Dataset for CDS BCL-2-like of organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3BEB7_BCL2L1-      atgtc----acacagcaacagagatctggtgcagttctaca--------t
A0A3Q3B0R2_BCL2-01      atgga----------------------ggtgaatcgcttca--------t
A0A3Q3B3X5_BCL2L1-      atgtc-------tcaaaacaaagaactggtgcttttctata--------t
A0A3Q3B4P5_MCL1-01      atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagt
A0A3Q3B4P5_MCL1-02      atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagt
                        ***                          *      **  *        *

A0A3Q3BEB7_BCL2L1-      aagctataag-----ttgtctcagaggaactgttcg--aagtctctgctg
A0A3Q3B0R2_BCL2-01      tgtggaaaactatatttgccacaaa-------ctctccaagcg-----cg
A0A3Q3B3X5_BCL2L1-      tatgtataaa-----ctgtcacagagaaactatcctgtcaatcaca--ta
A0A3Q3B4P5_MCL1-01      cgtggacgga-----tta-cacagagacacctctccccaggtctccattg
A0A3Q3B4P5_MCL1-02      cgtggacgga-----tta-cacagagacacctctccccaggtctccattg
                             *          *  * ** *         *               

A0A3Q3BEB7_BCL2L1-      atgccg---gaggttgccggtgaaaggaccgaga--aggccagctcggct
A0A3Q3B0R2_BCL2-01      gctacgcgtggggctccgaccgcccccgccgcgtccgagacgatgctg--
A0A3Q3B3X5_BCL2L1-      atactcagtgatcctccgaatagaactgatgcag--gg---gatgcag--
A0A3Q3B4P5_MCL1-01      gcgcctcgctaggctccg---agaacggcagcgt--ggcgtcgtgcaatt
A0A3Q3B4P5_MCL1-02      gcgcctcgctaggctccg---agaacggcagcgt--ggcgtcgtgcaatt
                                      * *             *              *    

A0A3Q3BEB7_BCL2L1-      cccagtaacggcttgctgg-------------------------------
A0A3Q3B0R2_BCL2-01      -ccaacaacggctcggtggcgagccagtccccgaccctggtccggaggtg
A0A3Q3B3X5_BCL2L1-      ---------ggttggaggacgcagagat----g----------------a
A0A3Q3B4P5_MCL1-01      cctccaaacgaccgaaggacctggtgat----gcctccgctgaagggata
A0A3Q3B4P5_MCL1-02      cctccaaacgaccgaaggacctggtgat----gcctccgctgaagggata
                                 *       *                                

A0A3Q3BEB7_BCL2L1-      ------------------------------tcaacagta----------g
A0A3Q3B0R2_BCL2-01      ccgcggcgcacg-----aggagccccaggaggagcagga-------acgg
A0A3Q3B3X5_BCL2L1-      cagagacacacgccaatgggactt------ttaacgggactagt--cctg
A0A3Q3B4P5_MCL1-01      ccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccga
A0A3Q3B4P5_MCL1-02      ccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccga
                                                        * *               

A0A3Q3BEB7_BCL2L1-      ggacggccagtcggggaagaagatctggccccg-ccgcagcgacatagag
A0A3Q3B0R2_BCL2-01      cgccccctgacgcggagagcgaccccgaccccgtcctc--------tgcg
A0A3Q3B3X5_BCL2L1-      ggaccccg----------------ccgg---cgtcccc------actgag
A0A3Q3B4P5_MCL1-01      gcacgccggaggtggacggtaaccccga---cgtccccggcggtgctgag
A0A3Q3B4P5_MCL1-02      gcacgccggaggtggacggtaaccccga---cgtccccggcggtgctgag
                           *  *                 * *    ** ** *         * *

A0A3Q3BEB7_BCL2L1-      gccg----------------------------------------------
A0A3Q3B0R2_BCL2-01      ggcggatctcc------------------ccgcacgagccgctc------
A0A3Q3B3X5_BCL2L1-      gcag-------------------------------caaccgctgccgacg
A0A3Q3B4P5_MCL1-01      gacgaagtgctggagaacgacacgaagcatctgatcagccgtttcctaca
A0A3Q3B4P5_MCL1-02      gacgaagtgctggagaacgacacgaagcatctgatcagccgtttcctaca
                        *  *                                              

