Dataset for CDS BCL-2-like of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6QF32_BCL2A1-      atgactgac-----------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      atggcg--------------------------------------------
A0A8C6RID6_BCL2-02      atggcg--------------------------------------------
A0A8C6QA84_MCL1-01      atgtttggcctgagaaggaacgcggtaatcggcctcaacctgtactgcgg
A0A8C6WBP6_BCL2L10      at------------------------------------------------
A0A8C6W748_BCL2L1-      a-------------------------------------------------
A0A8C6RJE0_BCL2L2-      atggcgaccccag-------------------------------------
A0A8C6RJE0_BCL2L2-      atggcgaccccag-------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      -----------------------------------tgtgaattcacatct
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      ------------------------------cacgccggcagaacagggta
A0A8C6RID6_BCL2-02      ------------------------------cacgccggcagaacagggta
A0A8C6QA84_MCL1-01      gggcgccagcctcgcggcaggcggcagttctccggcgggagcgc------
A0A8C6WBP6_BCL2L10      ----------------------ggcagatcccctgcgggagcgc------
A0A8C6W748_BCL2L1-      ---------------------------------tgtctcagagc------
A0A8C6RJE0_BCL2L2-      -----------------------------cctctgccccaga-c------
A0A8C6RJE0_BCL2L2-      -----------------------------cctctgccccaga-c------
                                                                          

A0A8C6QF32_BCL2A1-      gtctactctttggctgaggactatctt---------------------ca
A0A8C6R201_BCL2A1-      ---tactctttggctgaggactatctt---------------------ca
A0A8C6RID6_BCL2-01      tgataaccgggagattgtgatgaagta-----------------------
A0A8C6RID6_BCL2-02      tgataaccgggagattgtgatgaagta-----------------------
A0A8C6QA84_MCL1-01      ----gcctggtggccgagg--aggccaaggcacggtgcgaggggggaggg
A0A8C6WBP6_BCL2L10      ----acccggcagctgctgatagacta-----------------------
A0A8C6W748_BCL2L1-      ----aaccgggagctggtggttgactt-----------------------
A0A8C6RJE0_BCL2L2-      ----acacgggctctggtggctgactt-----------------------
A0A8C6RJE0_BCL2L2-      ----acacgggctctggtggctgactt-----------------------
                                          *                               

A0A8C6QF32_BCL2A1-      gtatgtcctacaagttcccttg----------------------tttg--
A0A8C6R201_BCL2A1-      gtatgtcctacaagttccctcg----------------------tttg--
A0A8C6RID6_BCL2-01      -catccactataagctgtcacagaggggctacg---aatgggatgctg--
A0A8C6RID6_BCL2-02      -catccactataagctgtcacagaggggctacg---aatgggatgctg--
A0A8C6QA84_MCL1-01      gaggccggcgcgggctcgggcggaagtgtgagcggccctgcagccctg--
A0A8C6WBP6_BCL2L10      --------------------------------------------cctg--
A0A8C6W748_BCL2L1-      -tctctcgtacaagctttcccagaaaggataca-----------gctgga
A0A8C6RJE0_BCL2L2-      -tgtaggctataagctgaggcagaagggttatg-----------tctg--
A0A8C6RJE0_BCL2L2-      -tgtaggctataagctgaggcagaagggttatg-----------tctg--
                                                                      **  

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      ------------------------------------------gagatgcg
A0A8C6RID6_BCL2-02      ------------------------------------------gagatgcg
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      gtcagttcagtgatgtcgaagagaacaggactgaggccccagaaggaact
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      gacgccgcgcccctgggggccacccccgccccgggcatcttttcttcctt
A0A8C6RID6_BCL2-02      gacgccgcgcccctgggggccacccccgccccgggcatcttttcttcctt
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      gaatcagagagggagacccccagtgccatcaatggcaacccatcctggca
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      -----------------------------------------aatcggctc
A0A8C6R201_BCL2A1-      -----------------------------------------aatcggctc
A0A8C6RID6_BCL2-01      gcctgggagcaacccaaccg------------ccgctgtgcaccaggacc
A0A8C6RID6_BCL2-02      gcctgggagcaacccaaccg------------ccgctgtgcaccaggacc
A0A8C6QA84_MCL1-01      --------------------------------ctgccagacgcgcgg---
A0A8C6WBP6_BCL2L10      --------------------------------ctgttctgcgcacgg---
A0A8C6W748_BCL2L1-      tctggtggacagccccgcggtgaatggagccactggc-----cacagcag
A0A8C6RJE0_BCL2L2-      ------------------------tggag---ctggc-----cccgg---
A0A8C6RJE0_BCL2L2-      ------------------------tggag---ctggc-----cccgg---
                                                                      *   

