Dataset for CDS BCL-2-like of organism Pelusios castaneus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8SUC3_BCL2A1-      atggaaagctccga---gtaccgttatgttt-------------------
A0A8C8S850_BCL2L1-      atgtcgaacactaacagggaat-tagtgattgacttta------------
A0A8C8RUG9_MCL1-01      at-gttggcgctgaagcggaacgctgtgatcggcctcaacatttactgcg
A0A8C8SWU7_BCL2-01      atggctcatcctgggagaagaggctatgat--------------------
                        **        *               ** *                    

A0A8C8SUC3_BCL2A1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
A0A8C8RUG9_MCL1-01      gagggggcccggcgctggcgccctcctcgccggcttctgccagcggcggc
A0A8C8SWU7_BCL2-01      -----aaccgggagatagt--------------------------gcaga
                                                                          

A0A8C8SUC3_BCL2A1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      ------tatcctacaag-----------ctatcgcagaggggatacagct
A0A8C8RUG9_MCL1-01      ggcgccccccctgctcccaccggcccttcttccacggagggcgttcggcc
A0A8C8SWU7_BCL2-01      aatacatccattacaaa-----------ctgtcacagagaggatatgatt
                                                                          

A0A8C8SUC3_BCL2A1-      ------actatttagtccaa------------------gattatctgaaa
A0A8C8S850_BCL2L1-      ggag--tcagttccacgcagaggatgagaacaggactgagtttgccgagg
A0A8C8RUG9_MCL1-01      ggcgacgctgattggcggagacccttggggtcccaacggtccttctgagg
A0A8C8SWU7_BCL2-01      gg----gctg-ccagtgaaaac-------atagcaccagtttctccaa--
                               *          *                         *  *  

A0A8C8SUC3_BCL2A1-      tacatt--------------------------------------------
A0A8C8S850_BCL2L1-      agatagagatggcaagcgtcc-----------------------------
A0A8C8RUG9_MCL1-01      gggctcgggcgctgattggtcaggagccccaggaggggccccgggcgctg
A0A8C8SWU7_BCL2-01      ---ctc--------------------------------------------
                                                                          

A0A8C8SUC3_BCL2A1-      -------------------------cttcaggaa--ccacatct------
A0A8C8S850_BCL2L1-      -------------------------ctaatggga-gtccatcctggcatc
A0A8C8RUG9_MCL1-01      attggctcccctgccccttccccggttgctgggacgccccggccggactc
A0A8C8SWU7_BCL2-01      -tttctcctcctcttcctgctgctgctgctggaa--cctcatctgaccct
                                                  *   ** *   *    *       

A0A8C8SUC3_BCL2A1-      --tggaccagccccaagcagagt-----tgct------------------
A0A8C8S850_BCL2L1-      agggtgccagccacatggtgaatggggctgccgggcac-----------a
A0A8C8RUG9_MCL1-01      gctgtgcttcccggaagaggagctggacggctgcgacccggaacctgaga
A0A8C8SWU7_BCL2-01      gctgggct--------ggggtctttgcctgctgaacccc-----------
                           *  *         *  *         **                   

A0A8C8SUC3_BCL2A1-      ---catgtcttaagaaacact---------gcatcctttctgcaaaag--
A0A8C8S850_BCL2L1-      gtcccagccttg----aagctcatga--aaggtttccagcagctgaag--
A0A8C8RUG9_MCL1-01      ggatgggccccgcggacggctccttgcccagcaccccgcccgacgaggag
A0A8C8SWU7_BCL2-01      ---ctggctcag----ctgctgctag--taatgttcctcctggtgagg--
                              *            **              *   * *   * *  

A0A8C8SUC3_BCL2A1-      -gaaaatgaa----------------------------------------
A0A8C8S850_BCL2L1-      ------tgaggcaggcactga-----------------------------
A0A8C8RUG9_MCL1-01      gacgacgggggcccggacggcttgtaccaggactcgctggagctcatcag
A0A8C8SWU7_BCL2-01      ---gactgagcccggtaccgc------------------aggctgttca-
                               *                                          

A0A8C8SUC3_BCL2A1-      ----------------------------------gaaacgctgaaaccat
A0A8C8S850_BCL2L1-      ----------------------------------gggaggcagga-----
A0A8C8RUG9_MCL1-01      ccgctacctgcgcgaggccgctgaacccggcagcaagaggctgaaggggc
A0A8C8SWU7_BCL2-01      --------------------cttgaccctgtgccaa---gctgga-----
                                                               ** * *     

A0A8C8SUC3_BCL2A1-      gtttggacactctt-----------------------------------g
A0A8C8S850_BCL2L1-      -----gatgagtttga----------------------------attgag
A0A8C8RUG9_MCL1-01      tgctgggcgagccgcgccggccagggggagccggccccgccgccgtggag
A0A8C8SWU7_BCL2-01      -----gatgaattttcccg-----------------ccgctaccatagag
                             *                                           *