A0A3Q3BEB7_BCL2L1-      -------------------------------------taaaatcagctct
A0A3Q3B0R2_BCL2-01      ---gcgcac------------------atccacagggtgctgcgcgaggc
A0A3Q3B3X5_BCL2L1-      acggcgaac------------------atggacaaggtgaaggaagctct
A0A3Q3B4P5_MCL1-01      agagtttactggactatcaaaacgtcagtggtcagagagtaaggagttat
A0A3Q3B4P5_MCL1-02      agagtttactggactatcaaaacgtcagtggtcagagagtaaggagttat

A0A3Q3BEB7_BCL2L1-      gaaggactctgcggatgagtttgagcgtctctacacgcaaagtttcagcc
A0A3Q3B0R2_BCL2-01      c-----ggcgacgagc------------tggagcgc--------------
A0A3Q3B3X5_BCL2L1-      ccgggacacggcaaacgagttcgagctgcggtacgcccgcgctttcagcg
A0A3Q3B4P5_MCL1-01      c-----gacgatgaaca-----gagtggtggaggac-----cttttgaca
A0A3Q3B4P5_MCL1-02      c-----gacgatgaaca-----gagtggtggaggac-----cttttgaca
                                *                          *              

A0A3Q3BEB7_BCL2L1-      acctgtccctgcagctcgacatca-------gccccgacacggtct----
A0A3Q3B0R2_BCL2-01      -----ctctaccagccggacttcgtggagatgtcgcggca---gctgggg
A0A3Q3B3X5_BCL2L1-      acctgcacagccagctgcacatcacg-------cccggcaccgtct----
A0A3Q3B4P5_MCL1-01      aa--acacag--attcgcgtacaatggtataatcaagaaactgtctttgg
A0A3Q3B4P5_MCL1-02      aa--acacag--attcgcgtacaatggtataatcaagaaactgtctttgg
                               *    *                    *  *  *    **    

A0A3Q3BEB7_BCL2L1-      ---acca----------------cagcttcaagagcgtgctg-----gac
A0A3Q3B0R2_BCL2-01      ctcgccagcgccgcggccaaggcgcgcttcgccgaggtgatg-----gac
A0A3Q3B3X5_BCL2L1-      ---acca----------------aagcttcgagaacgtgatg-----gac
A0A3Q3B4P5_MCL1-01      atgacaa----------------aag---tgaggacatgacgtttgtaac
A0A3Q3B4P5_MCL1-02      atgacaa----------------aag---tgaggacatgacgtttgtaac
                            * *                  *           **  *      **

A0A3Q3BEB7_BCL2L1-      gagc-------------tgttcaaggacgg---ggtgaactggggccgcg
A0A3Q3B0R2_BCL2-01      gagc-------------tgttccgggacgg---cgtcaactggggccgca
A0A3Q3B3X5_BCL2L1-      gagg-------------tgttccgggacgg---cgtcaactggggccgca
A0A3Q3B4P5_MCL1-01      aaaaacagcccggagccttttcgcagacgggatcaccaactggggtcgga
A0A3Q3B4P5_MCL1-02      aaaaacagcccggagccttttcgcagacgggatcaccaactggggtcgga
                         *               * ***   *****       ******** **  

A0A3Q3BEB7_BCL2L1-      tggtgggcctgtttgccttcggcggcgtgctgtgcgttcagtgcgtc---
A0A3Q3B0R2_BCL2-01      tcattgccttcttcgagttcggcggcacggtgtgcgtggagtgcgcgtcc
A0A3Q3B3X5_BCL2L1-      ttgtggggctctttgcattcggcggagcgctgtgcgtcgagtgcgtc---
A0A3Q3B4P5_MCL1-01      tctccagcctggtggcctttggcgcagtggtg-gcg----gtgcacctga
A0A3Q3B4P5_MCL1-02      tctccagcctggtggcctttggcgcagtggtg-gcg----gtgcacctga
                        *        *  * *  ** ****    * ** ***    ****      

A0A3Q3BEB7_BCL2L1-      --gagagggac--------atgagt-gagctggt-ctcccgcattgcaga
A0A3Q3B0R2_BCL2-01      ag--ggaggag--------atga-cgccgcaggtggacca-catcgcgga
A0A3Q3B3X5_BCL2L1-      --gagaaggag--------atgagt-cacctggt-ggccaggattgtgga
A0A3Q3B4P5_MCL1-01      aggagaaggggagggaggaatgcgtggagctggtgggccagga-------
A0A3Q3B4P5_MCL1-02      aggagaaggggagggaggaatgcgtggagctggtgggccagga-------
                            *  **          ***       * ***   **   *       

