Dataset for CDS BCL-2-like of organism Moschus moschiferus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6MJ03_BCL2A1-      atgtt--------------tcgccaggctccacaagcttgtgcttcagac
A0A8C6DX24_BCL2L1-      atg----------------tctcaga-----gcaaccgggagctggtggt
A0A8C6FN58_BCL2L1-      atg----------------tctcaga-----gcaactgggaactagtggt
A0A8C6CUC2_BCL2L2-      atggcgacccc------agcctcggccccagacacacgggctctagtggc
A0A8C6CUJ2_BCL2-01      atggcgcacgc---ggcgggcacaggctacgataaccgcgagatcgtgat
A0A8C6FJ57_BCL2L10      atggtggaccc--------gtttagg---------------gagcgcacc
A0A8C6E5E6_MCL1-01      atgttcggcctcaagagaaacgcagt---------------aatcggact
A0A8C6E5E6_MCL1-02      atgttcggcctcaagagaaacgcagt---------------aatcggact
                        ***                                               

A0A8C6MJ03_BCL2A1-      tgtcttggtcagttgcagg-----tgagcaggctcaagactctgctcc--
A0A8C6DX24_BCL2L1-      tgactttctctcttacaagctttcccagaaaggatacagctggagt----
A0A8C6FN58_BCL2L1-      tgactttctctcttacaagctttcccagaaaggatacatctggagt----
A0A8C6CUC2_BCL2L2-      agactttgtgggctataagctgaggcagaaggggtatgtttgtggagctg
A0A8C6CUJ2_BCL2-01      gaagtacatccactataagctgtcgcagcggggctacgagtgggacg---
A0A8C6FJ57_BCL2L10      gc---ccggctgct-------------gctggacta--cctggagttctg
A0A8C6E5E6_MCL1-01      ga---acctctactgtggg-----ggagccggactaggacagggcagcgg
A0A8C6E5E6_MCL1-02      ga---acctctactgtggg-----ggagccggactaggacagggcagcgg
                                     *             *   *   *              

A0A8C6MJ03_BCL2A1-      ----------ccagcaaggaga----------------------------
A0A8C6DX24_BCL2L1-      ------cagtttagtgatgtgg----------------------------
A0A8C6FN58_BCL2L1-      ------cagtttagtgatatgg----------------------------
A0A8C6CUC2_BCL2L2-      gcc-------ccggggagg-------------------------------
A0A8C6CUJ2_BCL2-01      ----------ccggggacgcgg----------------------------
A0A8C6FJ57_BCL2L10      cgc-------ccgggagcccggc---------------------------
A0A8C6E5E6_MCL1-01      cgcctcctctccgggggggcggcttttggttgcggggaaggaggccgcgg
A0A8C6E5E6_MCL1-02      cgcctcctctccgggggggcggctttt-----------------------
                                     *                                    