A0A8C8SUC3_BCL2A1-      ttattacc----------------tctgtcgatg----------------
A0A8C8S850_BCL2L1-      gtat--------------cggagggctttcagtgacctcacgtcccagct
A0A8C8RUG9_MCL1-01      aaggcgctggagacgttgcggagggtcggcgacggcgtcata---cagaa
A0A8C8SWU7_BCL2-01      attttgcc----------cagatgtctggc---------------cagct
                                                     *                    

A0A8C8SUC3_BCL2A1-      -----------------ctgccagaagaattttca-----------ttaa
A0A8C8S850_BCL2L1-      ccacatcactcctggcacggcataccagagcttcg-----------agca
A0A8C8RUG9_MCL1-01      gcaccagatcgcttt-----ccaagggatgcttcggaagctagacatcaa
A0A8C8SWU7_BCL2-01      gcacttgaccccattcacagccaggggacgctttg-----------tggc
                                            *          **                 

A0A8C8SUC3_BCL2A1-      agtcatggatgaagaa------------------------------tttg
A0A8C8S850_BCL2L1-      ggtggtgaatgaactc------------------------------ttcc
A0A8C8RUG9_MCL1-01      gaatgaggaggatctgaagtcggtgtctgcagttgcaacacatgttttca
A0A8C8SWU7_BCL2-01      ggtggtggaggagctg------------------------------ttcc
                              * * **                                  **  

A0A8C8SUC3_BCL2A1-      ctgatggaaacactaactggggacggattttgacaatatttatgtttgg-
A0A8C8S850_BCL2L1-      gggacggagt---gaactgggggcgcattgtggcttttttctcctttgg-
A0A8C8RUG9_MCL1-01      gtgatggaataacaaactggggtagaattgtgacactcatctcttttggt
A0A8C8SWU7_BCL2-01      gtgatggggt---taactggggcaggatcgtggccttcttcgaatttgg-
                          ** **       ********  * **  ** *  *  *    ***** 

A0A8C8SUC3_BCL2A1-      -----tggaat--tctttctaagaggcttcaagaacacagagttcagctt
A0A8C8S850_BCL2L1-      -----aggagccctatgcgtggagagtgtc---gacaaggaga------t
A0A8C8RUG9_MCL1-01      gcctttgttgcaaaacacctgaggagcata---aaccaggagaactgcat
A0A8C8SWU7_BCL2-01      -----tggtgtgatgtgtgtggagagcgtc---aaccgggaga----tgt
                              *            *     *  *     **   ***       *

A0A8C8SUC3_BCL2A1-      accgaagataataaagagcagatttcttatttcatcacagactatattat
A0A8C8S850_BCL2L1-      ggaggtgttggttggacgc--atcgcctcctggatgaccacttacctgac
A0A8C8RUG9_MCL1-01      caacacactagcagggatc--atcac-----agatgttcttgt-----ca
A0A8C8SWU7_BCL2-01      ca--cctcttgtggatagc--attgcggtgtggatgaccgagtacctgaa
                                *         *  **  *       **       *       

A0A8C8SUC3_BCL2A1-      aaacaacaaggctgagtggatagaggcaaatggaggttgggtgagtttca
A0A8C8S850_BCL2L1-      tgaccacctagatccctggatccaagagaatggcggttgggagcggtttg
A0A8C8RUG9_MCL1-01      cagacaa--acgagagtggctagttaaccaaagaggctgggagggatttg
A0A8C8SWU7_BCL2-01      cagacacctgcacaactggatccaggacaatggaggctgggatgcctttg
                             *          *** *        *  * ** ****     **  

A0A8C8SUC3_BCL2A1-      cttgctcttgctctatttctctgttggttaatcattgttatgagttagag
A0A8C8S850_BCL2L1-      tggatctctatggaaatgatgctgcagccaagagcaggaaaggccaggag
A0A8C8RUG9_MCL1-01      ttgacttcttccgc----gta-gaggatctaga--aggtagcatcaggaa
A0A8C8SWU7_BCL2-01      tggaattgtatggcagcaaca-tgagacctgtgtttgatttctcctggat
                                *                           *          ** 

A0A8C8SUC3_BCL2A1-      gcgcttcatacatcacatgta-tggaggttcctttg--------------
A0A8C8S850_BCL2L1-      cagttcaacaggtggcttctgacgggggcgaccgtggcaggagttctcct
A0A8C8RUG9_MCL1-01      cgttct----gatggcttttg-ctggcgttgctggactgggag-------
A0A8C8SWU7_BCL2-01      ctcttt----gaagactatcc-taagtttggctctggtgggagcctgcat
                                       *               *                  

A0A8C8SUC3_BCL2A1-      ----cctgcttctttcagtcaaacctgcttaa
A0A8C8S850_BCL2L1-      c---ctgggctctctgc-tgacccgcaagtaa
A0A8C8RUG9_MCL1-01      caagcttg--gcctata-tgatgc---gatga
A0A8C8SWU7_BCL2-01      cactcttggcgcttacc-tgggacataagtga
                            *  *   *      *    *     * *

© 1998-2022Legal notice