Dataset for CDS BCL2A1 of organism Podarcis muralis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A670JXJ0_BCL2A1-      atggaga-gccgagg-----------------------------------
A0A670JXJ0_BCL2A1-      atgaaaaggctgaagtcactaagttcagctctcaagcaacctgcaaatca
A0A670JXJ0_BCL2A1-      atgaaaaggctgaagtcactaagttcagctctcaagcaacctgcaaatca
                        *** * * ** ** *                                   

A0A670JXJ0_BCL2A1-      ----------------ggagggcgcagcc---------------------
A0A670JXJ0_BCL2A1-      tttgaacctgcattgtggaggtcacagcttgcattttgccctctgtgctc
A0A670JXJ0_BCL2A1-      tttgaacctgcattgtggaggtcacagcttgcattttgccctctgtgctc
                                        ***** * ****                      

A0A670JXJ0_BCL2A1-      ----------------------------gtct------------------
A0A670JXJ0_BCL2A1-      atttctcaatggaaaacaaccagttgcagtctgttgacactttggtccaa
A0A670JXJ0_BCL2A1-      atttctcaatggaaaacaaccagttgcagtctgttgacactttggtccaa

A0A670JXJ0_BCL2A1-      --ccgccggcgacatg-----------gccgccctgcacgccgcc-----
A0A670JXJ0_BCL2A1-      gactacttgaaacatgtttgtgaggatgccgaactggacgctgccccgag
A0A670JXJ0_BCL2A1-      gactacttgaaacatgtttgtgaggatgccgaactggacgctgccccgag
                          *  *  *  *****           ****  *** **** ***     

A0A670JXJ0_BCL2A1-      ----------------------------------------aagggagcgc
A0A670JXJ0_BCL2A1-      tcgagttgcccaagtcttggcaagagtagcaccttcgcttcaggaagaag
A0A670JXJ0_BCL2A1-      tcgagttgcccaagtcttggcaagagtagcaccttcgcttcaggaagaag
                                                                 *** **   

A0A670JXJ0_BCL2A1-      tgcgagcggagctgaagc--------------------------------
A0A670JXJ0_BCL2A1-      tggaagagaagataaagccactttggcactccatcaagatcagttctgtc
A0A670JXJ0_BCL2A1-      tggaagagaagataaagccactttggcactccatcaagatcagttctgtc
                        **  ** * ** * ****                                

A0A670JXJ0_BCL2A1-      ---------------------------------------------gccgc
A0A670JXJ0_BCL2A1-      gaggaggccagtgacattttcagccaggtgatggctcaggaatttgccga
A0A670JXJ0_BCL2A1-      gaggaggccagtgacattttcagccaggtgatggctcaggaatttgccga

A0A670JXJ0_BCL2A1-      ctgggagccctgagcg----------------------------------
A0A670JXJ0_BCL2A1-      c-gggaacaccaactggggacggattttgacaatattcgtcttcgcagga
A0A670JXJ0_BCL2A1-      c-gggaacaccaactggggacggattttgacaatattcgtcttcgcagga
                        * **** * *  *  *                                  

A0A670JXJ0_BCL2A1-      ----ccgccgagaagctgcgccag--------------------------
A0A670JXJ0_BCL2A1-      attatcgcaaagaagttgcgacagcacggagttcctttgacaagagaaaa
A0A670JXJ0_BCL2A1-      attatcgcaaagaagttgcgacagcacggagttcctttgacaagagaaaa
                             ***  ***** **** ***                          

A0A670JXJ0_BCL2A1-      ------------tcgcggct------------------------------
A0A670JXJ0_BCL2A1-      cgtggaaccgatttgccactgtgtcactgaatttataaacaccaaagcta
A0A670JXJ0_BCL2A1-      cgtggaaccgatttgccactgtgtcactgaatttataaacaccaaagcta
                                    * **  **                              