A0A8C6MJ03_BCL2A1-      ----------------------------------agatgactgagactga
A0A8C6DX24_BCL2L1-      ---------------------------------------aagaaaacaga
A0A8C6FN58_BCL2L1-      ---------------------------------------aagagaacaga
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      ------------------------------------------------gc
A0A8C6FJ57_BCL2L10      ------------------------------------------------gc
A0A8C6E5E6_MCL1-01      cgcggcgagaggtagggggaggggaagccggcacggtgattggcggaagc
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      gtttggctacgttcacaggctggccgaggactatctgaaatatgtgttgc
A0A8C6DX24_BCL2L1-      actgaggccccagaagggacagaatcagatatggaaacccccagtgccat
A0A8C6FN58_BCL2L1-      actgagaccacagaagggacagaatcagatatggaaaccctaaaagccat
A0A8C6CUC2_BCL2L2-      -----------------------------gcccagcagctgatccgctac
A0A8C6CUJ2_BCL2-01      gccgcgcc---ccccggggccgcccccgcgccgggcaccctgtccgccgc
A0A8C6FJ57_BCL2L10      gccagccc--------------------------------------ctgc
A0A8C6E5E6_MCL1-01      gccggcccgagccccccggccactcttgggcccgacgcccggagggtcgc
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      agatacagcaaactggatccaggccaagca---aaacatccagggtgtta
A0A8C6DX24_BCL2L1-      c-----------------aatggcaacccatcctggcacctggcggatag
A0A8C6FN58_BCL2L1-      c-----------------aatggcaacccatcctggcacctagcagatag
A0A8C6CUC2_BCL2L2-      a-----------------ccaagccatgcg--------------------
A0A8C6CUJ2_BCL2-01      g-----------------ccgggccgcgcgcccgcgcccgccaggacctc
A0A8C6FJ57_BCL2L10      g-----------------ccg---tccacgcctgaggctgccgtg--ctg
A0A8C6E5E6_MCL1-01      g-----------------cgg---ccctcgcccattggcgccgag--ggc
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      caagacgt------------------------------------------
A0A8C6DX24_BCL2L1-      ccctgcggtgaa--------------------------------------
A0A8C6FN58_BCL2L1-      ccctgcagtgaa--------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      cccgccgccgcc--------------------------------------
A0A8C6FJ57_BCL2L10      cgccacgt------------------------------------------
A0A8C6E5E6_MCL1-01      cccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacg
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A8C6FJ57_BCL2L10      --------------------------------------------------
A0A8C6E5E6_MCL1-01      cctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatca
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A8C6FJ57_BCL2L10      --------------------------------------------------
A0A8C6E5E6_MCL1-01      tgtcgcccgaagaggagctggacgggtgcgagccagaccctctcgggaag
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A8C6FJ57_BCL2L10      --------------------------------------------------
A0A8C6E5E6_MCL1-01      cggcctcccgtccggcctttacctttgttggtcggagaagccagtaacaa
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A8C6FJ57_BCL2L10      --------------------------------------------------
A0A8C6E5E6_MCL1-01      cagtccaggctcggacggctcgctgccctcgacgccgcccccggcagagg
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A8C6CUJ2_BCL2-01      --------------------------------------------------
A0A8C6FJ57_BCL2L10      --------------------------------------------------
A0A8C6E5E6_MCL1-01      aggaggaggacgagttatatcggcagtccctggagattatctctcagtac
A0A8C6E5E6_MCL1-02      --------------------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      -----------ggcttcctctgtccagaacga------------------
A0A8C6DX24_BCL2L1-      -----------tggagccactggccacagcagaagcttggatgcccggga
A0A8C6FN58_BCL2L1-      -----------gggagccactggccacagcagaagcttggacgcccggaa
A0A8C6CUC2_BCL2L2-      -----------ggcagctggagatgagttcgagaccc-------------
A0A8C6CUJ2_BCL2-01      -----------ggccgccgccgccgggcccgc----------gcccagcc
A0A8C6FJ57_BCL2L10      -----------ggccgcccgtgtccaggaagcaaatc-----gaaacgtc
A0A8C6E5E6_MCL1-01      ctccgggaacaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
A0A8C6E5E6_MCL1-02      -----------ggcaaccggcgccaaggacgcgaagcccctgggcgggtc
                                    *   *    *                            

A0A8C6MJ03_BCL2A1-      ------------------agtggaaaggactttgaagcagtgcttggata
A0A8C6DX24_BCL2L1-      agtgatccccatggcagcggtgaagcaagccctgagggaggcaggtgatg
A0A8C6FN58_BCL2L1-      aatgatccctgtgacaacagtaaagcaagccctggggcaggcaagcaatg
A0A8C6CUC2_BCL2L2-      ------------------gcttccggcgcaccttctccgatctggca--g
A0A8C6CUJ2_BCL2-01      cggtgccacctgt-----ggtccacctgaccctgcgccaggccggcgacg
A0A8C6FJ57_BCL2L10      ttgcccctcta--ccgccgctaccgcaggcaccgcgtcgagctggtg--g
A0A8C6E5E6_MCL1-01      tggggccaccagccggaaggcgttggagaccctgcgccgagttgg-g--g
A0A8C6E5E6_MCL1-02      tggggccaccagccggaaggcgttggagaccctgcgccgagttgg-g--g
                                                                          

A0A8C6MJ03_BCL2A1-      agtttgatgtggtgtccgtagacactgcca--------------------
A0A8C6DX24_BCL2L1-      agtttgaactgaggtaccgacgggca----------------ttcagcga
A0A8C6FN58_BCL2L1-      agtttgaactgaggtaccaacagaca----------------ttcagcga
A0A8C6CUC2_BCL2L2-      ctcagttgcatgtgaccccgggctcggccc--------------------
A0A8C6CUJ2_BCL2-01      acttctcccggcgctacc--gccgcgactt-cgccgagatgtccagccag
A0A8C6FJ57_BCL2L10      ccaggatg--gcgca-----gaggctgctc--------------------
A0A8C6E5E6_MCL1-01      atggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
A0A8C6E5E6_MCL1-02      atggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
                                                *                         

