Dataset for CDS BAX of Organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


L8IM55_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
L8IM55_BAX-01      ----atgagacc------ccattctgattctgtatccccg-caactccg-----------
                       * * * **      * *  * **  * *    ***  ** *** *           

L8IM55_BAX-02      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggggga
L8IM55_BAX-01      --------------ttcccaccctagtttcatccaggatcgagcagggcgaatgggggga
                                 **  *  *   ***********************************

L8IM55_BAX-02      gagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagc
L8IM55_BAX-01      gagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagc
                   ************************************************************

L8IM55_BAX-02      gagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
L8IM55_BAX-01      gagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
                   ************************************************************

L8IM55_BAX-02      gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
L8IM55_BAX-01      gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
                   ************************************************************

L8IM55_BAX-02      tccgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
L8IM55_BAX-01      tccgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
                   ************************************************************

L8IM55_BAX-02      gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggaca
L8IM55_BAX-01      gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggaca
                   ************************************************************

L8IM55_BAX-02      ttggacttccttcgagagcggctgctgggctggatccaggaccagggtggttg-------
L8IM55_BAX-01      ttggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgaga
                   *****************************************************       

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      cctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccacc
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      ataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagg
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      gtgcccaatgacctgtccatgacccttgacctcctcatgacctctgacctcctagtgacc
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      cctgacccgatgcctcgctgccctccctggtgcctccctccaattcctctggaatccctc
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      aagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccct
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      ctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgatg
                                                                               

L8IM55_BAX-02      ------------------------ggacggcctcctctcctactttgggacacccacatg
L8IM55_BAX-01      aagtgcctgctgtccctgtccccaggacggcctcctctcctactttgggacacccacatg
                                           ************************************

L8IM55_BAX-02      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
L8IM55_BAX-01      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
                   ************************************************************

L8IM55_BAX-02      gatgggctga--------------------------------------------------
L8IM55_BAX-01      gatgggctgaggccatcaactgccttggactttttctgcataaattatggcatttttcag
                   **********                                                  

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      gggggtggggcggatttgggggccatgggagtttttcttacttttttaattattggggtg
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      gggcagggtagggaggcgtggtcttggggggtgggcacaataaacctctttcggaccaca
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      ctttggagtctgagtcactgggcccgcttcctggctgtcgcaggagaccaggcttcatgc
                                                                               

L8IM55_BAX-02      ------------------------------------------------------------
L8IM55_BAX-01      gctgacccatctttttctgagggtaaccagtgccctctgtgggtcagtggcgagttaaat
                                                                               

L8IM55_BAX-02      ------------------------------------------------------
L8IM55_BAX-01      tgtggctctgccctcaaggagcccacagtcctgaggggaactgaggcggcttga
                                                                         

© 1998-2020Legal notice