Dataset for CDS MCL-1 of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8YP84_MCL1-01      atggacg----------------ggttattacccgcaaagccc-------
A0A8C9AD42_MCL1-01      -------------------gtgcg-----------caactct--------
A0A8C9AD42_MCL1-02      atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgg
A0A8C9AD42_MCL1-03      atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgg
                                               *           ***            

A0A8C8YP84_MCL1-01      -----------------cccgcagcagaggc-----------ggaagagg
A0A8C9AD42_MCL1-01      -----------------ccggaagctgccgcccttttccc----------
A0A8C9AD42_MCL1-02      gggggccggactgggagccggcagcggcggcgccacccccccgggagggc
A0A8C9AD42_MCL1-03      gggggccggactgggagccggcagcggcggcgccacccccccgggagggc
                                         ** * *** *  **                   

A0A8C8YP84_MCL1-01      accattt-------------------------------------------
A0A8C9AD42_MCL1-01      --ctttt-------------------------------------------
A0A8C9AD42_MCL1-02      ggcttttggctgccgagaaggaggccacggcccggcgagaggtaggggga
A0A8C9AD42_MCL1-03      ggctttt-------------------------------------------
                          * ***                                           

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ggggaagccggcacggtgattggcggaagccccggcgcaagccccccggc
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ctccctctcgccagacgcccggagggtcgcgcggccggcgcccattggtg
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ccgaggtccccgacgtcaccgcgacccccgaaaggctgctgtttttcgcg
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      cccacccgccgcgcgttgccgtccgaggagatggaggcccctgccgccga
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      tcgggaagcggcctgctgtcctgcctttactggagttggtcggggaggcc
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      agtaatggctccagcatggacgggtcactaccctcgacgccgcctccagc
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      ---------------------gtactggcagtcgctggagattatctctc
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      agaggaggaggaggacgagttgtaccggcagtcgctggagattatctctc
A0A8C9AD42_MCL1-03      --------------------------------------------------
                                                                          

A0A8C8YP84_MCL1-01      agtacttttgggagcaggcgaccggcgccaagggcccaaaaccaatggtc
A0A8C9AD42_MCL1-01      -------------atgggattccg--------------------------
A0A8C9AD42_MCL1-02      ggtaccttcgggagcaggcaaccggcgccaaggaggcaaagccaatgggc
A0A8C9AD42_MCL1-03      ----------------ggcaaccggcgccaaggaggcaaagccaatgggc
                                        **   ***                          

A0A8C8YP84_MCL1-01      aggtttgggggcgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A8C9AD42_MCL1-01      ----ctgacgccgcc--------gccgcctaggacc--------------
A0A8C9AD42_MCL1-02      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A8C9AD42_MCL1-03      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
                             **  * ****        * ***    ****              

A0A8C8YP84_MCL1-01      ggagagtgtgcagcgcagacacgatattgccttccaaggcatggttcgca
A0A8C9AD42_MCL1-01      -------------------------------------ggcatgcttcgga
A0A8C9AD42_MCL1-02      ggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A8C9AD42_MCL1-03      ggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                                                             ****** **** *

A0A8C8YP84_MCL1-01      gactggacatcagaaacgtagatggtgtgaaagatttgtctgaagtgatg
A0A8C9AD42_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8C9AD42_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A8C9AD42_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
                         *********** ***** *** * *** ***  *******  *******

A0A8C8YP84_MCL1-01      gtctgcgttttgaatgagagcgtaataagctggggcaggattacgactct
A0A8C9AD42_MCL1-01      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
A0A8C9AD42_MCL1-02      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
A0A8C9AD42_MCL1-03      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
                        ***   ***** * ***  ****** ** *************  ******

A0A8C8YP84_MCL1-01      aatttcttttggtgcctgtgtggcgaaacacttgaagagcataaatcaag
A0A8C9AD42_MCL1-01      aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaag
A0A8C9AD42_MCL1-02      aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaag
A0A8C9AD42_MCL1-03      aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaag
                        ***************** ****** ******************** ****

A0A8C8YP84_MCL1-01      aaagatgcatcgaaccattagcagaaagcatcacagacgttattgtaacg
A0A8C9AD42_MCL1-01      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A8C9AD42_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A8C9AD42_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
                        **** *********************** ************ ****** *

A0A8C8YP84_MCL1-01      ataaaacgtgactggctagtcgaacaaagaggctgggatgggtttgtgga
A0A8C9AD42_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A8C9AD42_MCL1-02      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A8C9AD42_MCL1-03      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
                        * ****** ************ ****************************

A0A8C8YP84_MCL1-01      gtacttccatgtagatgacctagaaggtgacatcagaaatgtgttgctgg
A0A8C9AD42_MCL1-01      gttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctgg
A0A8C9AD42_MCL1-02      gttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctgg
A0A8C9AD42_MCL1-03      gttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctgg
                        ** ************ *********** * ************* ******

A0A8C8YP84_MCL1-01      ctgttgcaattgttgctggaatagcagctggtttggtgtatctatctaat
A0A8C9AD42_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggca----tatctaat
A0A8C9AD42_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggca----tatctaat
A0A8C9AD42_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggca----tatctaat
                        ** *****  ********** *** ***********      ********

A0A8C8YP84_MCL1-01      gggatgaccttctaa
A0A8C9AD42_MCL1-01      aagatag--------
A0A8C9AD42_MCL1-02      aagatag--------
A0A8C9AD42_MCL1-03      aagatag--------
                          ***          

© 1998-2023Legal notice