Dataset for CDS BCL-2-like of organism Poecilia formosa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A096ME02_BCL2L10      atg-----------------------------------------------
A0A087X830_MCL1-01      atgacggctaattcgacaaccgcattaaactatctaattttttctcaaaa
A0A087X9B7_BCL2L1-      atg------------------------------------tcac---gaaa
A0A087YBW4_BCL2L1-      atg------------------------------------tcctacagcaa

A0A096ME02_BCL2L10      --------------------------------------------------
A0A087X830_MCL1-01      tggagtcggggatggacaaacacactacgaccaggggctcgttgtgcctg
A0A087X9B7_BCL2L1-      cagag---------------------------------------------
A0A087YBW4_BCL2L1-      cagag---------------------------------------------

A0A096ME02_BCL2L10      ----------------caccgaggttctccttccgccgtctggatgtg--
A0A087X830_MCL1-01      aagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccc
A0A087X9B7_BCL2L1-      ----------------aactggtgcttttctacattaagtttaaactgtc
A0A087YBW4_BCL2L1-      ----------------aactggtggagttctacataagctacaaattgtc
                                         ** *  *     ** *             *   

A0A096ME02_BCL2L10      -cagagagcc----------gtcacatatcgctgg---------------
A0A087X830_MCL1-01      tacaagaaac-gcccgacgaatctcgcagtgtccgcatcgaatggatatg
A0A087X9B7_BCL2L1-      tcagaggaactatccgatccaacacatattgccca---------------
A0A087YBW4_BCL2L1-      tcagagaaactattcaagctctctgctgaggtccg---------------
                            **   *            *       *                   

A0A096ME02_BCL2L10      --------------gaggaaaatgtcctgtgggctgtggaaagaga----
A0A087X830_MCL1-01      ttgcaaaaagcctccagaagagcagcgac---gacagcgacgaaggctct
A0A087X9B7_BCL2L1-      ------atgagcccccggacagcaccgct---gctggggacgcgg-----
A0A087YBW4_BCL2L1-      ------aggccgacggggccaggaccaattgggatgggga--cag-----
                                        *   *    *      *     **    *     

A0A096ME02_BCL2L10      ------------ccgtggctgttgcagaggattacatccacctgcgctgc
A0A087X830_MCL1-01      ctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgt
A0A087X9B7_BCL2L1-      ------------ccggggacgcgggg------------------------
A0A087YBW4_BCL2L1-      ------------ccggggccctagca------------------------
                                    **   *                                

A0A096ME02_BCL2L10      tcaagcccacacccagcccct---ccacctcccagcgag-----------
A0A087X830_MCL1-01      acgtgcgagcaaccaagtgctggataacgacacaatggagctcattagca
A0A087X9B7_BCL2L1-      atggacgacgagcagacgttggagacgcacgctaatggg----------a
A0A087YBW4_BCL2L1-      atggtccgctggtcaacagctgggccggctccccaggga----------a
                             *                              *             

A0A096ME02_BCL2L10      --------------------------------------------ccggct
A0A087X830_MCL1-01      gttttctaagaaattttacaggactttcaaagtg----------tcggtg
A0A087X9B7_BCL2L1-      cttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcg
A0A087YBW4_BCL2L1-      gt--------------cccgggaccctc----------------ccaccg

A0A096ME02_BCL2L10      gc-------------------cgccatgaggcgcctggcccaggacgt--
A0A087X830_MCL1-01      gagtcaaaataaagctctatctacgatgaaaagggtggtggaggacgttt
A0A087X9B7_BCL2L1-      gcggcaacga-------tggacgcggtgaaagtgaccctgcgagacac--
A0A087YBW4_BCL2L1-      gcgtcaaggt-------t-------gtcaaattggttctgaaggacgc--
                        *                         * *              ***    

A0A096ME02_BCL2L10      ---ggaggcccagcaccaggctcgctttcactccctggccca-----ggg
A0A087X830_MCL1-01      tgtcgaagcacagatatgcatacaatggtatgctc---------aacagg
A0A087X9B7_BCL2L1-      ------ggcccgtgagttcgagctgcgctactccc-gcgccttcaacgac
A0A087YBW4_BCL2L1-      ------ggcagaggagtttgaacgcctctacacccaaagctttaaacacc
                               **             *      *  * *               

