Dataset for CDS BCL2L10 of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5CY11_BCL2L10      atgatggccagttgtctaacctgcatcaaaatggccatctcttccagaaa
D2IT42_BCL2L10-02       --------------------------------------------------
                                                                          

A0A8C5CY11_BCL2L10      catgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacc
D2IT42_BCL2L10-02       -atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacc
                         *************************************************

A0A8C5CY11_BCL2L10      tgttgtcctgcactgcaagcacaggcacagccccgccgcctcccagcgag
D2IT42_BCL2L10-02       tgttgtcctgcactgcaagcacaggcacagccccgccgcctcccagcgag
                        **************************************************

A0A8C5CY11_BCL2L10      tcagccgcggccatgaggggactggcccaggacatggagcggcagcacta
D2IT42_BCL2L10-02       tcagccgcggccatgaggggactggcccaggacatggagcggcagcacta
                        **************************************************

A0A8C5CY11_BCL2L10      cgctcgcttccaggctctggcccagagcttcctggcccagtgcgaggccg
D2IT42_BCL2L10-02       cgctcgcttccaggctctggcccagagcttcctggcccagtgcgaggccg
                        **************************************************

A0A8C5CY11_BCL2L10      acgcatgcgccggcctccgcaaggtgatggaggagctggtgggagacgga
D2IT42_BCL2L10-02       acgcatgcgccggcctccgcaaggtgatggaggagctggtgggagacgga
                        **************************************************

A0A8C5CY11_BCL2L10      cagttgaactgggggagggtagtttccctcttcacctttaccggggtgct
D2IT42_BCL2L10-02       cagttgaactgggggagggtagtttccctcttcacctttaccggggtgct
                        **************************************************

A0A8C5CY11_BCL2L10      ggccagacaactgcaggagaagaagggggtacaactggggcaggaccccg
D2IT42_BCL2L10-02       ggccagacaactgcaggagaagaagggggtacaactggggcaggaccccg
                        **************************************************

A0A8C5CY11_BCL2L10      ggacgggcagggcactgggacaggttcccggcgggagctgcagggggctg
D2IT42_BCL2L10-02       ggacgggcagggcactgggacaggttcccggcgggagctgcagggggctg
                        **************************************************

A0A8C5CY11_BCL2L10      gcggagacgatagcggactacctaggggaggagaagagggactggctgct
D2IT42_BCL2L10-02       gcggagacgatagcggactacctaggggaggagaagagggactggctgct
                        **************************************************

A0A8C5CY11_BCL2L10      ggagaacgggggctgggaagggttttgtaagttctccaggatcgcccgag
D2IT42_BCL2L10-02       ggagaacgggggctgggaagggttttgtaagttctccaggatcgcccgag
                        **************************************************

A0A8C5CY11_BCL2L10      aggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggg
D2IT42_BCL2L10-02       aggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggg
                        **************************************************

A0A8C5CY11_BCL2L10      gtgggcatcgcaggcctgacgttccttttggtgcgctag
D2IT42_BCL2L10-02       gtgggcatcgcaggcctgacgttccttttggtgcgctag
                        ***************************************

© 1998-2022Legal notice