A0A8C6MJ03_BCL2A1-      -----------------------------gaacaat---------attca
A0A8C6DX24_BCL2L1-      cctgacgtcccagctccacatcaccccagggacagcatatcagagctttg
A0A8C6FN58_BCL2L1-      cctgacatcccagctccacatcaccccagggacagcatatcagagctttg
A0A8C6CUC2_BCL2L2-      -----------------------------agcaacg---------cttca
A0A8C6CUJ2_BCL2-01      ctgcacct----gacgcccttcaccgcgaggggacg---------cttcg
A0A8C6FJ57_BCL2L10      ------------gac--------------gaagac----------cctgg
A0A8C6E5E6_MCL1-01      ctggacatcaaaaac--------------gaagacgatgtcaaatctttg
A0A8C6E5E6_MCL1-02      ctggacatcaaaaac--------------gaagacgatgtcaaatctttg
                                                         *             *  

A0A8C6MJ03_BCL2A1-      accaag-tgatggaaaaggaatttgaagatggcgttgttaactggggcag
A0A8C6DX24_BCL2L1-      aacagg-tagtgaatgaactcttccgggacggggtga---actggggtcg
A0A8C6FN58_BCL2L1-      aacagg-taataaatgaactcctccgggacggggtga---gctggagtcg
A0A8C6CUC2_BCL2L2-      cccaggtctctgatgaactcttccaagggggcccca----actggggccg
A0A8C6CUJ2_BCL2-01      ccacgg-tggtggaggagctcttcagggacggcgtga---actgggggcg
A0A8C6FJ57_BCL2L10      ccccagctggggccgcgtggcctcactcgtg---------accttcgcgg
A0A8C6E5E6_MCL1-01      tctcgtgtgatggttcatgttttcagtgacggagtaacaaactggggcag
A0A8C6E5E6_MCL1-02      tctcgtgtgatggttcatgttttcagtgacggagtaacaaactggggcag
                                                      *          *    *  *

A0A8C6MJ03_BCL2A1-      gattgtaaccatattcgcctttgaaggtattcttatcaagaaacttcagg
A0A8C6DX24_BCL2L1-      cattgtggcctttttctccttcggtg------------gggcactgtgcg
A0A8C6FN58_BCL2L1-      cattgtggcctttttctccttcggtg------------gggcattatgca
A0A8C6CUC2_BCL2L2-      ccttgtggccttctttgtctttggag--cc----------gcgttgtgtg
A0A8C6CUJ2_BCL2-01      catcgtggccttctttgagttcggag------------gggtcatgtgtg
A0A8C6FJ57_BCL2L10      ggtcg---------ctgctagagagg--cctccgcagacgacccgacggc
A0A8C6E5E6_MCL1-01      gattgtgactcttatttcttttggtg--cctttg----tggccaaacact
A0A8C6E5E6_MCL1-02      gattgtgactcttatttcttttggtg--cctttg----tggccaaacact
                          * *                 *  *                        

A0A8C6MJ03_BCL2A1-      gcaagtgtattgccccagac------atgga--catgtgcaaggacattt
A0A8C6DX24_BCL2L1-      tggaaagcgtagacaaggag------atgcaggtattggtgagtcggatc
A0A8C6FN58_BCL2L1-      tgaaaagcatagacaaggag------atgcaggtattggtgagtcaggtc
A0A8C6CUC2_BCL2L2-      ctgagagtgtcaacaaggag------atggagccacttgtggga-----c
A0A8C6CUJ2_BCL2-01      tggagagcgtcaaccgggag------atgtcgcccctggtggacagcatc
A0A8C6FJ57_BCL2L10      tggagaagagagac---gacggcggcgt--------tagcagggactgtc
A0A8C6E5E6_MCL1-01      tgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatc
A0A8C6E5E6_MCL1-02      tgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatc
                           *             **        *          *           

A0A8C6MJ03_BCL2A1-      -------------cttactttgtggcagagttcatcaccgaaaacacagg
A0A8C6DX24_BCL2L1-      g------------caacttggatggccacttacctgaatgaccacctaga
A0A8C6FN58_BCL2L1-      a------------caacttggatggccacttacctaaatgaccacctaga
A0A8C6CUC2_BCL2L2-      aagtgcaggag-------tggatggtggcctacctggagacgcgactggc
A0A8C6CUJ2_BCL2-01      g------------ccctgtggatgaccgagtacctgaaccggcacctgca
A0A8C6FJ57_BCL2L10      ggctcctggtggcccttctgtgtgctc-agttctgcgaaaggcac---cg
A0A8C6E5E6_MCL1-01      a----cagatg---ttctcgtaaggtc-aa-------------aa---cg
A0A8C6E5E6_MCL1-02      a----cagatg---ttctcgtaaggtc-aa-------------aa---cg
                                               *                          