A0A3Q3BEB7_BCL2L1-      ctggatgaccgtttacctgga---------------tgag---cagatcg
A0A3Q3B0R2_BCL2-01      gtggatgacggagtatttaaa---------------tggacctctgaaca
A0A3Q3B3X5_BCL2L1-      gtggatgaccgtctacctggacaaccacattcagccttggattcagag--
A0A3Q3B4P5_MCL1-01      ---gatttccacatacctg------------ctgtctgag---cagaaag
A0A3Q3B4P5_MCL1-02      ---gatttccacatacctg------------ctgtctgag---cagaaag
                           ***  *    **  *                  *      * **   

A0A3Q3BEB7_BCL2L1-      gtccgtggatcgacagccagggagga----tgggacagcttcgctgagat
A0A3Q3B0R2_BCL2-01      gc---tggatagaggataacggggga----tgggatgcgttcgtggaact
A0A3Q3B3X5_BCL2L1-      ----------------tcaaggggga----tgggagcgctttgctgaaat
A0A3Q3B4P5_MCL1-01      ac---tggct----gctcaaaaataactcctggagtggctttgtggagtt
A0A3Q3B4P5_MCL1-02      ac---tggct----gctcaaaaataactcctggagtggctttgtggagtt
                                          *      *    ***      ** *  **  *

A0A3Q3BEB7_BCL2L1-      gtacgg---gcgagatgc--cgctgcagaagcgaggaggtttcaggagtc
A0A3Q3B0R2_BCL2-01      -----gtacgacagacacaaggagtccgtcttcag----ctgctactggc
A0A3Q3B3X5_BCL2L1-      cttcgg--cgaca-acgc--ggcggctgaaagcagaatctctcaggaggg
A0A3Q3B4P5_MCL1-01      ctttcgaataacagaccc--tgaatctacagtcaggaacacactgatggc
A0A3Q3B4P5_MCL1-02      ctttcgaataacagaccc--tgaatctacagtcaggaacacactgatggc
                             *      * *  *   *   *       **       *    *  

A0A3Q3BEB7_BCL2L1-      cct--gaagaaatggctgctag--ctggagcggcgctgctggctgggctg
A0A3Q3B0R2_BCL2-01      cgtccatcaagacagtcttcggcctggcggcgctcggggcggccagcatc
A0A3Q3B3X5_BCL2L1-      ttt--aaagaagtggctgctgg--tggggatgacggtggtgacc------
A0A3Q3B4P5_MCL1-01      tgt--agccggat--ttgctgggcttggggcaacactgg---cc------
A0A3Q3B4P5_MCL1-02      tgt--agccggat--ttgctgggcttggggcaacactgg---cc------
                          *                  *    *          *    *       

A0A3Q3BEB7_BCL2L1-      cttctcggc-----------------------------------------
A0A3Q3B0R2_BCL2-01      accatcggcgcgtacctcacgcaaaagatgcccctgacccctcagagaca
A0A3Q3B3X5_BCL2L1-      -gcggtggtggcgg------------------------------------
A0A3Q3B4P5_MCL1-01      -ttattgataagtgttt---------------------------------
A0A3Q3B4P5_MCL1-02      -ttattgataagcacttggtcagcaaaatgtgagcacaggcctctggaaa

A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      accttcagaccagatctggctctcttcaaagcctcg--------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      atgaatcatgtgtatctctggcgcctgggatcagaagttgctacctaagc

A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      ----------------ctcagagaactgctttcctcctcctgcgcctcca
A0A3Q3B3X5_BCL2L1-      ----------------gttcg-----------------------------
A0A3Q3B4P5_MCL1-01      ----------------gttgg-----------------------------
A0A3Q3B4P5_MCL1-02      acaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtgga

A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q3B0R2_BCL2-01      tgtcaaaacagacacaaatcaaaacagcagagggaaccagaggcacggcc
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      ------------------ccttga--------------------------
A0A3Q3B4P5_MCL1-02      tcaacaggatgagtcaaaccttaatattgggtggatcctgcctcttcaca

A0A3Q3BEB7_BCL2L1-      --------------------------------gtgctcgtggctaagaag
A0A3Q3B0R2_BCL2-01      cagagagcaaagg-------------------atgtctgaggtggaatca
A0A3Q3B3X5_BCL2L1-      --------------------------------ctcttcgcccagaagcgc
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      atgactgctggagacaggcaccagctccctgcgtctctgcagggaaaagg

A0A3Q3BEB7_BCL2L1-      cgttaa
A0A3Q3B0R2_BCL2-01      cactag
A0A3Q3B3X5_BCL2L1-      ctgtga
A0A3Q3B4P5_MCL1-01      ------
A0A3Q3B4P5_MCL1-02      gagtaa

© 1998-2020Legal notice