A0A096ME02_BCL2L10      cttcctgaagcactgcgggacagacct--------ctgctccaacc-tca
A0A087X830_MCL1-01      cttgct------ctggataaccagccggaca----atatggggtttgtta
A0A087X9B7_BCL2L1-      cttcacagcacgctgcacatcacaccggccaccgcctaccagagct-tcg
A0A087YBW4_BCL2L1-      tttccttgca-gctggacatcacccccgacacggcctaccagagct-tca
                         **         ***     *   **          *          *  

A0A096ME02_BCL2L10      gaaaggtgatggatgagatggtgggagatggacattttaactgggggagg
A0A087X830_MCL1-01      cggaagtagcagagaatctcttttcagacgggaccaccaactggggtcgg
A0A087X9B7_BCL2L1-      agaacgtgatggacgaggtgttccgggacgg---cgtcaactggggccgc
A0A087YBW4_BCL2L1-      agaccgtgctggatgagttgttcaagggtga---ggtcaactggggtcgg
                             **    **  *  *  *    *  *        ********  * 

A0A096ME02_BCL2L10      gtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcggga
A0A087X830_MCL1-01      atcgtcagcctggtggcgttcggggctgcagtg----------tgtcagc
A0A087X9B7_BCL2L1-      atcgtggggctcttcgcgtttggtggcgcgctc----------tgcgtgg
A0A087YBW4_BCL2L1-      gtggtggccatgtttacctttgggggaattctg----------tgtgtgg
                         * **     *  *  * ** *  *      *           **   * 

A0A096ME02_BCL2L10      a-------cagacgggcaagaac------------ccggggccggactcc
A0A087X830_MCL1-01      a------cctgaaggagaggggcagagagcattgcgtggagctggtgagc
A0A087X9B7_BCL2L1-      aatgcgttgagaaggagatgagc---------------cacctggtagcc
A0A087YBW4_BCL2L1-      attgcgttcagaagaatatgagt---------------gagctggtctcc
                        *         ** *   * *                     * **    *

A0A096ME02_BCL2L10      gggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggc
A0A087X830_MCL1-01      a-------------------------------------------------
A0A087X9B7_BCL2L1-      agga------------------------------------------ttgt
A0A087YBW4_BCL2L1-      cgca------------------------------------------ttgc

A0A096ME02_BCL2L10      ggagaccattgctgatta---cctggagaagcacaaaaaagactggctgc
A0A087X830_MCL1-01      --aggaaatatccacgtatctcctggaaaaccagcggga---ctggctag
A0A087X9B7_BCL2L1-      agagtggatgaccgtcta---cttggatgagcggattgaaccttgggtgg
A0A087YBW4_BCL2L1-      cgaatggatgaccactta---cctggacgagcagctcaatccctggatcc
                          *    **  *    **   * ****  * *      *    *** *  

A0A096ME02_BCL2L10      aggaaaataatggatgggacgggttt---------tgtagctacgcccac
A0A087X830_MCL1-01      caaaaaacaactcatgggagggctttgtggagttctttagagtatcagat
A0A087X9B7_BCL2L1-      agagccaaggaggatgggaccgtttcgctgagatcttcgg------gggc
A0A087YBW4_BCL2L1-      aaagccagggaggatgggaccgcttcgctaacctgtacgg------ccag
                              *      ******  * **          *   *          

A0A096ME02_BCL2L10      aacgccagagaagtaag---------tcaggactcctccatgaagacggc
A0A087X830_MCL1-01      cctgagtctacagtgag--gaacacgctgatggcgtttgttggggtcgct
A0A087X9B7_BCL2L1-      aacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggct
A0A087YBW4_BCL2L1-      gatgccgctgcagagggccggaggtttcgggagaccttgaacaaatggct
                           *       **   *                   *          *  

A0A096ME02_BCL2L10      gctggttgctg---------tcgccggagtcggcatcgcagggctcacct
A0A087X830_MCL1-01      ggtattgggg----------caacattagcctttctcatcaggt------
A0A087X9B7_BCL2L1-      gctgctggggatgagtgtggtgac---ggccttcatagccgggtccatct
A0A087YBW4_BCL2L1-      gctagtcggtgtggctctgctgaccggagctctgctcgtcatgt---tcg
                        * *  * *               *    *      *      *       

A0A096ME02_BCL2L10      tccttctggtgcgctag---
A0A087X830_MCL1-01      ------------------ga
A0A087X9B7_BCL2L1-      tcgcccagaagcgcctgtga
A0A087YBW4_BCL2L1-      tcgctaagaaacg---atga

© 1998-2020Legal notice