctgtccatcatcggagatgacatcaaccagcgc-
A0A8C2YJA8_BOK-01       gcagat---ccggc----------------------------ccagtgtg
                                                                          

A0A8C2VI87_BAX-01       agcaatatggagctgcagaggatgat-----------tgcggctgtggac
A0A8C2VI87_BAX-02       -------------------ggatgat-----------tgcggctgtggac
A0A8C2VZ66_BAK1-01      tacaacaccgagttccagagcctgctgca---------gcagctgcagcc
A0A8C2YJA8_BOK-01       taccgcaatgtggccc---gccagctgcacatctccctgcagtcagagcc
                                           *   * *            ** *     * *

A0A8C2VI87_BAX-01       ----acagactcgccccgagaggtctttttccgagtggccgctgaaatgt
A0A8C2VI87_BAX-02       ----acagactcgccccgagaggtctttttccgagtggccgctgaaatgt
A0A8C2VZ66_BAK1-01      cacggcggacaacgcctacgagctgttcctcaagattgcctccagtctct
A0A8C2YJA8_BOK-01       tgtggtgactgatgc---------gttcctggctgtggcaggccacatct
                                      *          **  *     * **        * *

A0A8C2VI87_BAX-01       ttgctgatggcaacttcaactggggccgggttgttgcccttttctatttt
A0A8C2VI87_BAX-02       ttgctgatggcaacttcaactggggccgggttgttgcccttttctatttt
A0A8C2VZ66_BAK1-01      ttgagagcggca---tcaactggggccgtgtggcggttctcctgggcttt
A0A8C2YJA8_BOK-01       tctcaacaggca---tcacatggggcaaggtggt-gtccctctacgcagt
                        *       ****   ***  ******   ** *  *  *   *      *

A0A8C2VI87_BAX-01       gccagca-aactggtgctcaa------------ggcgctgtgtaccaagg
A0A8C2VI87_BAX-02       gccagca-aactggtgctcaa------------g----------------
A0A8C2VZ66_BAK1-01      ggctatc-gcctggccctgcac-----------------gtctacca---
A0A8C2YJA8_BOK-01       ggctgcagggctggctgtggactgtgtacgacaggcccagcctgccatgg
                        * *       ****   *  *                             

A0A8C2VI87_BAX-01       tacccgagctgatca------------ggaccattatgggctggacactg
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      -gcacggcctgtctggcttcctgggcagggtgaccaggctggtgatcgat
A0A8C2YJA8_BOK-01       ttcacgccctggtcgactgcctgg---gggagtttgtgcgaaagacc---
                                                                          

A0A8C2VI87_BAX-01       gacttcctccgagaccg-gctgctgggctggatccaggaccagggtggtt
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      tgcatgctgcactactgcattgtc-cagtggatcgtggacaaaggcggct
A0A8C2YJA8_BOK-01       --ctggctgcctggctgcggcggcgcggtgga---tggac--tgacatcc
                                                                          

A0A8C2VI87_BAX-01       ggga---cggcctcctctcctactttggaa----ccccgacctggcagac
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      ggaa-------ggcagccctgaacttggttaatgaccccttctggaaagt
A0A8C2YJA8_BOK-01       tgaagtgcgtggtcagcaccgatcccggcctcc-actcacactggctcgt
                                                                          

A0A8C2VI87_BAX-01       ggtgaccatctttgtggccggtgtgc----------tcactgcctcgctc
A0A8C2VI87_BAX-02       --------------------------------------------------
A0A8C2VZ66_BAK1-01      ggtgatgatccttgccctggttctgg----tcggaaaatatgtggtacga
A0A8C2YJA8_BOK-01       ggccgcg----ctgtgcagcttcgggcgcttcctgaaagctgccttcttc
                                                                          

A0A8C2VI87_BAX-01       accatctggaagaacatgggctga
A0A8C2VI87_BAX-02       ------------------------
A0A8C2VZ66_BAK1-01      agattcttcaagtc---gtcctga
A0A8C2YJA8_BOK-01       gtactcttgccgga---gagatga
                                                

© 1998-2023Legal notice