Dataset for CDS BAX of Organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1FXV2_BAX-01      atggcatcgcacccgggaggaggtga-----ccaaggaaatgg------c
A0A3Q1FSZ4_BAX-01      atgtc-tggcagccgagacgaggataaacccccgggagagcaggaacctc
A0A3Q1FSZ4_BAX-02      atgtc-tggcagccgagacgaggataaacccccgggagagcaggaacctc
                       *** * * *** *** ** ****  *     **  *  *   *      *

A0A3Q1FXV2_BAX-01      aaggaacagctagtggaagtaggagctgctttgttaaaggacttcatttt
A0A3Q1FSZ4_BAX-01      aaggcgccgtcggcgg----agaagatg--ttgtt-gatgatcccatctt
A0A3Q1FSZ4_BAX-02      aaggcgccgtcggcgg----agaagatg--ttgtt-gatgatcccatctt
                       ****  * *   * **    ** ** **  *****  * **   *** **

A0A3Q1FXV2_BAX-01      tgagc-gggttcagcggcatggagatggt-----------------aata
A0A3Q1FSZ4_BAX-01      ggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaaca
A0A3Q1FSZ4_BAX-02      ggagcagggagcagtggtcctcagagggtatgtgattgaacgtataaaca
                        **** ***  *** **     *** ***                 ** *

A0A3Q1FXV2_BAX-01      ctgtagtgacaag--agcacagct-------gggt---ggaggagagctg
A0A3Q1FSZ4_BAX-01      cagaagaccctagtcggcacgtctcctctgaggatctgggaggaaggcca
A0A3Q1FSZ4_BAX-02      cagaagaccctagtcggcacgtctcctctgaggatctgggaggaaggcca
                       * * **   * **   ****  **       ** *   ******  **  

A0A3Q1FXV2_BAX-01      gttga-----------cccaaatcataagaagc--tcggtcagtgcctgc
A0A3Q1FSZ4_BAX-01      gatgaactacaggatccacaaatta-aagaagtggtggatcag---ctac
A0A3Q1FSZ4_BAX-02      gatgaactacaggatccacaaatta-aagaagtggtggatcag---ctac
                       * ***           * ***** * ******   * * ****   ** *

A0A3Q1FXV2_BAX-01      agcagattggagatgagctggatggaaatgtggagctccagaggatgata
A0A3Q1FSZ4_BAX-01      tcaagatagctgatgacctgaacaggaacgctgagctccag---------
A0A3Q1FSZ4_BAX-02      tcaagatagctgatgacctgaacaggaacgctgagctccag---------
                          **** *  ***** *** *  * ** *  *********         

A0A3Q1FXV2_BAX-01      aatgattcctcactcagtcctacaaaagatgtg-----------tttatg
A0A3Q1FSZ4_BAX-01      --cgacttatcaaccaggttcagggaaactgtgctcaggacatcttcatg
A0A3Q1FSZ4_BAX-02      --cgacttatcaaccaggttcagggaaactgtgctcaggacatcttcatg
                          ** *  ***  ***    *   **  ****           ** ***

A0A3Q1FXV2_BAX-01      aaagttgctgttgagatcttttcagatggaaaatttaactggggcagggt
A0A3Q1FSZ4_BAX-01      aaggtggccaggagcatctttgctgatggaa---taaactggggtcgagt
A0A3Q1FSZ4_BAX-02      aaggtggccaggagcatctttgctgatggaa---taaactggggtcgagt
                       ** ** **       ****** * *******   * ********  * **

A0A3Q1FXV2_BAX-01      ggttgctctgttctactttgcctgtcgactcgtcattaaggctcttgtaa
A0A3Q1FSZ4_BAX-01      ggtggctctctttcatctggcctacagacttatatacaaggctctgacca
A0A3Q1FSZ4_BAX-02      ggtggctctctttcatctggcctacagacttatatacaaggctctgacca
                       *** ***** **  *  * ****   ****  *    ********    *

A0A3Q1FXV2_BAX-01      cccaagtacctgatatcatcagaaccattattcattggaccatggactac
A0A3Q1FSZ4_BAX-01      ccaaccatttagagaacatcagaatgattatcagctgggttctccaattc
A0A3Q1FSZ4_BAX-02      ccaaccatttagagaacatcagaatgattatcagctgggttctccaattc
                       ** *       ** * ********  *****    ***    *  * * *

A0A3Q1FXV2_BAX-01      ctccgggaacatgtgatcaactggatcagggagcaaggtggctgggaggg
A0A3Q1FSZ4_BAX-01      attagagagcagctctatgtctggcttgtgcagcagggaggctgggtgag
A0A3Q1FSZ4_BAX-02      attagagagcagctctatgtctggcttgtgcagcagggaggctgggaggg
                        *  * ** **  *      **** *   * **** ** ******* * *

A0A3Q1FXV2_BAX-01      tattcgttcccactttggtactcccacatggcagacagtgggagttttct
A0A3Q1FSZ4_BAX-01      tggtacatcat-ctgtaaagttttgtcctg------------tatgtttg
A0A3Q1FSZ4_BAX-02      gg-----tgat-ccgtagcttttctcgatggaggacagcagccatagtag
                              *    *  *     *      **              *  *  

A0A3Q1FXV2_BAX-01      tggcaggcgttctcacc----------actgttctcgtcattcgcaagat
A0A3Q1FSZ4_BAX-01      tttaaggctttctggtctcctgcatggacttgttcggggatccaaagttc
A0A3Q1FSZ4_BAX-02      catcagtagtactggtggca-acttttatttatctcagga---ggacacg
                           **   * **              * *  *      *     *    

A0A3Q1FXV2_BAX-01      gtga
A0A3Q1FSZ4_BAX-01      ctaa
A0A3Q1FSZ4_BAX-02      ctga
                        * *

© 1998-2023Legal notice