Dataset for CDS Unclassified of Organism Branchiostoma lancelet adintovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5H3CWZ2_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Viruses] Branchiostoma lancelet adintovirus (length=594 residues).
atgtggcataccagacgccgcgggaggtcgtgtcgggcggcatcgttacttaagggtaggttgtgtatgtatcgctgtgt
cagtatggaggtgttgaaaacccaaacggaagacatatttcgtcacctgctccaccacagagctcccaacgtgtttccta
gaaacgagcgacgggaaaatagagccatataccgtaaggttgtgcaagtgtcaaacgatgtgacggagaggaaagagtgg
gctgatctcctctgctgttttgtctctacaacaacaacaacaaacggggcttcacgactgagagccctgctagaaaacgt
gcttaacgaggatggattgagctgggggcgtgtcatcatcgccatgatttttgctctggatgtcaatattaagttacacg
ggtcacaaacgaaccaagaaaacgcgatatgctcagagttagccgagttgatgtgcgccatagcggggaggtggctgtta
cgacgcggagggtggagtgggatgattgacgctgcagaaccgtcgatattcgtggctgttgtgaaccttatctgtcgtat
gtggactgcgcctgtttgcgttattgtatcgtga
© 1998-2023Legal notice