Dataset for CDS BCL2L1 of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4STP1_BCL2L1-      atgccctacagcaacaaagagctagttgaagattttataagctataaatt
A0A8C4XBF6_BCL2L1-      atgtcttacagcaacagagagcttgttgaagattttatcagctacaaatt
                        *** * ********** ****** ************** ***** *****

A0A8C4STP1_BCL2L1-      atctcagaaaaatttttcatgtaaccagtatttcggagacagtaggactg
A0A8C4XBF6_BCL2L1-      atcgcagaaaaatgttttgaatagcc------------------------
                        *** ********* ***    ** **                        

A0A8C4STP1_BCL2L1-      ccacaccagggacctccactcctgagaatgaacaagatgtgctacatgtc
A0A8C4XBF6_BCL2L1-      ------------------------agagtgaactggatgtattacaggtc
                                                *** *****  *****  **** ***

A0A8C4STP1_BCL2L1-      aatggctctgtcagtggaacagaaaatggaggcagctcttctgcagacca
A0A8C4XBF6_BCL2L1-      aatgggac------tggaataatcaat------agcttcccagccactcc
                        *****  *      ***** *   ***      ****   * **    * 

A0A8C4STP1_BCL2L1-      ctcgcctgatggtatcagagcagtaaaagaggcactccatgactcggggg
A0A8C4XBF6_BCL2L1-      agcatctaatggagttaaagcagtaaaagaggcacttcgtggctcagggg
                          *  ** ****  * * ****************** * ** *** ****

A0A8C4STP1_BCL2L1-      atgagtttgagttgaggtaccgggctgctttcagtgatctctcatcccag
A0A8C4XBF6_BCL2L1-      acgagtttgagctgaggtaccgggctgctttcaatgaccttgcttcgcag
                        * ********* ********************* *** **  * ** ***

A0A8C4STP1_BCL2L1-      ctgcacatcaccccagttaccgcttaccaaagctttgagcaagttatcaa
A0A8C4XBF6_BCL2L1-      ctacatatcacccctgttacagcttaccagagcttcgaggaggttgttgg
                        ** ** ******** ***** ******** ***** *** * *** *   

A0A8C4STP1_BCL2L1-      cgaactcttccgagatggggtgaactggggacgtatagtggcactcttcg
A0A8C4XBF6_BCL2L1-      cgaactcttcagagatggagtgaactggggacgcatagtggcactctttt
                        ********** ******* ************** **************  

A0A8C4STP1_BCL2L1-      catttggtggtgctctgtgtgtggaatgtgtggagaaggaaatgggttct
A0A8C4XBF6_BCL2L1-      catttggtggtgcgctctgtgttgaatgtgtggagaaggaaatggttcct
                        ************* ** ***** ********************** * **

A0A8C4STP1_BCL2L1-      ttggtgaaacgcatagctgaatggatgaccacctacttggacaataacct
A0A8C4XBF6_BCL2L1-      cttgtgagacatatagcagactggatgaccacctacttggataataacat
                         * **** **  ***** ** ******************** ****** *

A0A8C4STP1_BCL2L1-      agatccctggatccagagacaaggaggatgggacacgttcgccaaaatct
A0A8C4XBF6_BCL2L1-      tgatgcctggatcctgagtaatggaggatgggatacctttgtcaggatct
                         *** ********* ***  * *********** ** ** * **  ****

A0A8C4STP1_BCL2L1-      acgggagcaacgcggctgccgagtgccggaggtcccaggaacgtttcagt
A0A8C4XBF6_BCL2L1-      atggacgacacgcatcagccgagt------------------atttcaag
                        * **  *  ****  * *******                   *****  

A0A8C4STP1_BCL2L1-      aggtggctgttggcaggaatgactctggctactggcctgatgctgggctc
A0A8C4XBF6_BCL2L1-      aagtggctggtggttggagtgactatgactgctggactggtgttggcctc
                        * ******* ***  *** ***** ** ** **** *** ** *** ***

A0A8C4STP1_BCL2L1-      ctacttcttccacaaacgcttgtag
A0A8C4XBF6_BCL2L1-      ctttattgcacacacccatctgtag
                        **   *    ****  *   *****

© 1998-2022Legal notice