Dataset for CDS BCL2L2 of organism Macaca fascicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
A0A2K5V0Q3_BCL2L2-      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
A0A2K5V0Q3_BCL2L2-      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      atgccccttctgattctctctccatatattcatgccagtgtttcatcctt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      -------------------atggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      -------------------atggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gcctcttatagctgcccggatggcgaccccagcctcggccccagacacac
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gggctctggtggcagactttgtaggttataagctgaggcagaagggttat
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gtctgtggagctggccccggggagggcccagcagctgacccgctgcacca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      agccatgcgggcagctggagatgagttcgagacccgcttccggcgcacct
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaa
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      cgcttcacccaggtctccgatgaacttttccaagggggccccaactgggg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gcctacctggagacgcggctggctgactggatccacagcagtgggggctg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      g------------------gcggagttcacagct----------------
A0A2K5V0Q3_BCL2L2-      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
A0A2K5V0Q3_BCL2L2-      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
A0A2K5V0Q3_BCL2L2-      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gttatcccagatcactgaagctgagatggctgatgaagtaatttgcagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      ---ctatacggggacggggccctg--------------------------
A0A2K5V0Q3_BCL2L2-      aaattttaagcgactgtgactctgctccaagttccccagatctc------
A0A2K5V0Q3_BCL2L2-      ----------------------------------------------ggag
A0A2K5V0Q3_BCL2L2-      aaattttaagcgactgtgactctgctccaagttccccagatctcgaggag
A0A2K5V0Q3_BCL2L2-      aaattttaagcgactgtgactctgctccaagttccccagatctcgaggag
A0A2K5V0Q3_BCL2L2-      aaattttaagcgactgtgactctgctccaagttccccagatctcgaggag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      aaattttaagcgactgtgactctgctccaagttccccagatctcgaggag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      ---------------------------------gag---gaggcgcggc-
A0A2K5V0Q3_BCL2L2-      ---------------------------------gagtttgaagccgggca
A0A2K5V0Q3_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      ------------------------------atggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      ctggaagctatcaaagctcgagtcagggagatggaggaagaagctgagaa
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      gctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccac
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------

A0A2K5V0Q3_BCL2L2-      ----------------------------gtctgcgggaggggaactgg--
A0A2K5V0Q3_BCL2L2-      ----------------------------gtccgttcgggggca-------
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      ctccaggcaatgctggcccagtgatcatgtccattgaggagaagatggag
A0A2K5V0Q3_BCL2L2-      --------------------------atgtccattgaggagaagatggag
                                                    ***       * * *       

A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc
A0A2K5V0Q3_BCL2L2-      gctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagc

A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -----------aggttcac-------------------------------
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta
A0A2K5V0Q3_BCL2L2-      agaagagctggaagctcactttcatggctgtggatcagtcaaccgtgtta

A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      -------ctgtcacgaaacgagtgtcactccttcgaatctcgc-------
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata
A0A2K5V0Q3_BCL2L2-      ccatactctgtgacaaatttagtggccatcccaaaggatttgcgtatata

A0A2K5V0Q3_BCL2L2-      ---------------gcatcagtgagga----------------------
A0A2K5V0Q3_BCL2L2-      ---------------gagccaatcagca---------tctgagactgggc
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
A0A2K5V0Q3_BCL2L2-      gagttctcagacaaagagtcagtgaggacttccttggccttaga-tgagt
                                       *   ** * ** *                      

A0A2K5V0Q3_BCL2L2-      --cagtgctgacgggg----------------------------------
A0A2K5V0Q3_BCL2L2-      cactgcggtgaggcgatcgga-----------------------------
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
A0A2K5V0Q3_BCL2L2-      ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacaga
                          *      ** *                                     

A0A2K5V0Q3_BCL2L2-      ----------------------------------------gccgtggcac
A0A2K5V0Q3_BCL2L2-      -----------------agattggtcctttcca-------gtcgcctagc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
A0A2K5V0Q3_BCL2L2-      ccaggcatcagcacaacagaccggggttttccacgagcccgctaccgcgc
                                                                *        *

A0A2K5V0Q3_BCL2L2-      tgggggccctg---gtaactgtaggggccttttttgcta-----------
A0A2K5V0Q3_BCL2L2-      tagggcca------atcacgg----agcgtcctatacttc----------
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K5V0Q3_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
                          **  *          ** *     **      * **            

A0A2K5V0Q3_BCL2L2-      ---gcaag-----------------------------tga----------
A0A2K5V0Q3_BCL2L2-      ---gcgggccc------------------gcccg---tag----------
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctaca--ggtcaggatag----------
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctaca--ggtcaggatag----------
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctaca--ggtcaggatag----------
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctaca-gggccgggctagagcgacatca
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K5V0Q3_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
                           **  *                             *            

A0A2K5V0Q3_BCL2L2-      ----------------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------------
A0A2K5V0Q3_BCL2L2-      tggt------ttctgtag----------------
A0A2K5V0Q3_BCL2L2-      tggtattccccttactaaaaaaagtgtgtattag
A0A2K5V0Q3_BCL2L2-      tggtattccccttactaa----------------
A0A2K5V0Q3_BCL2L2-      tggtattccccttactaa----------------

© 1998-2022Legal notice