A0A8C6QF32_BCL2A1-      caagcaaaacgtccagagtgctacaaaaagttgct---------------
A0A8C6R201_BCL2A1-      caa---------------------------ttgtt---------------
A0A8C6RID6_BCL2-01      cagccgccaggacctcgccgccgcgcctcccggctgcaatggctgggcag
A0A8C6RID6_BCL2-02      cagccgccaggacctcgccgccgcgcctcccggctgcaatggctgggcag
A0A8C6QA84_MCL1-01      -ag----ggtcgcgcggccgccgcccattggcgccgaagtccccg-----
A0A8C6WBP6_BCL2L10      -gaac-caggcacccgggagctgc-------caccgagctc---------
A0A8C6W748_BCL2L1-      cagtt-tggatgcccgggagctgatccccatggttgcagtg---------
A0A8C6RJE0_BCL2L2-      ------ggaaggcccagcagccgaccctc----------tg---------
A0A8C6RJE0_BCL2L2-      ------ggaaggcccagcagccgaccctc----------tg---------
                                                                          

A0A8C6QF32_BCL2A1-      ---------------------------ttctcagtccaaaaagaagttga
A0A8C6R201_BCL2A1-      ---------------------------ttctcagtccaaaaagaagttga
A0A8C6RID6_BCL2-01      gcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctgg
A0A8C6RID6_BCL2-02      gcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctgg
A0A8C6QA84_MCL1-01      -----------------------acgtcaccgcgacccccgagaagctga
A0A8C6WBP6_BCL2L10      ---------------------------cagcgaggccgccg------tgc
A0A8C6W748_BCL2L1-      ---------------------------aagcaagcgctaagagaggctgg
A0A8C6RJE0_BCL2L2-      ---------------------------caccaagccatgcgggcagctgg
A0A8C6RJE0_BCL2L2-      ---------------------------caccaagccatgcgggcagctgg
                                                                       ** 

A0A8C6QF32_BCL2A1-      aa--------agaatctgaaacca---------------------tactt
A0A8C6R201_BCL2A1-      ac--------agaatctgaaacta---------------------tactt
A0A8C6RID6_BCL2-01      gg--------atgacttctcccgtcgt------------------taccg
A0A8C6RID6_BCL2-02      gg--------atgacttctcccgtcgt------------------taccg
A0A8C6QA84_MCL1-01      tgctcttcccagcgggtcgtgcgtcgccgcctgaggacatggccgcgccg
A0A8C6WBP6_BCL2L10      tgcgctcggtagcggcacagaccctgcagctc-------------cacca
A0A8C6W748_BCL2L1-      gg--------atgagtttgaactgcgg------------------taccg
A0A8C6RJE0_BCL2L2-      ag--------atgagtttgagacccgc------------------ttccg
A0A8C6RJE0_BCL2L2-      ag--------atgagtttgagacccgc------------------ttccg
                                  *                                    *  

A0A8C6QF32_BCL2A1-      ggacaattttgatgtggt--------------------------------
A0A8C6R201_BCL2A1-      ggacaattttgatgttgt--------------------------------
A0A8C6RID6_BCL2-01      ccgcgacttcgcagagat--------------------------------
A0A8C6RID6_BCL2-02      ccgcgacttcgcagagat--------------------------------
A0A8C6QA84_MCL1-01      gccgccgccatcatgtctcctgaggaggagttggacggctacgaacccga
A0A8C6WBP6_BCL2L10      gcccttcttctcctccttcc--------------gcggctacca------
A0A8C6W748_BCL2L1-      gcgggcattcagtgacct--------------------------------
A0A8C6RJE0_BCL2L2-      gcgcaccttctctgatct--------------------------------
A0A8C6RJE0_BCL2L2-      gcgcaccttctctgatct--------------------------------
                                         *                                

