Dataset for CDS BCL2L2 of organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1068 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagt
gaaattttaagcgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatt
tagtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttt
ccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgtgtctacaggtcaggatag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1161 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtttctgtag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1167 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1137 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcagggagatggaggaag
aagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggccca
gtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc
ccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttaga
ggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccg
ctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtg
tctacaggtcaggatag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=1041 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaagctaaa
ggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccattg
aggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagct
cactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaaggatttgcgta
tatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaaggcaaatcaagg
tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccggacc
accaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctacaggtcaggata
g
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-07 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=789 residues).
atgccccttctgattctctctccatatattcatgccagtgtttcatccttgcctcttatagctgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacccaggtctccga
tgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggctgactgg
atccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtgaaattttaag
cgactgtgactctgctccaagttccccagatctcgagtttgaagccgggcagtccgttcgggggcaaggttcacctgtca
cgaaacgagtgtcactccttcgaatctcgcgagccaatcagcatctgagactgggccactgcggtgaggcgatcggaaga
ttggtcctttccagtcgcctagctagggccaatcacggagcgtcctatacttcgcgggcccgcccgtag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-08 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=552 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgtgtctacagggccgggctagagcgacatcatggtattccccttactaaaaaaagtgtgtattag
>gnl|bcl2dbcds|A0A2K5V0Q3_BCL2L2-09 BCL2-like 2 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L2 (length=441 residues).
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2021Legal notice