Dataset for CDS BCL-2-like of organism Neolamprologus brichardi

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q4MN81_BCL2L10      atgtgcagaga------------------------gcagtctgatatcgc
A0A3Q4HLQ8_MCL1-01      atgaccaa---------------------ctatatgatgtcgaaa-----
A0A3Q4N4B5_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctc
                        ***                                   **   *      

A0A3Q4MN81_BCL2L10      tgggaggaa---------------aatgaaattctgtgggctgtggaaag
A0A3Q4HLQ8_MCL1-01      ----aggaacca---gtgcaccttcatag-actatcttattcctcaaaat
A0A3Q4N4B5_BCL2L1-      ccagagaaactatcctctcaaccacatagtactcaacgagccttcgaaca
                            ** **                **   * *          *  **  

A0A3Q4MN81_BCL2L10      agaccct--------------ggttttggccgagga--------------
A0A3Q4HLQ8_MCL1-01      ggagtcctagagggaccaatgcactatggatcgggaaattcctcaccgca
A0A3Q4N4B5_BCL2L1-      ggactgatgggggggcagcggggt--tggatgaggaa------cagcgaa
                         **                       ***    ***              

A0A3Q4MN81_BCL2L10      ------------ctacctgtccttttgctg-cacgag-------------
A0A3Q4HLQ8_MCL1-01      ga-------acgccacaggctcctctaaagactctagcaacgggattgtg
A0A3Q4N4B5_BCL2L1-      tagacacacacgccaatgggacttttaatggcacgagtcccgggac----
                                    * *   *  * * *   * * * **             

A0A3Q4MN81_BCL2L10      tccacatcaagcccctccacctcccagcga------atcagccgctgcca
A0A3Q4HLQ8_MCL1-01      tccaatggtaccccca-aacggccggacaacctcgaggtaacctcaacaa
A0A3Q4N4B5_BCL2L1-      cccaccggcatccccgcagcggc--ggcagc-----agcagccgccatca
                         ***     * ****    *  *    *           * ** *    *

A0A3Q4MN81_BCL2L10      -----------------------tgaggcgtctaggctg-----------
A0A3Q4HLQ8_MCL1-01      acgggtataccacaaaagctatccgggaccgggaggaagacggttcgttg
A0A3Q4N4B5_BCL2L1-      acg------------acggacctcgacgcagtgaaggag-----------
                                                *   *    * *  *           

A0A3Q4MN81_BCL2L10      ----ggacatcgaa-----agacag-caccaagctcg--------ctt--
A0A3Q4HLQ8_MCL1-01      ccgagcaccccggagtttcattcggacagtgaatccgacgagcagctgga
A0A3Q4N4B5_BCL2L1-      ----gcgctccggg-----acacggccaatgagttcg------agctg--
                            *  *  **       *  * * **   *   **        **   

A0A3Q4MN81_BCL2L10      --------cgacaacctc---------------------gctca---gac
A0A3Q4HLQ8_MCL1-01      gagagaaacgaaactccttattcacagttttttgggtgactttactggac
A0A3Q4N4B5_BCL2L1-      --------cgatacgctc-----------------gtgccttcagc-gac
                                *** *  *                         * *   ***

A0A3Q4MN81_BCL2L10      cttcctggtgcagtgtggaccggacca--------ctgcctcagcctcag
A0A3Q4HLQ8_MCL1-01      tttcgcagcc--------------tcaacgaaaggaaaccaaagcactaa
A0A3Q4N4B5_BCL2L1-      cttcacagccagctgcacatcacgccggccacggcctaccaaagcttcga
                         ***   *                 *            **  ***     

A0A3Q4MN81_BCL2L10      aaaggtgatg-aaggagctggttggagatggacacttgaactgggggagg
A0A3Q4HLQ8_MCL1-01      agac--gatgaaaagagttgttgcg----ga---cgt--attagaaaagc
A0A3Q4N4B5_BCL2L1-      gaacgtgatg-gacgaggtgttccgggacgg---cgttaactggggccgc
                          *   ****  * *** ** *  *    *    * *  * * *    * 

A0A3Q4MN81_BCL2L10      gttgtttctcttttcgcct-----ttactggagtgctggccagaaagatc
A0A3Q4HLQ8_MCL1-01      acagatacgcttacaacggaatgattaataaactgtcattggatgaaaga
A0A3Q4N4B5_BCL2L1-      atcgtagggctttttgcgt-----tcggtggggcactgtgtgtcgagtgc
                           *     ***    *       *   *                *    

A0A3Q4MN81_BCL2L10      ctggagcagaagcc---------------ggggctggaccc--tggtcaa
A0A3Q4HLQ8_MCL1-01      gacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggaga
A0A3Q4N4B5_BCL2L1-      gtcgagaa---------------------ggagatgagccccttggtggg
                           *** *                      * *  *  **   * *    

A0A3Q4MN81_BCL2L10      cagca---------ggaactg-----------------------ggacag
A0A3Q4HLQ8_MCL1-01      ccacacgaccaactggggtcgtgttgtcagctttgtggccttcggggcag
A0A3Q4N4B5_BCL2L1-      c-------------aggatcgtagagt-----------------ggatga
                        *              *    *                       **    

A0A3Q4MN81_BCL2L10      gagccc---atgagctgcagaaggctggcagagaccatagc---------
A0A3Q4HLQ8_MCL1-01      tggtctctcagcacctgaaggaaaagggcagggacaactgcgt--ggcgc
A0A3Q4N4B5_BCL2L1-      cggtct------acct---------------agacaaccacattcagccc
                          * *       * **                *** *   *         

A0A3Q4MN81_BCL2L10      -----------------------tgattacctgggagaa------gagaa
A0A3Q4HLQ8_MCL1-01      tagtt----agccaagagatttctgcatacct-gctg-----tctgagca
A0A3Q4N4B5_BCL2L1-      tggatccagagccaaggaggatgggagcacttcgctgaaatctttgggca
                                                *   ** * *  *        * * *

A0A3Q4MN81_BCL2L10      gaaagactggctgttggataatgatggatgggaaggcttctgtaagttct
A0A3Q4HLQ8_MCL1-01      gcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttct
A0A3Q4N4B5_BCL2L1-      g---gatgcggcggctgaaagcc-------ggaggtctcaggagag---t
                        *   **   *       * *          *** * **      **   *

A0A3Q4MN81_BCL2L10      cccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctg
A0A3Q4HLQ8_MCL1-01      ttc---------gagtagca-----------gaccctga-------gtcg
A0A3Q4N4B5_BCL2L1-      ttc---------aagaagtg-----------gctgctggtggggatgacg
                          *          ** **                  **        *  *

A0A3Q4MN81_BCL2L10      tttgctgccgccg-----gtgtcggccttgctgggcttacc---------
A0A3Q4HLQ8_MCL1-01      atagt--caggcacacactcatggcctttgctggatttgctggtattggg
A0A3Q4N4B5_BCL2L1-      gtggtgacaggcg-----tcgtggc-------gggtgcgct--tatcgcg
                         * *   * * *         * *        **     *          

A0A3Q4MN81_BCL2L10      ---------ttcctcttggtgcgctag
A0A3Q4HLQ8_MCL1-01      gcaacactggccctgttgatcaggtga
A0A3Q4N4B5_BCL2L1-      caaaaac--gcct----------gtga
                                   *            *  

© 1998-2020Legal notice