Dataset for CDS MCL-1 of organism Seriola dumerili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4T8L9_MCL1-01      atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaacta
A0A3B4T8L9_MCL1-02      atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaacta

A0A3B4T8L9_MCL1-01      ttgcatttgtcgtcaaaatggaggattggaaacttggaccgacggctccg
A0A3B4T8L9_MCL1-02      ttgcatttgtcgtcaaaatggaggattggaaacttggaccgacggctccg

A0A3B4T8L9_MCL1-01      gagactcctcgccggagattgccattggctctacaatatgttctcacaac
A0A3B4T8L9_MCL1-02      gagactcctcgccggagattgccattggctctacaatatgttctcacaac

A0A3B4T8L9_MCL1-01      gggaatgttgtgccaaatgataattctaaacggcccaagagcctggaagt
A0A3B4T8L9_MCL1-02      gggaatgttgtgccaaatgataattctaaacggcccaagagcctggaagt

A0A3B4T8L9_MCL1-01      cacctcaacaaatgggtatgcaacaaaagcgagtcgggaggacagcgacg
A0A3B4T8L9_MCL1-02      cacctcaacaaatgggtatgcaacaaaagcgagtcgggaggacagcgacg

A0A3B4T8L9_MCL1-01      tcgacgacggctctttgccgtgtactccggagattcagtcggacggagaa
A0A3B4T8L9_MCL1-02      tcgacgacggctctttgccgtgtactccggagattcagtcggacggagaa

A0A3B4T8L9_MCL1-01      accgatgtccctagttgtccagcaggggatgaagtgttggaggacgatac
A0A3B4T8L9_MCL1-02      accgatgtccctagttgtccagcaggggatgaagtgttggaggacgatac

A0A3B4T8L9_MCL1-01      gaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac
A0A3B4T8L9_MCL1-02      gaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac

A0A3B4T8L9_MCL1-01      cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggac
A0A3B4T8L9_MCL1-02      cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggac

A0A3B4T8L9_MCL1-01      ggcgttttggaaaaacacagatacgcatacaatggtatgatcaacaaact
A0A3B4T8L9_MCL1-02      ggcgttttggaaaaacacagatacgcatacaatggtatgatcaacaaact

A0A3B4T8L9_MCL1-01      gtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcga
A0A3B4T8L9_MCL1-02      gtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcga

A0A3B4T8L9_MCL1-01      agagcctgttcgcagatggcaccacaaactggggtcgcatcgccagcctg
A0A3B4T8L9_MCL1-02      agagcctgttcgcagatggcaccacaaactggggtcgcatcgccagcctg

A0A3B4T8L9_MCL1-01      gtggccttcggggcggtggtgtgtcagcgcatgaaggagacaggcaggga
A0A3B4T8L9_MCL1-02      gtggccttcggggcggtggtgtgtcagcgcatgaaggagacaggcaggga

A0A3B4T8L9_MCL1-01      gaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctg
A0A3B4T8L9_MCL1-02      gaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctg

A0A3B4T8L9_MCL1-01      atcagcgagactggctggtgaaaaacaactcctgggatggctttgtagcg
A0A3B4T8L9_MCL1-02      atcagcgagactggctggtgaaaaacaactcctgggatggctttgtagcg

A0A3B4T8L9_MCL1-01      ttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc
A0A3B4T8L9_MCL1-02      ttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc

A0A3B4T8L9_MCL1-01      ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcag--
A0A3B4T8L9_MCL1-02      ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcaggt

A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      gtttgtttgagcggtccaggccaaagcaggaagggaaaattgcatttttt

A0A3B4T8L9_MCL1-01      ----cgccatga---tgtga----------------------------
A0A3B4T8L9_MCL1-02      ccaatgtcatgcagtcgtgaagcccatttccatagagctcattcataa
                             * ****     ****                            

© 1998-2023Legal notice