A0A8C6MJ03_BCL2A1-      agagtggataaggcaaaatggaggctgggaaaatggttttgtaaagaagt
A0A8C6DX24_BCL2L1-      gccttggatccaggagaacggcggctggg---acacttttgtggaactct
A0A8C6FN58_BCL2L1-      gccttggatccaggagaatggcgactggg---acacttttgtggaactct
A0A8C6CUC2_BCL2L2-      tgactggatccacagcagcgggggctggg---cggagttcacagctctat
A0A8C6CUJ2_BCL2-01      cgcctggatccaggacaacggaggctggg---acgcctttgtggagctgt
A0A8C6FJ57_BCL2L10      cgcctggctgctggcgaacggcggctggg---atggatttt----gtctc
A0A8C6E5E6_MCL1-01      agactggatagtcaaacaaagaggctggg---atgggtttgtggagttct
A0A8C6E5E6_MCL1-02      agactggatagtcaaacaaagaggctggg---atgggtttgtggagttct
                            *** *           * * *****        **           

A0A8C6MJ03_BCL2A1-      ttgaaatcaaa--tctggctggctga---------------------ctt
A0A8C6DX24_BCL2L1-      acgggaacaacgcagcagctgagagc------------------------
A0A8C6FN58_BCL2L1-      acgaaaacaatacagcaaccgagagc------------------------
A0A8C6CUC2_BCL2L2-      acggggacggggccctgg-aggaggcac----------------------
A0A8C6CUJ2_BCL2-01      --------atggccctagcatgcggc----------ccctgtttgatttc
A0A8C6FJ57_BCL2L10      tcc---------------------------------ttcagcc--actca
A0A8C6E5E6_MCL1-01      tccatgtagaggacctagaaggtggcatcagaaatgtcctgct--ggctt
A0A8C6E5E6_MCL1-02      tccatgtagaggacctagaaggtggcatcagaaatgtcctgct--ggctt
                                                                          

A0A8C6MJ03_BCL2A1-      ttctggaagttacaggaaa-------------gatct-------------
A0A8C6DX24_BCL2L1-      ---cggaagggccaggagcgcttcaaccgct-ggttcct-----------
A0A8C6FN58_BCL2L1-      ---cagaagggccaagagcgcttcagctgct-ggtccct-----------
A0A8C6CUC2_BCL2L2-      -----ggcgtctgcgggagg-----ggaactgggcctcagtgaggacagt
A0A8C6CUJ2_BCL2-01      tcctggctgtctctgaaggc-----actgctcagtct-------------
A0A8C6FJ57_BCL2L10      ttgcagccatcttgggaaag-----acagct-ggtct-------------
A0A8C6E5E6_MCL1-01      ttgcaggtgttgccggagta-----ggagct-ggttt-------------
A0A8C6E5E6_MCL1-02      ttgcaggtgttgccggagta-----ggagct-ggttt-------------
                             *                                            

A0A8C6MJ03_BCL2A1-      ------gtgaaacattatgtcgcctgaagcaat-----------------
A0A8C6DX24_BCL2L1-      ------gacgggcatgactgtggctggtgtggttctgcttggctcgctct
A0A8C6FN58_BCL2L1-      ------gatggacatgactgtg--tggtatggttctgctgggcttgcttt
A0A8C6CUC2_BCL2L2-      gctgacgggggccgtggcactgggggccctggtgaccgtaggggcctttt
A0A8C6CUJ2_BCL2-01      ------ggc------cctggtgggcgcttgcatcaccctgggtgcctatc
A0A8C6FJ57_BCL2L10      ------ggtttttcttctcatactggacagcaataatcataatctacttc
A0A8C6E5E6_MCL1-01      ------ggcatatct----------------aataa--------------
A0A8C6E5E6_MCL1-02      ------ggcatatct----------------aataa--------------
                              *                                           

A0A8C6MJ03_BCL2A1-      ------acta-------ttga-----------------------------
A0A8C6DX24_BCL2L1-      tcagtcggaa-------atga-----------------------------
A0A8C6FN58_BCL2L1-      tcaactcata-------ataactattccttttgttatagtcattcaaatt
A0A8C6CUC2_BCL2L2-      tcgctagcaa-------gtga-----------------------------
A0A8C6CUJ2_BCL2-01      tgggccataa-------gtga-----------------------------
A0A8C6FJ57_BCL2L10      tgg---ataaaattatcatga-----------------------------
A0A8C6E5E6_MCL1-01      --g---atag----------------------------------------
A0A8C6E5E6_MCL1-02      --g---atag----------------------------------------
                                                                          

A0A8C6MJ03_BCL2A1-      ---------
A0A8C6DX24_BCL2L1-      ---------
A0A8C6FN58_BCL2L1-      ttatactag
A0A8C6CUC2_BCL2L2-      ---------
A0A8C6CUJ2_BCL2-01      ---------
A0A8C6FJ57_BCL2L10      ---------
A0A8C6E5E6_MCL1-01      ---------
A0A8C6E5E6_MCL1-02      ---------
                                 

© 1998-2022Legal notice