A0A8C6QF32_BCL2A1-      -----------------------------atccatagatacagctagaac
A0A8C6R201_BCL2A1-      -----------------------------acccacagatacagctagtac
A0A8C6RID6_BCL2-01      -----------gtccagccagctgcacctgacgcccttcaccgcgagggg
A0A8C6RID6_BCL2-02      -----------gtccagccagctgcacctgacgcccttcaccgcgagggg
A0A8C6QA84_MCL1-01      gccgctcgggaagcggccggccgtgctacccctgcgggggctggtcggcg
A0A8C6WBP6_BCL2L10      -------gggcaacagt-----------------ctggagctg-------
A0A8C6W748_BCL2L1-      -----------aacatcccagcttcatataaccccggggacagcatatca
A0A8C6RJE0_BCL2L2-      -----------agccgctcagctgcatgtgaccccaggctcagcccagca
A0A8C6RJE0_BCL2L2-      -----------agccgctcagctgcatgtgaccccaggctcagcccagca
                                                                * *       

A0A8C6QF32_BCL2A1-      aata-----------ttcaatcaagtgat---------------------
A0A8C6R201_BCL2A1-      aata-----------ttcaatcaagtgat---------------------
A0A8C6RID6_BCL2-01      acgc-----------ttcgtcacggtggt---------------------
A0A8C6RID6_BCL2-02      acgc-----------ttcgtcacggtggt---------------------
A0A8C6QA84_MCL1-01      aggcggcgaagagctcgggcactgacggctcgctgccctccacgccgccg
A0A8C6WBP6_BCL2L10      ---------------ctgtcacagatggc---------------------
A0A8C6W748_BCL2L1-      gagc-----------tttgaacaggtagt---------------------
A0A8C6RJE0_BCL2L2-      acgc-----------ttcacccaggtgtc---------------------
A0A8C6RJE0_BCL2L2-      acgc-----------ttcacccaggtgtc---------------------
                                                                          

A0A8C6QF32_BCL2A1-      --------------ggaaaaagaatttga---------------------
A0A8C6R201_BCL2A1-      --------------ggaaaaagaatttga---------------------
A0A8C6RID6_BCL2-01      --------------ggaggagctcttcag---------------------
A0A8C6RID6_BCL2-02      --------------ggaggagctcttcag---------------------
A0A8C6QA84_MCL1-01      ccggtcgaggaggacgacgagctgtaccgccagtcgctggcgatcatctc
A0A8C6WBP6_BCL2L10      -----------ggatgtcgtgttgtccgacca------------------
A0A8C6W748_BCL2L1-      --------------gaatgaactcttccg---------------------
A0A8C6RJE0_BCL2L2-      --------------cgacgaacttttcca---------------------
A0A8C6RJE0_BCL2L2-      --------------cgacgaacttttcca---------------------
                                                *                         

A0A8C6QF32_BCL2A1-      -------------------------------------agatggtatt---
A0A8C6R201_BCL2A1-      -------------------------------------agatggtatc---
A0A8C6RID6_BCL2-01      -------------------------------------ggatggggtg---
A0A8C6RID6_BCL2-02      -------------------------------------ggatggggtg---
A0A8C6QA84_MCL1-01      ccggtacctgcgcgagcaggccacaggcgccaaggacgcgaagcctctgg
A0A8C6WBP6_BCL2L10      -------------------------------------gcaaagcctc---
A0A8C6W748_BCL2L1-      -------------------------------------agatggggta---
A0A8C6RJE0_BCL2L2-      -------------------------------------agggggcccc---
A0A8C6RJE0_BCL2L2-      -------------------------------------agggggcccc---
                                                                  *       

