Dataset for CDS BCL-2-like of organism Calidris pygmaea

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C3K1C5_BCL2A1-      atgg--------------------------aaacggctga----gttcta
A0A8C3JHE5_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8C3KQJ2_BCL2L1-      atgtc------------------caacagtaaccgggagttagtgattga
                        ***                           ** ***  *     * *  *

A0A8C3K1C5_BCL2A1-      ttacgtttattacttagctc-------aagattat------------ctg
A0A8C3JHE5_BCL2-01      gtacatccactat-aaactctcgcagagaggatacgactggg-----ctg
A0A8C3KQJ2_BCL2L1-      ctttgtttcctac-aagctttcacagaagggatacagctggagcgatctg
                         *   *    **   * **          *  **             ***

A0A8C3K1C5_BCL2A1-      caatatgtg----------------cttcaggagtcaca-----------
A0A8C3JHE5_BCL2-01      ccgg-tgaggacccggcacctctgccaccaggtctctctcctcctgctgc
A0A8C3KQJ2_BCL2L1-      caggaggagga-----------tgagaacaggactgact-----------
                        *     * *                   ****  *  *            

A0A8C3K1C5_BCL2A1-      --------------------------------------------------
A0A8C3JHE5_BCL2-01      tgctgctgctgctgctgctgctgggacttcctctgatcacactgggctgg
A0A8C3KQJ2_BCL2L1-      -----ttgtggcagaggaggacgagat-----------------ggacgg

A0A8C3K1C5_BCL2A1-      ----tcttggacc--agcccaaaccagggttgct---------cacgt--
A0A8C3JHE5_BCL2-01      tgtctccgcaccccgagccc--cccggctcggctgctgctagccacgtgc
A0A8C3KQJ2_BCL2L1-      cg--tcctcaacgggagcccctcctggcaccaac-ccgccagccacgt--
                            **     *   *****   *  *                *****  

A0A8C3K1C5_BCL2A1-      ------------------------------------cttgcgaaacattg
A0A8C3JHE5_BCL2-01      ccccggccgaggggctgcgccccgcgcc-------ccaggtggtccacct
A0A8C3KQJ2_BCL2L1-      -----agtgaacggagccaccgtgcaccggagaagcctggaagtccatga
                                                            *  *     **   

A0A8C3K1C5_BCL2A1-      catctt-----------------------cgct--------------gca
A0A8C3JHE5_BCL2-01      cacctt----------------------gcgcc-----aggcaggggacg
A0A8C3KQJ2_BCL2L1-      aatcgttcaaacagccgatgtgaggcaggcgctgagagaggcgggggatg
                         * * *                       ***                  

A0A8C3K1C5_BCL2A1-      agatcaaactgagg-------aggctctcagaccgttcctggacaagatt
A0A8C3JHE5_BCL2-01      agttctcccgccgctaccagagggactttgcccaaatgtccggccagctg
A0A8C3KQJ2_BCL2L1-      agtttgagttgaggtaccggcgggctttcagcgacctcacttcccagctc
                        ** *        *         **   *        *      * ** * 

A0A8C3K1C5_BCL2A1-      gatattacctcggtagctgt-tgccaagagaattttcaatggtgtcatgg
A0A8C3JHE5_BCL2-01      cacctgacccccttcacggc----caggggccgcttcgtggcggtggtgg
A0A8C3KQJ2_BCL2L1-      cacatcacccccggcacggcgtatcaga----gctttgagcaggtagtga
                         *  * *** *     * *     **        **       **  ** 

A0A8C3K1C5_BCL2A1-      aagaaaaatttgctgacggaaatactaactggggacgaattatgaccata
A0A8C3JHE5_BCL2-01      aggagctcttccgagacggg---gttaactggggcaggatcgtggccttc
A0A8C3KQJ2_BCL2L1-      acgaactcttccgcgatgga---gtgaactggggtcgcatcgtggctttc
                        * **    **    ** **       ********  * **  ** *  * 

A0A8C3K1C5_BCL2A1-      tttacatttggag--gtcttctcactaagaagcttcaagagcatggagtc
A0A8C3JHE5_BCL2-01      ttcgagttcggcggcgtgatgtgcgtggagagcgtcaa---ccgggagat
A0A8C3KQJ2_BCL2L1-      ttctccttcggaggagccttgtgtgtggagagcgttga---caaggagat
                        **    ** ** *  *   * *   *    *** *  *   *  ****  

A0A8C3K1C5_BCL2A1-      cagctgactggagaggagaaagagcagatttcttatttcatcacagagta
A0A8C3JHE5_BCL2-01      gtctcccctcgtggacagc--------atcgccgcctggatgaccgagta
A0A8C3KQJ2_BCL2L1-      gcgggtattggtgggacgc--------attgtatcttggatgaccacgta
                                * * *    *         **       *  ** **   ***

A0A8C3K1C5_BCL2A1-      cataatgaacaacaaagccgaatggatagatgcgaatggtggctgggaaa
A0A8C3JHE5_BCL2-01      cctgaaccggcacctgcacaactggatccaggacaacggaggctgggatg
A0A8C3KQJ2_BCL2L1-      cttgaccgaccacctagatccctggatccgggagaatggcggatgggagc
                        * * *      **         *****    *  ** ** ** *****  

A0A8C3K1C5_BCL2A1-      -----atggcttcct-----aacaaagtttgaa-----------------
A0A8C3JHE5_BCL2-01      ccttcgtggagttgtatggcaacagt------------------------
A0A8C3KQJ2_BCL2L1-      ggtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggc
                              ***     *     ***                           

A0A8C3K1C5_BCL2A1-      -agaagatcactactgtctttctccaaa---------------attacag
A0A8C3JHE5_BCL2-01      -atgaggcctttgttcgatttctcctggatctctctgaagactatcctga
A0A8C3KQJ2_BCL2L1-      caggagaccttcaacaaatggctcctga----ccggggcgacggtggcag
                         *  **  *         *  ****                   *     

A0A8C3K1C5_BCL2A1-      ccatgttcctggc-------tgttttctccttg--------ttcagagag
A0A8C3JHE5_BCL2-01      gtctggttctggtgggagcttgcatcactcttggcgcttatcttgga---
A0A8C3KQJ2_BCL2L1-      gagtgcttctgctgggatc----------cctg--------ctgagc---
                           ** * ***                  * **         *  *    

A0A8C3K1C5_BCL2A1-      tactactga
A0A8C3JHE5_BCL2-01      cataagtag
A0A8C3KQJ2_BCL2L1-      cgcaagtga
                            * *  

© 1998-2023Legal notice