A0A670JXJ0_BCL2A1-      cgtg-------------cgcggcaaggtgttggagcatcctaaataccaa
A0A670JXJ0_BCL2A1-      cgtggatcagcgaaaatggaggctgggtgttggagcatcctaaataccaa
A0A670JXJ0_BCL2A1-      cgtggatcagcgaaaatggaggctg-------------------------
                        ****              * ***                           

A0A670JXJ0_BCL2A1-      gcttctcagagaattgcagtcttcctaagcatgtcggatgaggtccagac
A0A670JXJ0_BCL2A1-      gcttctcagagaattgcagtcttcctaagcatgtcggatgaggtccagac
A0A670JXJ0_BCL2A1-      --------------------------------------------------

A0A670JXJ0_BCL2A1-      agaagaaatcattaaggacattttccagcatggcaaagagtgcttcattc
A0A670JXJ0_BCL2A1-      agaagaaatcattaaggacattttccagcatggcaaagagtgcttcattc
A0A670JXJ0_BCL2A1-      ---------------ggacagcttcc------------------------
                                       *****  ****                        

A0A670JXJ0_BCL2A1-      cgcattacaagccccggagcagccacatggacatggtgaagctagcttcc
A0A670JXJ0_BCL2A1-      cgcattacaagccccggagcagccacatggacatggtgaagctagcttcc
A0A670JXJ0_BCL2A1-      ----ttgcaa----------------------------------------
                            ** ***                                        

A0A670JXJ0_BCL2A1-      tacgaagaaattgctttgctccccttgacttcctggaacatccatcagcc
A0A670JXJ0_BCL2A1-      tacgaagaaattgctttgctccccttgacttcctggaacatccatcagcc
A0A670JXJ0_BCL2A1-      ----------------------------------------------agtt

A0A670JXJ0_BCL2A1-      ggctgaaaatgacatcagggaagaagccttgtcagcggcagagggtctgg
A0A670JXJ0_BCL2A1-      ggctgaaaatgacatcagggaagaagccttgtcagcggcagagggtctgg
A0A670JXJ0_BCL2A1-      gggtga----------agagaagagtccctggc-----------------
                        ** ***          ** *****  ** ** *                 

A0A670JXJ0_BCL2A1-      atctcatcctcgtgccaggacttggttttgaccaaaccggcaacagactg
A0A670JXJ0_BCL2A1-      atctcatcctcgtgccaggacttggttttgaccaaaccggcaacagactg
A0A670JXJ0_BCL2A1-      ----------------------tggccttg--------------------
                                              ***  ***                    

A0A670JXJ0_BCL2A1-      ggaagaggaaaggggtactatgatacatacctgaacaggtgcagacagca
A0A670JXJ0_BCL2A1-      ggaagaggaaaggggtactatgatacatacctgaacaggtgcagacagca
A0A670JXJ0_BCL2A1-      ---------------------------------------------cacta
                                                                     **  *

A0A670JXJ0_BCL2A1-      tcccaaaggaaaaccttacacaatcgccttggcttttaaagaacaagtgt
A0A670JXJ0_BCL2A1-      tcccaaaggaaaaccttacacaatcgccttggcttttaaagaacaagtgt
A0A670JXJ0_BCL2A1-      catcaagacaaaac---------tcatctccgctttc-------------
                           ***   *****         **  **  *****              

A0A670JXJ0_BCL2A1-      gtgacgtggtccctgcgtctgaaaatgatgtgaaagttgatgaaatcctg
A0A670JXJ0_BCL2A1-      gtgacgtggtccctgcgtctgaaaatgatgtgaaagttgatgaaatcctg
A0A670JXJ0_BCL2A1-      ------tcgttcttcagtc-------------------------------
                              * ** * *  ***                               

A0A670JXJ0_BCL2A1-      tttgaagacaactga
A0A670JXJ0_BCL2A1-      tttgaagacaactga
A0A670JXJ0_BCL2A1-      ----aatattactga
                            ** *  *****

© 1998-2021Legal notice