A0A8C6QF32_BCL2A1-      -attaactgggggaggattgtgaccatatt--------------------
A0A8C6R201_BCL2A1-      -attaactgggggaggattgtgaccatatt--------------------
A0A8C6RID6_BCL2-01      ----aactgggggaggattgtggccttctt--------------------
A0A8C6RID6_BCL2-02      ----aactgggggaggattgtggccttctt--------------------
A0A8C6QA84_MCL1-01      gcggggcgggggcggcgggccggagggcgttggagacccttcggcgagtg
A0A8C6WBP6_BCL2L10      ----aactggggcagagtggtagtgcttgt--------------------
A0A8C6W748_BCL2L1-      ----aactggggtcgcattgtggccttttt--------------------
A0A8C6RJE0_BCL2L2-      ----aactggggtcgtcttgtggcattctt--------------------
A0A8C6RJE0_BCL2L2-      ----aactggggtcgtcttgtggcattctt--------------------
                              * ****  *              *                    

A0A8C6QF32_BCL2A1-      -----------------------------tgcttttggggg--tgttctc
A0A8C6R201_BCL2A1-      -----------------------------tgcttttggggg--tgttttc
A0A8C6RID6_BCL2-01      -----------------------------tgagttcggtgg--ggtcatg
A0A8C6RID6_BCL2-02      -----------------------------tgagttcggtgg--ggtcatg
A0A8C6QA84_MCL1-01      ggcgacggtgtgcagcgcaaccacgaaacggccttccaaggcatgcttcg
A0A8C6WBP6_BCL2L10      -----------------------------ggccttcgctggcatgctcct
A0A8C6W748_BCL2L1-      -----------------------------ctcctttggcgg--tgcactg
A0A8C6RJE0_BCL2L2-      -----------------------------tgtctttggggc--tgccttg
A0A8C6RJE0_BCL2L2-      -----------------------------tgtctttggggc--tgccttg
                                                         **    *    *     

A0A8C6QF32_BCL2A1-      ctcaagaaactt--ccacaagagcagatggacttggatgtggatacttac
A0A8C6R201_BCL2A1-      ctcaaggaactt--ccacaagagcagatggacttggatgtggatacctac
A0A8C6RID6_BCL2-01      tgtgtggagagc--gtcaacagggagatg------------------tca
A0A8C6RID6_BCL2-02      tgtgtggagagc--gtcaacagggagatg------------------tca
A0A8C6QA84_MCL1-01      gaaactggacat---taaaaatgaagatgatgtcaaatctttgtctcgag
A0A8C6WBP6_BCL2L10      ggatcaaagcccttgtaagaataccaaggg-----------------gag
A0A8C6W748_BCL2L1-      tgtgtggaaagc--gtagacaaggagatg------------------cag
A0A8C6RJE0_BCL2L2-      tgtgctgagagt--gtcaacaaagagatg------------------gag
A0A8C6RJE0_BCL2L2-      tgtgctgagagt--gtcaacaaagagatg------------------gag
                                                  * *                     

A0A8C6QF32_BCL2A1-      aagcaagtttctta------------------------------------
A0A8C6R201_BCL2A1-      aagcaagtttcttg------------------------------------
A0A8C6RID6_BCL2-01      ccgctggtggacaacatcgc------------------------------
A0A8C6RID6_BCL2-02      ccgctggtggacaacatcgc------------------------------
A0A8C6QA84_MCL1-01      tgatgg--tccatgttttcagtgacggcgtaacaaactggggcaggattg
A0A8C6WBP6_BCL2L10      gaataggctccatgtgctccgggac-------------------------
A0A8C6W748_BCL2L1-      gtattggtgagtcggatcgcaag---------------------------
A0A8C6RJE0_BCL2L2-      ccactggtgggacaagtgcagga---------------------------
A0A8C6RJE0_BCL2L2-      ccactggtgggacaagtgcagga---------------------------
                                                                          

A0A8C6QF32_BCL2A1-      ------------------------ttttgtggctgaattcat--------
A0A8C6R201_BCL2A1-      ------------------------ttttgtggctgaattcat--------
A0A8C6RID6_BCL2-01      ---------------------cctctggatgaccgactacct--------
A0A8C6RID6_BCL2-02      ---------------------cctctggatgaccgactacct--------
A0A8C6QA84_MCL1-01      tgactctgatttcttttggtgccttt--gtggccaaacacttgaagagca
A0A8C6WBP6_BCL2L10      -------------------tgcctttacatggtggacctcct-------a
A0A8C6W748_BCL2L1-      ------------------------ttggatggccacttacct--------
A0A8C6RJE0_BCL2L2-      ------------------------ttggatggtgacctacct--------
A0A8C6RJE0_BCL2L2-      ------------------------ttggatggtgacctacct--------
                                                 *   **        * *        

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      taaaccaagaaagttgcatcgacccattagcagaaagtatcacagatgtt
A0A8C6WBP6_BCL2L10      tgtac-------------tcgcctcact----------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      -------aatgaataacacaggagaatggatacgtcaaaatggaggttgg
A0A8C6R201_BCL2A1-      -------aaagaataacacaggagaatggatacgtcaaaatggaggttgg
A0A8C6RID6_BCL2-01      -------gaaccggcacctgcacacctggatccaggataacggaggctgg
A0A8C6RID6_BCL2-02      -------gaaccggcacctgcacacctggatccaggataacggaggctgg
A0A8C6QA84_MCL1-01      cttgtaaggacaa-aacgagactggctagtcaaacaaaaa----ggctgg
A0A8C6WBP6_BCL2L10      -------ggacggcaccgtgcttggctggaagctcaggat----gactgg
A0A8C6W748_BCL2L1-      -------gaatgaccacctagagccttggatccaggagaacggcggctgg
A0A8C6RJE0_BCL2L2-      -------ggagacgcgcctggctgactggatccacagcagtgggggctgg
A0A8C6RJE0_BCL2L2-      -------ggagacgcgcctggctgactggatccacagcagtgggggctgg
                                        *         * *         *     *  ***

A0A8C6QF32_BCL2A1-      gaag--------------atggcttca-----------------------
A0A8C6R201_BCL2A1-      gtat--------------atggcttca-----------------------
A0A8C6RID6_BCL2-01      ---g--------------atgcctttg-----------------------
A0A8C6RID6_BCL2-02      gtag--------------gtgcacatc-----------------------
A0A8C6QA84_MCL1-01      ---g--------------atgggtttg-----------------------
A0A8C6WBP6_BCL2L10      ---g--------------atggctttt-----------------------
A0A8C6W748_BCL2L1-      ---g--------------acacttttg-----------------------
A0A8C6RJE0_BCL2L2-      ---gagctagaagcgatcaaagctcgagtcagggagatggaggaagaggc
A0A8C6RJE0_BCL2L2-      ---gcg------gagttcacagctctatacgggga---------------
                                                                          

A0A8C6QF32_BCL2A1-      ----------------taaggaaatttgaacctaagt-------------
A0A8C6R201_BCL2A1-      ----------------taaggaagtttgaacctaagt-------------
A0A8C6RID6_BCL2-01      tggaact---------gtatggacccagtgtgcggcccctgtttgacttc
A0A8C6RID6_BCL2-02      tg--act---------gaaggagtctgggtttcgg---------------
A0A8C6QA84_MCL1-01      tggagttcttccacgtacaggacc---------------tagaaggcggc
A0A8C6WBP6_BCL2L10      gccgcttcttc-----agaagacccttcccactgagtttttggaggagac
A0A8C6W748_BCL2L1-      tggaactct-------atgggaac-----aac-------------gcagc
A0A8C6RJE0_BCL2L2-      cgagaagct-------aaaggagc-----tacagaacgaggtggagaagc
A0A8C6RJE0_BCL2L2-      cggggccct-------ggaggagg-----cgcggcgtctgcgggagggg-
                                            *                             

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      tcttggctgtctctgaagaccctgctcagtctggc---------------
A0A8C6RID6_BCL2-02      ----------------------tgatcatttt------------------
A0A8C6QA84_MCL1-01      atcag---------------aaatgtgctgc-------------------
A0A8C6WBP6_BCL2L10      -------------------------tgctgctcca---------------
A0A8C6W748_BCL2L1-      agctgagagtcggaaaggccaggagcgcttcaacc---------------
A0A8C6RJE0_BCL2L2-      agatgaatatgagtccacccccaggcaatgctggcccagtgattatgtct
A0A8C6RJE0_BCL2L2-      aactgggcatcagt------gaggacagtgctgac---------------
                                                                          

A0A8C6QF32_BCL2A1-      -------------------ctggc-----------------tggctgact
A0A8C6R201_BCL2A1-      -------------------ctggc-----------------tggctgact
A0A8C6RID6_BCL2-01      ------------------cctggtag---------------gggcctgca
A0A8C6RID6_BCL2-02      -------------------ctggt--------------------------
A0A8C6QA84_MCL1-01      --------------------tggctt---------------ttgcaggtg
A0A8C6WBP6_BCL2L10      ------------------gatgtttt---------------tatcatgct
A0A8C6W748_BCL2L1-      ------------------gctggttcc--------------tgacgggca
A0A8C6RJE0_BCL2L2-      attgaggagaagatggaggctgatgcccgctctatctatgttggcaatgt
A0A8C6RJE0_BCL2L2-      --------------gggggctg-------------------tggcactgg
                                            **                            

A0A8C6QF32_BCL2A1-      tttctggaag-----------------------------------tcatg
A0A8C6R201_BCL2A1-      tttctggaag-----------------------------------tcatg
A0A8C6RID6_BCL2-01      tcaccctggg--------------------------------------tg
A0A8C6RID6_BCL2-02      --accctggg----------------------------------------
A0A8C6QA84_MCL1-01      ttgctggagt---------------------------aggggctggtttg
A0A8C6WBP6_BCL2L10      tctttgcaat---------------------------a------ggcata
A0A8C6W748_BCL2L1-      tgactgtggc---------------------------------tggtgtg
A0A8C6RJE0_BCL2L2-      ggactatggtgcaacagcagaagagctggaagctcactttcatggctgtg
A0A8C6RJE0_BCL2L2-      gggccctggt----------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      ggac----------------------------agatctgggaactgat--
A0A8C6R201_BCL2A1-      ggac----------------------------agatctgggaattgat--
A0A8C6RID6_BCL2-01      ccta----------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      gcat----------------------------------------------
A0A8C6WBP6_BCL2L10      ctat----------------------------------------------
A0A8C6W748_BCL2L1-      gttc-------------------------------ttctgggttcact--
A0A8C6RJE0_BCL2L2-      gttcggtcaaccgtgttactatactctgtgacaaatttagtggccatccc
A0A8C6RJE0_BCL2L2-      --------------------------------aactgtaggggcctt---
                                                                          

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      aaagggtttgcatatatagagttctcagacaaagagtcagtgaggacttc
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      cctggccttagatgagtctctgtttagaggaagacaaatcaaggtgatcc
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      ccaaacgaaccaacagaccaggtatcagcacaacagaccggggcttccca
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      --------------------------------------------------
A0A8C6R201_BCL2A1-      --------------------------------------------------
A0A8C6RID6_BCL2-01      --------------------------------------------------
A0A8C6RID6_BCL2-02      --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C6WBP6_BCL2L10      --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      cgtgctcgttaccgtgccaggactaccaactacaacagttcccgttctcg
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6QF32_BCL2A1-      ------------ctttctcctgaag-------------------------
A0A8C6R201_BCL2A1-      ------------ctttctcctgaag-------------------------
A0A8C6RID6_BCL2-01      ------------tttgggccacaag-------------------------
A0A8C6RID6_BCL2-02      ----------------------agg-------------------------
A0A8C6QA84_MCL1-01      ------------atctaataag----------------------------
A0A8C6WBP6_BCL2L10      ------------atttgtggaaacg-------------------------
A0A8C6W748_BCL2L1-      ------------ctttagccggaag-------------------------
A0A8C6RJE0_BCL2L2-      attctacagtggttttaacagcaggccccggggtcgagtctacaggggcc
A0A8C6RJE0_BCL2L2-      ------------ttttgccagcaag-------------------------
                                                                          

A0A8C6QF32_BCL2A1-      -----------------------caccatcattga
A0A8C6R201_BCL2A1-      -----------------------------------
A0A8C6RID6_BCL2-01      --------------------------------tga
A0A8C6RID6_BCL2-02      --------------------------------tag
A0A8C6QA84_MCL1-01      -------------------------------atag
A0A8C6WBP6_BCL2L10      ----------------------------attataa
A0A8C6W748_BCL2L1-      --------------------------------tga
A0A8C6RJE0_BCL2L2-      gggctagagcgacatcatggtattccccttactaa
A0A8C6RJE0_BCL2L2-      --------------------------------tga
                                                           

© 1998-2022Legal notice